Download Towards the construction of Escherichia coli cell

Towards the construction of Escherichia coli cell-free
protein synthesis system platform
Sara Alexandra Peça de Sousa Rosa
Thesis to obtain the Master of Science Degree in
Biotechnology
Supervisor(s): Professor Luís Joaquim Pina da Fonseca
Examination Committee
Chairperson:
Supervisor:
Professor Arsénio do Carmo Sales Mendes Fialho
Professor Luís Joaquim Pina da Fonseca
Member of the Committee:
Professor Gabriel António Amaro Monteiro
July 2015
ii
Acknowledgments
I would like to express my gratitude to professor Luı́s Fonseca, for giving me the opportunity to work in a
subject that I fell in love with. I would like to thank to all my colleges of 7th and 8th floor, for all the help,
advice, and support. Without all of you I would not be able to finish my work. I would also like to thank
to Doctor Ana Azevedo and Sofia Duarte, for all the help and tips.
I would like to give a special thanks to Ana, Andreia, Cátia, Elsa, Pedro, Rita and Ricardo, for help
and support during the best and worst times. I also want to thank to Cláudia, for the time spent inside
IST walls.
Most of all, I would like to thank my mom and dad for all the support. I also want to thank to my
grandmother, for all the concern, and to my nieces, Beatriz and Margarida.
Finally, I want to thank Davide, for always being there. My words will be never enough to express my
gratitude towards you.
Thank you all.
iii
iv
Resumo
Sistemas produtores de proteı́nas livres de células são descritos como a expressão in vitro de proteı́nas
recombinantes sem o recurso a células vivas. Esta abordagem usa lisados celulares que contém
vários componentes quı́micos e biológicos necessários para a transcrição, tradução, enrolamento de
proteı́nas, e metabolismo energético; tudo o que é necessário para sintetizar directamente proteı́nas.
Contudo, existem problemas associados ao uso destes sistemas: capacidade de sintetizar com fiabilidade uma proteı́na activa numa plataforma universal, falta de uma plataforma rentável e escalável, e
incapacidade de realizar padrões de glicosilação. O objectivo principal deste trabalho é construir uma
plataforma robusta e rentável para sı́ntese de proteı́nas in vitro num sistema de transcrição e tradução
copulado. Neste trabalho, um modelo de DNA foi desenhado e purificado. Este foi purificado por lise
alcalina e cromatografia por interação hidrofóbica. Este método permite produzir em maior quantidade e com um menor custo. RNA de transferência foi purificado extraindo os ácidos nucleicos por
extração com fenol, separando o DNA com acetato de sódio e removendo os restante contaminantes
por cromatografia de troca aniónica. Aquando da produção do lisado S30, não foi possı́vel atingir a
concentração proteica necessária para ter um lisado activo.
Apesar de o objectivo principal, construir uma plataforma de produção de proteı́nas livre de células
reprodutı́vel não foi conseguido, foram dados alguns passos importantes para atingir esse objectivo.
No futuro, uma das prioridades é melhorar o método de produção de lisados para se obter um maior
rendimento a partir do sistema livre de células.
Palavras-chave:
Sistemas livres de células, Escherichia coli, lisado S30, Purificação de
tRNA, Purificação de plasmı́deo
v
vi
Abstract
Cell-free protein systems are described as the in vitro expression of recombinant proteins without the
use of living cells. This approach uses a cell lysate containing a wide array of biological and chemical
components for transcription, translation, protein folding, and energy metabolism; all required to directly
synthesise the target protein. However, there are some problems when using these systems: the ability
to reliably synthesize any biologically active protein in a universal platform, the lack of a cost-effective
and scalable platform, and the inability to carry out humanized glycosylation patterns. The main aim of
this work is to construct a robust and cost effective platform for in vitro protein synthesis in a coupled
transcription–translation system.
In this work, a DNA template was design and purified. The DNA template was purified using an
alkaline lysis and hydrophobic interaction chromatography. This method allows us to produce in higher
quantity and lower cost. The tRNA purification was achieved by extracting the nucleic acids by phenol
extraction, separate the DNA with sodium acetate, and remove the remaining contaminants by anion
exchange chromatography. When producing the S30 lysate, it was not possible to achieve the protein
concentration necessary to have a highly active lysate.
