Download Identification of a mitochondrial ATP synthase small subunit gene

Journal of Experimental Botany, Vol. 57, No. 1, pp. 193–200, 2006
doi:10.1093/jxb/erj025 Advance Access publication 29 November, 2005
RESEARCH PAPER
Identification of a mitochondrial ATP synthase small
subunit gene (RMtATP6) expressed in response to
salts and osmotic stresses in rice (Oryza sativa L.)
Xinxin Zhang1,2, Tetsuo Takano2 and Shenkui Liu1,*
1
Alkali Soil Natural Environmental Science Center (ASNESC), Stress Molecular Biology Laboratory,
Northeast Forestry University, Harbin 150040, PR China
2
Asian Natural Environment Science Center (ANESC), The University of Tokyo, 1-1-1 Midori-cho,
Nishi-tokyo, Tokyo 188-0002, Japan
Received 14 August 2005; Accepted 21 October 2005
Abstract
Introduction
Large areas of northern China have alkaline soil due
to the accumulation of sodium carbonates (NaHCO3,
Na2CO3). To understand better how plants can tolerate
alkaline soil, a cDNA library was prepared from rice
(Oryza sativa L.) roots grown in the presence of
NaHCO3 stress. A cDNA clone isolated from this library
was identified by a homology search as a mitochondrial
ATP synthase 6 kDa subunit gene (RMtATP6; GenBank
accession nos AB055076, BAB21526). In transformed
yeast and tobacco protoplasts, the RMtATP6 protein
was localized in mitochondria using the green fluorescent protein (GFP) marker. Analysis of RMtATP6 mRNA
levels suggested that the expression of this gene was
induced by stress from sodium carbonates and other
sodium salts. Transgenic tobacco overexpressing the
RMtATP6 gene had greater tolerance to salt stress
at the seedling stage than untransformed tobacco.
Among the other genes for F1F0-ATPase of rice, some
were found to be up-regulated by some environmental
stresses and some were not. These data suggest that
the RMtATP6 protein acts as a subunit of ATP synthase, and is expressed in response to stress from
several salts, with the other genes coding for the
subunits of the same ATP-synthase.
Alkaline soil is a type of soil that has high levels of
carbonate salts. According to incomplete statistics of
UNESCO and FAO, 950 million ha (6.4%) of the world’s
land area has saline-alkali soil, and about one-tenth of this
area is found in China. The alkaline soils of China are
formed by the accumulation of NaHCO3 and Na2CO3
(Wang et al., 1993), the hydrolytic decomposition of which
raises the pH to above 9.0. The alkalinity results in a
hardened, poorly ventilated soil. Plants in severely alkaline
soil can barely survive. Only a few species of plants grow
in such soils and they are sparsely distributed. This limits
the development of agriculture and livestock husbandry.
Presently, an important policy in many parts of the world,
including China, is to exploit existing alkaline-tolerant
plants and to develop new ones. Therefore, there is interest
in breeding transgenic plants that are tolerant of alkaline
soil. In this study, some genes from a rice (Oryza sativa)
root cDNA library that was prepared from plants grown
under carbonate (NaHCO3) stress were isolated. One of the
genes was found to be the gene for a mitochondrial ATP
synthase 6 kDa subunit (RMtATP6; GenBank accession
nos AB055076, BAB21526).
Mitochondrial F1F0-ATP synthase is a multimeric enzyme, in which F1 is a hydrophilic sector carrying the
catalytic sites for ATP synthesis/hydrolysis and F0 includes
hydrophobic subunits embedded in the membrane so as to
constitute a proton channel (Fillingame, 1999; Pedersen
et al., 2000). Prokaryotes and eukaryotes have the same F1
structures which consist of five subunits designated a, b,
c, d, and e (Amzel and Pedersen, 1983), but somewhat
Key words: Carbonate stress, cloning, GFP, mitochondria, rice
mitochondrial ATP synthase 6 kDa subunit, transgenic, yeast.
* To whom correspondence should be addressed. E-mail: [email protected]
ª The Author [2005]. Published by Oxford University Press [on behalf of the Society for Experimental Biology]. All rights reserved.
