Download Lecture 14 Cloning and Expression E. coli Expression System

Lecture 14
Cloning and Expression
Expression Systems
Bacterial: Escherichia coli , Bacillus subtilis
Mammalian : animal cells
Others: Saccharomyces cerevisiae, Insect cells
Factors considered when choosing an expression system
•
•
•
The size of protein
The amount of protein needed
Whether active protein is needed
E. coli Expression System
1. Choosing a promoter and vector system
2. Fusion proteins
3. Insoluble proteins
4. Optimization of expression of foreign proteins
5. Competent cells and transformation
The Nobel Prize in Physiology or Medicine 1965
"for their discoveries concerning genetic control of enzyme and virus synthesis"
François Jacob
Institut Pasteur Paris, France
1920b
From the early 1950's Jacques Monod, at the Pasteur Institute in Paris, had been studying the ability of E. coli to
adapt to grow on different sugar sources. In particular, he studied the ability of E. coli to metabolize lactose. This
depended on the ability of the cells to synthesize the enzyme ß-galactosidase. Later on, it was found that ßgalactoside permease was needed, too).
André Lwoff
Institut Pasteur Paris, France
1902-1994
Jacques Monod
Institut Pasteur Paris, France
1910-1976
Operon model and lac operon
(i) Operon model of Francois Jacob and Jacques Monod: the model consists of a regulator gene, operator site
and a set of structural genes in order to explain the parallel regulation of β-galactosidase, permease, and
transacetylase. (ii) Lactose operon or lac operon: i encodes gene for repressor, o is operator site, z, y, a are
structural genes for β-galactosidase, permease, and transacetylase, respectively. p is promoter site. z, y, a give
a polycistronic (or polygenic) transcript.
The lac operator, nearly perfect inverted repeat, 2-fold rotational symmetry.
An operon is a cluster of genes that are transcribed as a single mRNA. Genes in an operon code for a diffusible gene product which may be a polypeptide
or an RNA molecule.
Lac repressor binding to operator DNA (Kd=10-13) or 0.1 pM.
The binding of the α-helix into the major groove of DNA.
E. coli genome has one lac operator (blue) but many pur operator (red).
20 pur or purine operators for 19 operons and 25 genes
When glucose is scarce, E. coli use lactose as the carbon source.
β-galactosidase will be induced to break down lactose.
$
The enzyme activity can be measured by X-gal assay. In the presence of lactose, β-galactosidase
constitutes 6.6% of total protein synthesized.
(i)
(ii)
in the absence of lactose, repressor binds at o site and represses transcription from the lac operon.
IPTG binds to the repressor so that it cannot bind to O site, and transcription can start.
DNA
Inducer such as IPTG (isopropylthiogalactoside) or allolactose will bind to the
repressor and alter its binding domain so that
it cannot bind to o site, and thus RNA pol can
transcribe the lac mRNA.
Domain for a large class of proteins
including taste proteins.
IPTG
IPTG-inducible vector
pGEM series (Promega),
pGEX series (Pharmacia),
pKK223-3 (Pharmacia),
pMEX (US Biochemicals),
pTrc99A (Pharmacia),
pMAL (New England Biolabs).
IPTG-inducible promoter: pGEM
Used for in vitro transcription and protein expression. The vector encodes the LacZ α-peptide and β-lactamase and
contains restriction site, lac O, T7, SP6 initiation sequence, promoter with efficient ribosome-binding site (ATG +
Shine-Dalgarno sequence, complementary to 16S rRNA 3’-terminal), t terminator or RNase III site (stabilize mRNA,
facilitate translation). IPTG-inducible promoter can lead to an expression level exceeds 30% of total protein.
E. coli strains:
The strain should carry either the lacIq or lacIq1 allele. If the plasmid contains lacIq1 then any
strain is fine. lacIq or lacIq1 generate 10x repressor to prevent any leaky expression.
Promega
Bacteriophage T7 promoter
Bacteriophase T7 RNA polymerase, unlike E. coli RNA polymerase, is not
inhibited by rifampicin. Thus host genes can be turned off.
The T7 polymerase can only recognize the T7 promoter.
The T7 polymerase is a processive enzyme that will transcribe around a
circular plasmid several time and may transcribe genes that are not efficiently
transcribed by E. coli enzyme.
The bacteriophage T7 expression system
(1) T7 polymerase either on a λ vactor, a plasmid, or inserted into E. coli
chromosome.
(2) a plasmid vector equipped with a T7 promoter upstream of the gene
to be expressed.