Although the main goal of creating a reproducible E. coli cell-free protein synthesis system platform
was not achieved, some major steps were taken towards this goal. In the future, one of the priorities is
to improve the lysate production method so that we get a better yield from the cell-free system.
Keywords: Cell-free systems, Escherichia coli, S30 lysate, tRNA purification, Plasmid purification, Cytomimic system
vii
viii
Contents
Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
iii
Resumo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
v
Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
vii
List of Tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
xiii
List of Figures
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xviii
Nomenclature . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xix
1 Introduction
1
1.1 State-of-the-art . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2
1.1.1 Cell-free Protein Synthesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2
1.1.2 cell lysates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
5
1.1.3 Cell free protein synthesis system templates . . . . . . . . . . . . . . . . . . . . .
9
1.1.4 Other components and Energy systems . . . . . . . . . . . . . . . . . . . . . . . .
12
1.1.5 Configurations of Cell-free systems . . . . . . . . . . . . . . . . . . . . . . . . . . .
17
1.1.6 Folding and post-translational modifications . . . . . . . . . . . . . . . . . . . . . .
20
1.1.7 History and applications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
22
1.1.8 Applications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
23
1.1.9
28
Synthetic biology frontiers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2 Objectives
31
3 Materials and Methods
33
3.1 Template preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
33
3.1.1 pEXP5-NT/GFP construction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
34
3.2 Agarose gel electrophoresis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
36
3.3 Cell transformation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
36
3.3.1 Preparation of chemically competent cells . . . . . . . . . . . . . . . . . . . . . . .
36
3.3.2 Transformation of chemically competent cells . . . . . . . . . . . . . . . . . . . . .
37
3.3.3 Cell banks preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
37
3.4 Plasmid production and purification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
37
3.4.1 Cell production . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
37
3.4.2 Alkaline lysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
38
ix
3.4.3 Plasmid purification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
38
3.4.4 HIC purification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
38
3.4.5 SEC purification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
39
3.4.6 Dialysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
39
3.4.7 Plasmid concentration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
39
3.5 tRNA purification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
39
3.5.1 Cell growth . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
39
3.5.2 Phenol extraction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
40
3.5.3 Contaminant removal . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
40
3.5.4 Anion-exchange chromatography . . . . . . . . . . . . . . . . . . . . . . . . . . . .
40
3.5.5 RNA electrophoresis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
41
3.5.6 tRNA concentration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
41
3.6 GFP production and purification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
42
3.6.1 Cell production . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
42
3.6.2 Cell lysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
42
3.6.3 HIC purification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
42
3.6.4 IMAC purification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
43
3.7 S30 Lysate preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
43
3.7.1 Cell production . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
43
3.7.2 Biomass processing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
44
3.7.3 Cell lysis efficiency determination . . . . . . . . . . . . . . . . . . . . . . . . . . . .
44
3.8 Cell free protein synthesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
45
3.8.1 Expressway cell-free kit . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
45
3.8.2 Cytomim system . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
45
3.8.3 Optimisation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
46
3.9 Protein analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
46
3.9.1 Protein concentration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
46
3.9.2 SDS-PAGE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
47
3.9.3 Western blotting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
47
3.9.4 Fluorimetry . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
48
4 Results and Discussion
49
4.1 Template preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
49
4.1.1 pEXP5-NT/GFP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
49
4.2 Plasmid purification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
51
4.2.1 Hydrophobic interaction chromatography . . . . . . . . . . . . . . . . . . . . . . .
52
4.2.2 Plasmid desalting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
54
4.3 tRNA purification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
57
4.4 GFP purification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
61
x
4.5 S30 lysate preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
63
4.6 Cell-free protein synthesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
67
5 Conclusions
73
Bibliography
89
xi
xii
List of Tables
3.1 Digestion tests. Four different tests were performed. In all tests, 1000 ng of plasmid and
0.5 of each enzyme (PvuII and SacII) were used. In the tests 1 and 2, 2 and 4µL of 10X
buffer were tested. The same volumes were tested for G 10X Buffer in 3 and 4. Water
was also added to achieve the volume of 20 µL
. . . . . . . . . . . . . . . . . . . . . . .