For Permissions, please e-mail: [email protected]
194 Zhang et al.
different F0 structures (Boyer, 1997; Jones et al., 1998;
Kinosita et al., 1998; Mueller, 2000; Velours and Arselin,
2000). A major challenge is to understand how the F0
sector functions (Kinosita et al., 1998). Jansch et al. (1996)
resolved the mitochondrial F1F0-ATP synthase from potato (Solanum tuberosum) by blue native (BN)-PAGE
into two forms: the intact F1F0 complex (580 kDa) comprising 13 subunits and the separated F1 part (350 kDa).
The F1 section is composed of six polypeptides, and the
F0 section is composed of at least seven polypeptides with
apparent molecular masses of 27, 23, 20, 20, 15, 6, and 6
kDa. One of the two 6 kDa proteins is the F0 part
of complex V. The deduced amino acid sequence of
RMtATP6 is homologous to the 6 kDa protein from potato (Jansch et al., 1996). However, the function of this
small protein is not clear and its gene has not been
identified. Recently, Heazlewood et al. (2003b) purified
rice mitochondrial proteins using IEF/SDS–PAGE and
BN/SDS–PAGE. Among the isolated proteins is a 6 kDa
protein (spot 23 in BN-PAGE). This protein is part of F0
of the mitochondrial ATP synthase, and its gene corresponds to the RMtATP6 gene. In this study, the RMtATP6
gene was identified and its gene expression was characterized. Green fluorescent protein (GFP) was used as a marker
to study RMtATP6 protein localization in yeast and plant
cells. Overexpression of the gene in tobacco was found to
increase stress tolerance at the seedling stage.
Materials and methods
Plant materials
Rice (Oryza sativa L., cv. Nipponbare) seeds were surface-sterilized
with 70% ethanol for 1 min with constant agitation, washed at least
three times with autoclaved water, immersed in autoclaved water at
30 8C for 24 h, and germinated in a culture room maintained at 25 8C
with 80% humidity under a 12/12 h light/dark cycle. The roots of
7-d-old seedlings were immersed in 30 mM NaHCO3 for 24 h and
then harvested for cDNA library construction. In addition, the 7-d-old
seedlings were divided into five groups. The roots of each group were
immersed in one of five solutions (H2O, 80 mM NaCl, 30 mM
NaHCO3, 15 mM Na2CO3, 10% PEG 6000) for 24 h, and then the
leaves and roots were harvested for northern and semi-quantitative
RT-PCR analyses.
Construction and screening of the rice root cDNA library
Poly(A)+ RNA extracted from rice roots was used to construct
a cDNA library in the E. coli expression vector kTriplEx2 using
a SMART cDNA Library Construction Kit (Clontech) according to
the manufacturer’s instructions. The rice root expression cDNA
library was plated on LB medium containing 120 mM NaHCO3.
About 3000 E. coli cells were inoculated on each plate (U=90 mm).
After incubation overnight at 37 8C, a few carbonate-resistant E. coli
clones were transferred to grow on LB medium containing 125 mM
NaHCO3 at 37 8C overnight. Faster growing colonies were picked
and incubated with LB liquid medium. Plasmid DNA was prepared
by the alkali method and sequenced. The GenBank database was
searched for homologous sequences with the BLAST algorithm.
DNA sequence analysis
The sequences of the RMtATP6 clone and other clones were determined from DNA cycle sequencing reactions, which were performed
with fluorescent dye terminators followed by product analysis on an
automated model 377 DNA sequencer.
Northern blot analyses
For northern blot analysis, 10 lg total RNA was electrophoresed on
a 1% formaldehyde agarose gel and blotted onto a nylon membrane.
RNA blot analyses were performed using a digoxigenin (DIG)labelled RMtATP6 cDNA probe. The membrane was hybridized and
washed according to Sambrook et al. (1989). Hybridization signals
were detected with CDP-Star (Tropix) using the ImageMaster VDSCL system (Amersham Pharmacia).