(3) pET series from Novagen
The pET expression system
T7 phage expression vector: Expression vector containing the bacteriophage T7 promoter carrying colicin E1 replicon (colE1), MCS, with insert under
control of f10 promoter for T7 RNA polymerase or under the control of T7lac promoter. E. coli strains: HMS174(DE3) or BL21(DE3)
Vectors: pET series (Novagen: www.novagen.com). Expression system: (i) In lDE3 lysogens the T7 pol gene (T7 gene 1) under control of lacUV5
promoter, (ii) pET.pLysS or pLysE encode lysozyme which inhibits T7 pol under uninduced condition.
Fusion proteins
•
•
•
•
Attaching target protein to a domain to provide a tag
Topogenic signals to direct the protein to a cellular site
Adding “carrier” sequences to protect the protein
Adding “carrier” sequences to improve solubility
Affinity purification of fusion protein
fused partner
β-galactosidase
ProteinA
Glutathione-S-transferase
Maltose-binding protein
Chloroamphenicol
Acetyltransferase
Carbonic anhydrase
Cellulose-binding protein
Poly(histidine)
FLAG
Poly(arginine)
Poly(cysteine)
Poly(phenylanaline)
affinity resin
APTG
IgG
glutathione
crosslinked amylose
Chloroamphenicol-
Eluent
sodium borate (pH 10)
0.5 M acetic acid
5 mM GSH
10 mM maltose
chloramphenicol
Sepharose
sulfonamide-affinity resin
Tris-sulfate
cellulose
immobolized Ni
anti-FLAG
S-sepharose
water
imidazole
EDTA
NaCl gradient
thiopropyl-sepharose
mercaptoethanol or DTT
phenyl-sepharose
ethylene glycol
Cleavage of fusion proteins
Chemicals:
cyanogen bromide and 70% formic acid (-M/)
formic acid (70%) and heat (-D/P)
hydroxylamine pH9 and heat (-N/G-)
Enzymes:
ala-64 subtilisin (-GAHR/)
clostripain (-R/ and -KR/)
collagenase (-PV/GP-)
enterokinase (-DDDDK/)
Factor Xa (-IE(D)GR/)
renin (-PFHL/L-)
α-thrombin (-LVPR/GS-)
trypsin (-R/ or -K/)
Tev protease (-ENLYFQ/G-)
Glutathione-S-transferase (GST) gene fusion system
*
*
*
*
A tac promoter for chemically inducible, high-level expression.
An internal lac Iq gene for use in any E. coli host.
Very mild elution conditions for release of fusion proteins from the affinity matrix.
PreScission™, thrombin, or Factor Xa protease recognition sites for cleaving the desired protein from the fusion product.
GSH is attached to Sepharose 4B by coupling to the oxirane group
using epoxy-activation.
The binding capacity is about 8 mg/ml resin.
The elution condition is mild, 10 mM GSH.
Tac promoter is a functional hybrid derived from the trp and lac promoter (see de Boer et al., PNAS 80, 21-25, 1983
tac_promoter
TGACAATTAATCATCGGCTCGTATAATGT
Cellulose-binding domain
Beta sheet in CBD. W17 W54 and W72 in contact with cellulose.
Cellulose-binding domain vectors
pET with 3 CBD sequences (with His-tag, GST-tag, Ek=enterokinase, Xa=factor Xa, Thrombin cutting site).
Cellulose-binding domain
$
SDS-PAGE (4-20%), pET34 CBD BAP in
BL21(DE3) (37˚C, 1 total, 2 total+, 3
soluble 1.5 h, 4 soluble 3h, 5 soluble 4.5h,
6 insoluble 1.5 h, 7 insoluble 3h, 8
insoluble 4.5 h); pET36 BAP
BL21(DE3)pLysS (16h 30˚C, 1 total, 2
total+, 3 media, 4 media+, 5 periplasmic
+, 6 soluble +, 7 insoluble.
The FLAG technology
N- and C-cloning. Kit: (pFLAG vector, control vector, anti-FLAG monoclonal antibody,
biotinylated anti-FLAG antibody, FLAG affinity resin and column,
control FLAG-BAP, sequencing primers, FLAG peptide, host strain, enterokinase). 3 hosts
(E.coli, yeast, mammalian cells).
The FLAG technology
The FLAG technology
www.sigma-aldrich.com
The FLAG technology
Transformation
Chemical Methods: calcium chloride, other
variations include reducing agents, other
divalent cations, freezing and thawing, heat
shock, organic solvent shock etc (Hengen,
1996)
Physical Methods: electroporation
Competent cells
Competent cells
Improvement of competent cells: adding tRNA genes
that encode for rare E. coli codons