34
3.2 PCR components and volumes (in microliters) used in the reaction. . . . . . . . . . . . . .
35
3.3 PCR program. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
35
3.4 Molecular cloning reaction components and the respective volumes in µL . . . . . . . . .
36
3.5 Components of RNA samples for electrophoresis in TAE agarose gels and the respective
volumes in µL. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
41
3.6 Reagents used to perform cell-free protein synthesis from Expressway kit and the respective volumes in µL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.7 Feed buffer reagents from Expressway kit and the respective volumes in µL
. . . . . . .
45
45
3.8 Reagents for 25µL reaction kit, stock and reaction concentrations and the respective volumes used in µL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
46
4.1 Primers sequences and properties used in the PCR to produce the insert containing GFP
and the restriction enzymes locals used for cloning pEXP5-NT/GFP. . . . . . . . . . . . .
51
4.2 Genotypes of the E.coli strains BL21(DE3), DH5α and TOP10. . . . . . . . . . . . . . . .
57
4.3 Cell lysis efficiency of the 6 lysated produced calculated from equation 3.4. . . . . . . . .
66
4.4 Protein concentration for the 6 different lysates. The last entry corresponds to the protein
concentration from the lysate of Invitrogen cell-free kit. . . . . . . . . . . . . . . . . . . . .
xiii
67
xiv
List of Figures
1.1 Comparison of in vivo protein expression with cell-free protein synthesis (CFPS). CFPS
systems provide a more rapid process/product development timeline. Example proteins
shown include a virus-like particle (VLP), single-chain antibody variable fragment (scFv),
and a membrane bound protein (MBP) (Carlson u. a., 2012). . . . . . . . . . . . . . . . .
3
1.2 ATP regeneration pathways for cell-free protein synthesis. Commonly used reaction sequences (Cre-P (Creatinephosphate); PANOxSP (PEP, Amino acids, NAD+ , Oxalic acid,
Spermidine and Putrescine) are indicated (Whittaker, 2013). . . . . . . . . . . . . . . . .
14
1.3 The active biochemical reactions in the Cytomim system. Glutamate is used as an energy source in this system to produce reducing equivalents (NADH) through the TCA
cycle. NADH fuels oxidative phosphorylation in which oxygen serves as the final electron acceptor, resulting in the supply of ATP. ATP mainly generated from oxidative phosphorylation promotes the transcription and translation processes.GLU-glutamate; SUCsuccinate; MAL-malate; PYR-pyruvate; AC-acetate; OAA-oxaloacetate; ASP-aspartic acid;
Pi-inorganic phosphate; IMVs- inverted inner membrane vesicles; ETC-electron transport
chain; PMF-proton motive force (Lian u. a., 2014).
. . . . . . . . . . . . . . . . . . . . . .
15
1.4 ATP regeneration in the dual-energy system combined creatine phosphate and glucose
as the energy sources. GAP-glyceraldehyde-3-phosphate; GAPDH-glyceraldehyde-3phosphate dehydrogenase; DPG-1,3-diphosphoglycerate; CP-creatine phosphate;CK-creatine
kinase (Lian u. a., 2014). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
16
1.5 The formats of CFPS system. a) Conventional batch-formatted CFPS system. b) CFCF
protein synthesis system.c) CECF protein synthesis system. d) Hollow fiber reactor. e)
Bilayer CFPS system. f) Thin film format.Reaction mixture includes cell extract, template
(DNA or RNA), and RNA polymerase (when necessary). Feeding solution includes amino
acids, energy components, NTPs or NMPs, cofactors,etc (Lian u. a., 2014). . . . . . . . .