Construction of expression vectors and transformation
The RMtATP6 fragment was ligated to the pBI121 binary vector
(Clontech) that had been digested with SmaI and SacI to construct the
plasmid pBI121-RMtATP6. The GFP gene was digested from the
plasmid pEGFP (Clontech) by BamHI and NotI, and the GFP
fragment was ligated into BamHI/NotI sites in pYES2 (Clontech) to
construct the plasmid pYES2-GFP. The RMtATP6 gene was
amplified by PCR with sense primer 59-CGTAAGCTTAGATCGAGGATGGTT-39 (HindIII site underlined) and antisense primer
59-CGGGATCCCGGGCTTCTTGTG-39(BamHI site underlined),
and the RMtATP6 fragment was ligated into the HindIII/BamHI sites
in pYES2-GFP to construct the plasmid pYES2-RMtATP6-GFP. The
GFP and RMtATP6-GFP genes were amplified by PCR with sense
primer 59-TCCCCCGGGAGATCGA GGATGGTT-39 (SmaI site
underlined) and antisense primer 59-CCGGAGCTC TTACTTGTACAGCTC-39 (SacI site underlined). The GFP fragment was cloned
into the SmaI/SacI sites in pBI121 vector to construct the plasmid
pBI121-GFP. The RMtATP6-GFP fragment was blunt ended with
a Klenow fragment, and was cut with SacI and ligated into pBI121 to
construct the plasmid pBI121-RMtATP6-GFP. The plasmids pYES2GFP and pYES2-RMtATP6-GFP were transformed into competent
yeast strain INVSc1 using the electric impulse method. The plasmids
pBI121-RMtATP6, pBI121-GFP, and pBI121-RMtATP6-GFP were
transformed into Agrobacterium tumefaciens strain EHA105.
Staining of mitochondria and analysis by confocal
microscopy
Yeast cells in the mid-log phase were incubated without fixation in
YPGR medium (1% yeast extract and 2% peptone+2% galactose
and 1% raffinose) containing 100 nM MitoTracker Red CmxRos
(Molecular Probes) for 45 min at 30 8C with gentle shaking and washed
three times before confocal analysis. Protoplasts were incubated in
culture medium with 400 nM MitoTracker for 40 min at 28 8C, and
washed three times before confocal analysis. Confocal microscopy
was performed with a FV500 laser-scanning confocal imaging system
(Olympus, Japan). GFP fluorescence was detected between 505 nm
and 550 nm with excitation at 488 nm. MitoTracker staining was
detected between 585 nm and 615 nm with excitation at 568 nm.
Transformation of tobacco
The RMtATP6, GFP genes and the RMtATP6-GFP fusion gene were
separately cloned in the plant transformation binary vector pBI121.
Each gene was placed under the control of the CaMV 35S promoter
with nptII as the selectable marker. To transform tobacco (Nicotiana
tabacum) leaf discs, the recombinant plasmids were introduced into
Agrobacterium tumefaciens strain EHA105. Agrobacterium-mediated
transformation of tobacco was performed per standard protocol
(Rogers et al., 1986). Integration of the transgene in different lines
was confirmed by PCR and Southern blot analysis. Expression of the
Rice mitochondrial ATP synthase small subunit gene
introduced gene was evaluated with an RNA blot analysis using RNA
from young leaves and roots. Transgenic tobacco protoplasts were
prepared from calli and roots as described (Carneiro et al., 1993).
Transgenic plants and salinity stress tolerance
To assess the relative salinity tolerance of various plants, wild-type
(WT) and T1 generation transgenic seeds over-expressing the
RMtATP6 gene were germinated in 1/2 strength MS medium
containing 0 and 50 mg lÿ1 kanamycin, respectively. The surviving
seedlings (30-d-old) were transferred onto fresh 1/2 MS medium
with one of four salt solutions (150 mM NaCl, 200 mM NaCl,
5 mM NaHCO3, and 7.5 mM NaHCO3) to impose salinity stress
or onto plain 1/2 MS medium as a control. The seedlings were
maintained under culture room conditions, and their growth under
stress was monitored for 25 d. Root length was measured 25 d after
the salt treatments.
Semi-quantitative RT-PCR analysis
Total RNA (50 ng) was added to a 20 ll reverse transcription mixture
for first-strand cDNA synthesis, using the RT-PCR kit (ReverTra
DashTM) (Toyobo, Japan) according to the manufacturer’s instructions. After a 30-fold dilution, 1 ll of the reverse transcripts was
added to a 50 ll PCR mixture. Annealing temperature was calculated
according to the nucleotide composition of the primers and the
general program was 30 cycles of 94 8C (30 s), 57.8 8C (1 min) and
72 8C (1 min), followed by an extended incubation at 72 8C for
10 min. The PCR products (15 ll) were then electrophoresed in
a 1.2% ethidium bromide (EB)-agarose gel and viewed under UV.
Rice actin1 transcripts were used as internal standards. The primers
used are listed in Table 1 (sense and antisense, respectively). The
ImageMaster TotalLab software (Amersham Pharmacia) was used
to measure the intensity of each band. The ratio intensity of the
bands relative to the normal condition (CV) was shown.
195
Table 1. PCR primers used in semi-quantitative RT-PCR
amplification
Target genea
GenBank
accession no.
Sense and antisense primers (59-39)
RMtATP6
AB055076
RMtATPa
X51422
RMtATPb
D10491
RMtATP9
X16936
RMtATPd1
AK070990
RMtATPd2
AK068050
Actin1
X15865
AGGAGGAGATCGAGGATGTT
ACCAGCTGTTCCTTCACCAT
GGCTTACAGAAGTGCCCAAA
GAACAACCGCTGGGATTCTT
GTGGTGTCCAAAGGGTTCTT
TCTATGAAGCCGACTCCTTG
AGCTGCGAAAGAAAAGCCGT
GGCCTCGTATCTCTATTTGC
CGAGGGAAACGATATCACCA
CCCATCATCCATGAGTTTGC
TTGACTGGGAGTACTACAGA
GTTCCTCCACTCTTCAGTAG
CTCATGAAGATCCTGACGGA
CACCACTGAGAACGATGTTG
a
RMtATPa, RMtATPb, RMtATP9, RMtATPd1, and RMtATPd2 are,
respectively, the rice (Oryza sativa L.) mitochondrial ATP synthase
a-, b-, 9, d1-, and d2-subunit genes. Actin1 is the rice (Oryza sativa L.)
actin1 gene.
Results
Sequence analysis and identification of the
RMtATP6 gene in rice
The RMtATP6 gene was isolated as described in the
Materials and methods. The length of the RMtATP6 cDNA
is 505 bp. Sequencing revealed that RMtATP6 cDNA contains a major GC-rich (62%) open reading frame (ORF) of
174 nucleotides (85–258) encoding a protein of 58 amino
acids. The open reading frame encodes a predicted 58 amino
acid protein with a calculated molecular mass 6578 Da. The
TMpred method predicted the RMtATP6 protein has a
strong transmembrane domain (Fig. 1). The amino acids at
the boundary of the mitochondrial targeting sequence are
SRFDPW which are shown in a rectangle in Fig. 2.
The BLAST algorithm identified two proteins with
similarity to RMtATP6 (Fig. 2). One is from Arabidopsis
thaliana (At3g46430; 76% amino acid identity) and the
other is from potato (Solanum tuberosum) (ID: P80497;
73% amino acid identity). RMtATP6 corresponds to a
6 kDa protein from the F0 part of rice mitochondrial ATP
synthase (Heazlewood et al., 2003b) and thus appears to be
the mitochondrial ATP synthase 6 kDa subunit. According
to the computer program PSORT, the intracellular localizations of RMtATP6 with the highest certainties were
Fig. 1. Transmembrane region of RMtATP6 protein as determined by
the TMpred method. A putative transmembrane domain is indicated by
the Roman numeral ‘I’.
Fig. 2. Comparison of the amino acid sequences of the RMtATP6
proteins of rice (Oryza sativa L.), Arabidopsis thaliana, and potato
(Solanum tuberosum).
the mitochondrial intermembrane space (0.827), microbody peroxisome (0.640), mitochondrial matrix space
(0.605), and mitochondrial inner membrane (0.310). These
results further suggest that RMtATP6 is located in rice
mitochondria.
196 Zhang et al.
Fig. 3. RMtATP6-GFP fusion protein is located at specific sites of mitochondria in yeast. RMtATP6 was cloned in frame at the C-terminus with the
GFP gene in the pYES2 vector and expressed in the yeast strain INVSc1. Live cells were incubated with MitoTracker, and the localization of RMtATP6GFP was observed with a confocal microscope. (a–c) Expression of the RMtATP6-GFP fusion constructs in yeast; (d–f) expression of the GFP protein in
yeast. Scale bars, 2 lm.
Fig. 4. Targeting of the GFP fusion proteins to tobacco protoplasts. (a–c) Expression of the GFP protein in tobacco callus protoplasts; (d–f) expression
of the RMtATP6-GFP fusion protein in tobacco root protoplasts; (g–i) expression of the RMtATP6-GFP fusion protein in tobacco callus protoplasts. The
GFP column shows the signal detected in the green channel; the MitoTracker column shows the signal detected in the red channel; the GFP+MitoTracker
column corresponds to the merging of the green and red channels, in which yellow represents the superposition of green and red. Scale bars, 10 lm.