18
1.6 Timeline for CFPS milestones in the production of complex proteins. Abbreviations: scFv:
single-chain antibody variable fragment, vtPA: variant of human tissue-type plasminogen
activator, GM-CSF: granulocyte macrophage colony stimulating factor, IGF-I: insulin-like
growth factor I, cIFN-α: human consensus interferon-alpha, rhGM-CSF: human granulocyte macrophage colony-stimulating factor (Carlson u. a., 2012). . . . . . . . . . . . . . .
xv
24
3.1 Representations of the plasmids used in this study. 3.1a) pEP5-NT/CALM3 (3194 bp);
3.1b) pEXP5-NT/GFP (3685 bp); 3.1c) pETGFP (6088 bp). . . . . . . . . . . . . . . . . .
3.2 Steps of the S30 lysate processing.
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
33
44
4.1 A 1% agarose gel containing the plasmid and the respective digestions. 1-undigested
pEXP5-NT/CALML3 plasmid in different isoforms. 2- pEXP5-NT/CALML3 digestion with
buffer G and SacII. 3-pEXP5-NET/CALML3 digestion with buffer B, SacII and PvuII. 4pEXP5-NT/CALML3 digestion with buffer C and PvuII. M-NZYDNA Ladder III. . . . . . . .
50
4.2 A 1% agarose gel containing the undigested plasmid and the double digestions. 1Undigested plasmid isoforms oc, linear and sc (from top to bottom). 2- Digestion with
SacII, PvuII and 1×C buffer. 3-Digestion with SacII, PvuII and 2× C buffer. 4-Digestion
with SacII, PvuII and 1× G buffer. 5-Digestion with SacII, PvuII and 2× G buffer. MNZYDNA Ladder III. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
50
4.3 A 1% agarose gel containing the pEXP5NT-CALML3 digestion and the PCR product. 1pEXP5NT-CALML3 double digestion with SacII and PvuII. 2- Digested PCR product. MNZYDNA Ladder III. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
51
4.4 A 1% agarose gel containing the 3 purified plasmids obtained from cloning and the respective digestions. 1-Plasmid obtained with a incubation for 1 hour at 22o C; 1a-Digestion
with XmnI; 1b-Double digestion with SacII and PvuII. 2-Plasmid obtained with incubation
overnight at 4o C; 2a-Double digestion with SacII and PvuI; 2b-Digestion with XmnI; 3Plasmid obtained with incubation overnight at 4o C; 3a-Double digestion with SacII and
PvuI; 3b-Digestion with XmnI. M- NZYDNA Ladder III. . . . . . . . . . . . . . . . . . . . .
52
4.5 HIC chromatogram of the pETGFP purification. The x axis correspond to the volume of
the flowtrough, and the double y axis to the absorvance at 254 nm (green line) and the
conductivity of the flowtrough in mS/cm (blue line). . . . . . . . . . . . . . . . . . . . . . .
53
4.6 A 1% agarose gel of the selected fraction of pETGFP purification HIC chromatography.
1 to 3 correspond to purified plasmid peak. 4 corresponds to the second peak. 5 to 8
correspond to contaminant peak. M-NZYDNA Ladder III. . . . . . . . . . . . . . . . . . . .
54
4.7 HIC chromatogram of the pEXP5/GFP purification and a 1% agarose gel of the selected fractions. 4.7b) HIC chromatogram. The x axis correspond to the volume of the
flowtrough, and the double y axis to the absorvance at 254 nm (green line) and the conductivity of the flowtrough in mS/cm (blue line). 4.7a) A 1% agarose gel of the selected
fraction of pETGFP purification HIC chromatography. 1 to 4 correspond to the first peak
(pure plasmid). 7 and 8 correspond to the second peak. 9 to 12 correspond to the final
peak (contaminants). 13- Feed sample. M-NZYDNA Ladder III. . . . . . . . . . . . . . . .
54
4.8 Two 1% agarose gels containing pure pETGFP recovered from HIC chromatography after
dialisys. oc-open circular form; l- linear form; sc: supercoild form. M-NZYDNA Ladder III.
xvi
55
4.9 SEC chromatogram of pEXP5-NT/GFP desalting and 1% agarose gel of the selected fractions. 4.9a) SEC chromatography. The x axis correspond to the volume of the flowtrough,
and the double y axis to the absorvance at 254 nm (green line) and the conductivity of the
flowtrough in mS/cm (blue line). 4.9b) A 1% agarose gel containing the selected fractions
(1-14) of multiple SEC chromatographies. M-NZYDIA Ladder III . . . . . . . . . . . . . . .