Rice mitochondrial ATP synthase small subunit gene
197
Intracellular localization of RMtATP6 protein using
a GFP fusion in yeast and tobacco cells
To determine whether RMtATP6 is localized to mitochondria, a fusion gene was constructed which encodes a protein
with the GFP at the C terminus of the RMtATP6 protein and
it was introduced into yeast and plant cells. The fusion protein
was expressed in the yeast strain INVSc1, and its localization
was analysed with a laser confocal microscope. The mitochondria were visualized with MitoTracker, a mitochondriaspecific dye for living cells. As a control, a construct
encoding GFP was used to study its targeting in yeast cells
(Fig. 3d–f). The green fluorescence of GFP was almost
evenly distributed throughout the yeast cells (Fig. 3d). The
localization signal was not consistent with the mitochondrial
localization signal (red fluorescence area) (Fig. 3e, f). This
result indicates the GFP is not targeted to a specific site in
yeast cells. The RMtATP6-GFP fusion protein is evenly
distributed throughout the mitochondria, as can be observed
by RMtATP6-GFP/MitoTracker double staining (Fig. 3a–c).
The RMtATP6-GFP gene was cloned into the plant
expression vector pBI121 to study the localization of
RMtATP6 in a tobacco plant (Nicotiana tabacum). The
fusion gene was placed under the control of the CaMV 35S
promoter. In the confocal microscopy analysis of the
transgenic plants, GFP fluorescence was visible throughout
the cytosol (Fig. 4a, b). In root protoplasts transformed
with the RMtATP6-GFP construct, microscopic analysis of
GFP expression revealed a punctate pattern of fluorescence
(Fig. 4d), which was also labelled by the fluorescence of
MitoTracker (Fig. 4e). Colocalization is shown by yellow
in the merged image in Fig. 4f, and shows that the
RMtATP6-GFP fusion protein is in mitochondria. Callus
protoplasts transformed with the RMtATP6-GFP construct
showed fluorescence in mitochondria (Fig. 4g–i). These
results show that RMtATP6 is localized in the mitochondria
of protoplasts of tobacco roots and calli.
RMtATP6 gene expression responds to
environmental stresses in rice
RMtATP6 gene expression was induced by both salts (80 mM
NaCl, 30 mM NaHCO3, 15 mM Na2CO3) and osmotic
stress (exposure to 10% PEG 6000) in both leaves (Fig. 5A)
and roots (Fig. 5B). In roots, expression was strongly
induced by NaCl, Na2CO3, and PEG. In the presence of
30 mM NaHCO3, transcript levels of the RMtATP6 gene in
leaves peaked at 12 h, and remained high until 24 h (Fig.
5C), and those in roots increased from 6 h to 24 h (Fig. 5D).
Salt stress tolerance of transgenic tobacco seedlings
harbouring RMtATP6
Three independent transgenic lines (T31, T32, T40) of
tobacco were first confirmed to harbour pBI121-RMtATP6
by PCR using genomic DNA as templates (Fig. 6A).
Northern analyses further showed that each of these lines
constitutively expressed RMtATP6 in leaves (Fig. 6B) and
Fig. 5. Northern blot analysis of RMtATP6 gene expression in rice
(Oryza sativa L.). Total RNA was separated on an agarose gel, blotted
onto a nylon membrane, and hybridized with a DIG-labelled RMtATP6
probe. Ethidium bromide-stained RNA bands indicate that equal amounts
of RNA were loaded. (A, C) 10 lg of total RNA from leaves, (B, D) 10 lg
of total RNA from roots. (A, B), Lane 1: control, lanes 2–5: treated,
respectively, by 80 mM NaCl, 30 mM NaHCO3, 15 mM Na2CO3, 10%
PEG 6000, for 24 h. (C, D), Lane 1: control, lanes 2–4: treated,
respectively, by 30 mM NaHCO3 for 6 h, 12 h, or 24 h.
roots (Fig. 6C). In order to investigate the biological
role of RMtATP6 in salinity tolerance, three lines of the
T1 generation transgenic seedlings over-expressing the
RMtATP6 gene were selected and compared with WT
plants in salt-tolerance tests. WT and the three independent
transgenic lines (T31, T32, T40) showed comparable growth
in the absence of salts (Fig. 6D). However, in the presence
of NaCl and NaHCO3, the growth of WT plants was reduced compared with that of the transgenic lines. The root
length of stressed transgenic plants was longer compared
with that of WT, as reflected on visual inspection (Fig. 6E–
H) and quantitative estimation (Fig. 7). When plants were
grown on medium containing 150 mM NaCl, 200 mM
NaCl, 5 mM NaHCO3 and 7.5 mM NaHCO3, the root
lengths of the three transgenic plants were about 4.6;6,
3.7;4.1, 4.6;5.7, and 3.2;4.1-fold, respectively, of that
in the WT plants (Fig. 7).