56
4.10 Two 1% agarose gels containing the digestion of pEXP5-NT/GFP purified by HIC and
desalted by SEC. 4.10a) Agarose gel containing: 1-pEXP-NT/GFP digested with XmnI;
2-pEXP5-NT/GFP undigested; M-NZYDIA Ladder III. 4.10b) Agarose gel containing: 1pEXP-NT/GFP digested with XmnI; 2-pEXP-NT/GFP double digested with SacII and PvuII;
M-NZYDIA Ladder III. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
56
4.11 A 1.2% agarose gel containing different steps of tRNA purification. 1 and 2- Samples the
supernatant of the precipitation with ethanol. 4- Samples of the pellet resultant phenol extraction and ethanol precipitation. 6- pellet obtained with the addition of 1NaCl in acetate
buffer. 8- Supernatant obtained after the purification step with 1NaCl in acetate buffer. 10Pellet obtained after the last precipitation step. M-NZYDNA Ladder III. . . . . . . . . . . .
58
4.12 A 1.2% agarose gel containing different steps of tRNA purification. 1 and 2-Samples the
supernatant of the precipitation with ethanol. 3-Pellet sample after the purification with
0.3 M sodium acetate. M-NZYDNA Ladder III. . . . . . . . . . . . . . . . . . . . . . . . . .
59
4.13 AEC chromatogram of tRNA purification. The x axis correspond to the volume of the
flowtrough, and the double y axis to the absorvance at 254 nm (green line), the conductivity of the flowtrough in mS/cm (blue line) and the the percentage of 1M NaCl buffer in
the flowtrough (%B) (orange line). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
60
4.14 AEC chromatogram of tRNA purification and 1.2% agarose gel of the selected fractions.
4.14a) AEC chromatography with a gradient elution from 30 to 70% of NaCl buffer. The x
axis correspond to the volume of the flowtrough, and the double y axis to the absorvance
at 254 nm (green line), the conductivity of the flowtrough in mS/cm (blue line), and the percentage of 1M NaCl buffer in the flowtrough (%B) (orange line). 4.14b) A 1.2% agarose
gel containing: 1 to 2- Fractions from the first peak; 2 to 9- The selected fractions corresponding to tRNA peak; 10-Feed sample. M-NZYDIA Ladder III. . . . . . . . . . . . . . .
60
4.15 AEC chromatogram of tRNA purification and 1.2% agarose gel of the selected fractions.
4.14a) AEC chromatography with a elution step of 45% NaCl buffer. The x axis correspond
to the volume of the flowtrough, and the double y axis to the absorvance at 254 nm (green
line), the conductivity of the flowtrough in mS/cm (blue line), and the percentage of 1M
NaCl buffer in the flowtrough (%B) (orange line). 4.14b) A 1.2% agarose gel containing:
1 to 5- Fractions from the first peak; 6 to 9- The selected fractions corresponding to tRNA
peak; 11-Feed sample. M-NZYDIA Ladder III. . . . . . . . . . . . . . . . . . . . . . . . . .
61
4.16 A SDS-page gel silver stained containing samples from the first peak of tRNA purification
chromatogram. Marker: Precision Plus Protein Standards duo Color (Bio Rad) . . . . . .
xvii
61
4.17 E.coli cells containing the GFP produced from pETGFP (figure 4.17a) and pEXP5-NT/GFP
(figure 4.17b) seen with a flurescence microscope with blue filter. . . . . . . . . . . . . . .
61
4.18 A 12% acrylamide gel stained with comassie blue containing samples from the washing
and elution of GFP HIC purification. Marker: Precision Plus Protein Standards duo Color
(Bio Rad) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
62
4.19 Two 15% acrylamide SDS PAGE gels containing samples of GFP purification by IMAC
chromatography. 4.19a) 15% acrilamide gel containing: 1- Feeding sample: 2 to 4- Elution
samples containing GFP; 5- Washing sample. 4.19b) 15% acrylamide gel containing two
elution samples with GFP after the optimization of imidazole concentration in the buffer
used. M- Precision Plus Protein Standards duo Color (Bio Rad) . . . . . . . . . . . . . . .