Semi-quantitative RT-PCR analysis
The stresses had different effects on the transcript levels of
the genes encoding the other mitochondrial F1F0-ATPase
subunits of rice (Fig. 8). The expressions of RMtATPa and
RMtATPb in leaves and roots were hardly affected by the
various stress conditions. The expression of RMtATP9 in
leaves was little affected under several stresses, but the
expression of RMtATP9 in roots clearly decreased by
treatment with Na2CO3 and PEG. Stress treatments with
198 Zhang et al.
Fig. 6. (A) PCR detection of RMtATP6 transgenic T1 generation tobacco plants (T31, T32, T40). CK is positive control, and WT is the wild-type
tobacco. Bands indicated by an arrowhead are 200 bp fragments of RMtATP6 gene. The position and size (kb) of DNA markers are indicated. (B, C)
Northern analysis of RMtATP6 expression in leaves and roots of wild-type (WT) and transformed (T31, T32, T40) tobacco. A DIG-labelled RMtATP6
probe was used for hybridization. (D–H) Relative salt tolerance of WT and RMtATP6-overexpressing transgenic T1 generation tobacco plants (T31, T32,
T40) at the seedling stage. Seedlings were grown on medium supplemented with 0 (D), 150 mM NaCl (E), 200 mM NaCl (F), 5 mM NaHCO3 (G), and
7.5 mM NaHCO3 (H) for 25 d.
NaCl and NaHCO3 induced the expressions of RMtATPd1
and RMtATPd2 in leaves, but the expression of these two
genes in roots was clearly decreased by treatment with
Na2CO3. Expression of RMtATP6 was increased in leaves
by treatment with NaCl, NaHCO3, Na2CO3, and PEG, and
was increased in roots by treatment with NaCl and PEG.
Discussion
The compositions of the yeast and mammalian mitochondrial ATP synthase complex subunits have been extensively studied, while much less is known about the plant
complex. Several studies have purified and partially
sequenced components of F1F0-ATP synthase from spinach
(Hamasur and Glaser, 1992), potato (Jansch et al., 1996),
and Arabidopsis (Kruft et al., 2001; Millar et al., 2001).
These previous works have mainly identified F1 subunits,
and some of the corresponding genes from these species
have been sequenced. However, the compositions of the
plant mitochondria F0, in contrast, are largely unknown.
Recently, four subunits in the F0 part of Arabidopsis
mitochondrial ATP synthase were identified, which were
subunit 9, d subunit, orf B and orf 25, but the function is
not clear (Heazlewood et al., 2003a). So it is important to
study the structures of the plant mitochondria F0 subunit,
which will help in understanding its role in ATP synthase.
In this study, the RMtATP6 gene was identified as a rice
mitochondrial ATP synthase 6 kDa subunit gene. This
subunit was separately purified from the F0 part of mitochondrial F1F0-ATP synthase of potato (Solanum tuberosum)
and rice (Oryza sativa L.) by blue native (BN)-PAGE (Jansch
et al., 1996; Heazlewood et al., 2003b). An Arabidopsis
protein (At3g46430) was found which had 76% amino
acid identity with RMtATP6, although the protein was not
identified in the F0 component of Arabidopsis (Heazlewood et al., 2003a). Use of GFP as a marker also showed
that RMtATP6 is targeted to mitochondria (Figs 3, 4). A
BAC clone of rice chromosome 3 was also found which
contained the nucleotide sequence of RMtATP6 (BAC
OSJNBa0091E13; GenBank accession no. AC133860).
Genomic Southern hybridization showed that there is
only one RMtATP6-like gene in rice (data not shown).
Therefore, RMtATP6 is encoded by the nuclear genome
and functions in mitochondrial F1F0-ATP synthase.
Rice mitochondrial ATP synthase small subunit gene
Fig. 7. Salts effects on the root length of WT and RMtATP6overexpressing transgenic T1 generation tobacco plants (T31, T32, T40).
Seedlings were grown on medium supplemented with 0, 150 mM NaCl,
200 mM NaCl, 5 mM NaHCO3, and 7.5 mM NaHCO3 for 25 d.
Root length was measured 25 d after salt treatment. Values are means
6SD (n=9).
199
The transcript level of the RMtATP6 gene showed that it
was induced by several abiotic stresses (Fig. 5). Moreover,
transgenic tobacco over-expressing RMtATP6 displayed
enhanced tolerance to salt stresses from NaCl and NaHCO3
(Figs 6, 7). These results suggest that the RMtATP6 gene plays
an important role in the response to salt and osmotic stress.
Little is known on the response of expression of F1F0ATPase subunit genes against environmental stresses.
Sweetlove et al. (2002) exposed Arabidopsis cells to
oxidative stresses, and found that the ATP synthase asubunit and b-subunit was significantly decreased by the
stress treatments. The authors speculated that the ATP
synthase subunits are the greatest casualties of oxidative
stress. Christie et al. (2001) reported that exposure of wheat
(Triticum aestivum) to aluminium increased mitochondrial
F1F0-ATPase activity only in the aluminum-tolerant wheat
variety, although the level of transcript encoding the asubunit of F1F0-ATPase remained constant. They considered that the up-regulation of ATP synthase activity
was an adaptive response involved in aluminium tolerance.
In this study, to understand better the function of RMtATP6 as a subunit of mitochondrial F1F0-ATPase under
environmental stresses, the transcript levels of the genes
encoding the other subunits of rice mitochondrial F1F0ATPase were examined under various stress conditions
by semi-quantitative RT-PCR analyses. In this study, there
was little or no effect of salt stress on the expression of the
Fig. 8. (A) Induction of RMtATP6, RMtATPa, RMtATPb, RMtATP9, RMtATPd1, and RMtATPd2 by NaCl (80 mM), NaHCO3 (30 mM), Na2CO3
(15 mM), and 10% PEG treatments in rice leaves and roots as measured by semi-quantitative RT-PCR. Rice actin1, loading control. PCR products were
visualized on agarose gels stained with ethidium bromide. (B) Quantitative analyses of expression levels corresponding to (A). The ImageMaster
TotalLab software was used to measure the intensity of each band. The ratio intensity of the bands relative to the normal condition (CV) was shown.
200 Zhang et al.
a-subunit, which was the same as the response to Al stress
(Christie et al., 2001); the b-subunit and 9 subunit of F1F0ATPase were observed, respectively (Fig. 8). On the other
hand, the level of transcript encoding the 6, d1-, d2-subunits
of F1F0-ATPases increased with salt stress. The a-subunit,
b-subunit, d1-subunit, and d2-subunit are the parts of the
F1-complex, which is a catalytic portion of ATP synthase,
whereas the 6 subunit and 9 subunit are parts of the F0complex which performs the proton translocation needed
for ATP synthase activity. Although the change in F1F0ATPase activity has not been analysed in this study, the upregulation of the level of transcript encoding the subunits
of F1F0-ATPases may indicate a response of rice to maintain the activity of F1F0-ATPases under damage suffered
from environmental stresses. Because the over-expression
of the RMtATP6 gene greatly improved the salt-tolerance of
transgenic tobacco plants, increased RMtATP6 must have
a role to keep or intensify the activity of the F1F0-ATPase
under stress conditions, although the function of RMtATP6
in the complex of the F1F0-ATPase is not understood.
14-3-3 proteins are known as regulators of the H+ATPase. They are the highly conserved hydrophilic proteins and widely present in animal and plant cells (Aitken,
1996). Recently, Bunney et al. (2001) demonstrated that
14-3-3 proteins are present in the inner mitochondrialmembrane compartment and regulate the activity of
mitochondrial and chloroplast F1F0-ATPases via an interaction with the F1 b-subunit. The activity of ATP
synthases in both organellas is drastically reduced by
14-3-3 proteins. The authors suggested that 14-3-3 proteins
provide a mechanism to regulate the activity of ATP
synthase in response to environmental stresses. It will be
very interesting to know whether the 14-3-3 proteins also
regulate the activity of mitochondrial ATPase under salt
and osmotic stress conditions or not.
In the near future, the yeast two or three-hybridization
system will be applied to study the interaction between
RMtATP6 and other ATP synthase subunits, and to analyse
the ATP synthase activity of transgenic plant with the
RMtATP6 gene under environmental stresses, which will
help us to discover how the mitochondrial ATP synthase
activity is regulated and to understand the function of
RMtATP6 in the regulation of ATP synthase activity in
response to environmental stresses.
Acknowledgement
This work was supported by the National High Technology Research and Development Program (863 Program) from the People’s
Republic of China.
References
Aitken A. 1996. 14-3-3 and its possible role in co-ordinating multiple
signaling pathways. Trends in Cell Biology 6, 341–347.
Amzel LM, Pedersen PL. 1983. Proton ATPases: structure and
mechanism. Annual Review of Biochemistry 52, 801–824.
Boyer PD. 1997. The ATP synthase-a splendid molecular machine.
Annual Review of Biochemistry 66, 717–749.
Bunney TD, van Walraven HS, de Boer AH. 2001. 14-3-3 protein
is a regulator of the mitochondrial and chloroplast ATP synthase.
Proceedings of the National Academy of Sciences, USA 98,
4249–4254.
Carneiro VTC, Pelletier G, Small I. 1993. Transfer RNA-mediated
suppression of amber stop codons in protoplasts and transgenic
plants. Plant Molecular Biology 22, 681–690.
Christie AH, Allen GG, Gregory JT. 2001. Induction of vacuolar
ATPase and mitochondrial ATP synthase by aluminum in an
aluminum-resistant cultivar of wheat. Plant Physiology 125,
2068–2077.
Fillingame RH. 1999. Molecular rotary motors. Science 286,
1687–1688.
Hamasur B, Glaser E. 1992. Plant mitochondrial F0F1 ATP synthase. Identification of the individual subunits and properties of
the purified spinach leaf mitochondrial ATP synthase. European
Journal of Biochemistry 205, 409–416.
Heazlewood JL, Howell KA, Whelan J, Millar AH. 2003b.
Towards an analysis of the rice mitochondrial proteome. Plant
Physiology 132, 230–242.
Heazlewood JL, Whelan J, Millar AH. 2003a. The products of
the mitochondrial orf25 and orfB genes are F0 components in the
plant F1F0 ATP synthase. FEBS Letters 540, 201–205.
Jansch L, Kruft V, Schmitz UK, Braun HP. 1996. New insights
into the composition, molecular mass and stoichiometry of the
protein complexes of plant mitochondria. The Plant Journal 9,
357–368.
Jones PC, Jiang W, Fillingame RH. 1998. Arrangement of the
multicopy H+-translocating subunit c in the membrane sector of
the Escherichia coli F1F0-ATP synthase. Journal of Biological
Chemistry 273, 17178–17185.
Kinosita K Jr, Yasuda R, No Ji H, Ishiwata S, Yoshida M. 1998.
F1-ATPase: a rotary motor made of a single molecule. Cell 93,
21–24.
Kruft V, Eubel H, Jansch L, Werhahn W, Braun HP. 2001.
Proteomic approach to identify novel mitochondrial proteins in
Arabidopsis. Plant Physiology 127, 1694–1710.
Millar AH, Sweetlove LJ, Giege P, Leaver CJ. 2001. Analysis of
the Arabidopsis mitochondrial proteome. Plant Physiology 127,
1711–1727.
Mueller DM. 2000. Partial assembly of the yeast mitochondrial
ATP synthase. Journal of Bioenergetics and Biomembranes 32,
391–400.
Pedersen PL, Ko YH, Hong S. 2000. ATP synthase in the year
2000; evolving views about the structures of these remarkable
enzyme complexes. Journal of Bioenergetics and Biomembranes
32, 325–332.
Rogers SG, Horsch RB, Fraley RT. 1986. Gene transfer in plants:
production of transformed plants using Ti plasmid vectors.
Methods in Enzymology 118, 627–640.
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning:
a laboratory manual, 2nd edn. Cold Spring Harbor, New York:
Cold Spring Harbor Laboratory Press.
Sweetlove LJ, Heazlewood JL, Herald V, Holtzapffel R, Day DA,
Leaver CJ, Millar AH. 2002. The impact of oxidative stress on
Arabidopsis mitochondria. The Plant Journal 32, 891–904.
Velours J, Arselin G. 2000. The Saccharomyces cerevisiae
ATP synthase. Journal of Bioenergetics and Biomembranes
32, 383–390.
Wang ZQ, Zhu SQ, Yu RP, Li LQ, Shan GZ. 1993. The salinealkali soil of China. The Science Press, 1–305.