63
4.20 A 15% acrylamide gel stained with comassie blue containing samples from the washing
(3) and elution (1 and 2) of GFP purified by IMAC. A western blot with His-tag ant-body
from with the same samples as the acrilamide gel on top. Marker: Precision Plus Protein
Standards duo Color (Bio Rad). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
64
4.21 E.coli BL21 growth curve represented by average and the respective standard deviations
until the harvest. the y axis corresponds to the optical density (OD600 ) of the cells. The x
axis corresponds to the culture time in hours. The curve corresponding cell growth without
plasmid is represented in light blue, and the dark blue represent cell growth with plasmid.
65
4.22 A 15% acrilamide SDS-PAGE gel containg samples of pEXP5-NT/GFP tests using Expressway Cell-Free textitE. coli Expression System (Invitrogen). 1) Test containing the
control vector (pEXP5-NT/CALML3); 2 to 4) Tests containg pEXP5/GFP as expression
vector. M) Precision Plus Protein Standards duo Color Marker (Bio Rad). . . . . . . . . .
68
4.23 A 15% acrilamide SDS-PAGE gel containg samples of pETGFP tests using Expressway
Cell-Free textitE. coli Expression System (Invitrogen). 1) Test containing the control vector
(pEXP5-NT/GFP); 2 to 4) Tests containg pETGFP as expression vector. M) Precision Plus
Protein Standards duo Color Marker (Bio Rad). . . . . . . . . . . . . . . . . . . . . . . . .
68
4.24 A histogram containing the GFP produced with Expressway cell-free kit at two incubation
temperatures- 37o C (dark blue bar) and 37o C (light blue bar) and the respective standard
deviations. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
69
4.25 A histogram containing the average relative flurescence (RFU) of the produced GFP in
the 6 lysates and the lysate from the kit. . . . . . . . . . . . . . . . . . . . . . . . . . . . .
69
4.26 Optimisation screens of E. coli cell-free protein synthesis containing the cytomimic system as a energy system, pEXP5-NT/GFP as a template and the lysate 6. 4.26a) Active
GFP produced, in relative fluorescence units, with the variation of magnesium concentration from 2mM to 12mM in increments of 2mM. 4.26b) Active GPF produced, in relative fluorescence units, with the variation of template (pEXP5-NT/GFP) concentration in
µg × mL−1 . 4.26c) Active GPF produced, in relative fluorescence units, with the variation
of lysate volume (%). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
xviii
70
List of abbreviations
3’-UTR-Three prime untranslated region
ICE-Insect cells
5’-UTR-Five prime untranslated region
IMAC-Immobilized metal ion affinity chromatogra-
AEC-Anion exchange chromatography
phy
ATP-Adenosine triphosphate
IPTG-β-D-1-thiogalactopyranoside
BSA-Bovine serum albumin
mRNA-Messenger ribonucleic acid
CECFS-Continuous exchange cell-free protein
NAD-Nicotinamide adenine dinucleotide
synthesis
PAGE-Polyacrylamide gel electrophoresis
CFCFP-Continuous flow cell-free protein synthesis
PANOx-Phosphenol pyruvate, amino acids, Nicoti-
CFPS-Cell-free protein synthesis
namide adenine dinucleotide , oxalic acid
CoA-Coenzyme A
PCR-Polymerase chain reaction
CP-Creatine phosphae
pDNA-plasmid DNA
CTP-Cytidine triphosphate
PE-Polyethylene glycol
DEAE-Diethylaminoethanol
PEP-Phosphenol pyruvate
DMSO-Dimethyl sulfoxide
RRL-Rabbit reticulocyte
DNA-Deoxyribonucleic acid
RM-Reaction mixture
DTT-Dithiothreitol
RNA-Ribonucleic acid
E. coli-Escherichia coli
RNAP-Ribonucleic acid polymerase
FM-Feeding mixture
SDS-Sodium dodecylsulfate
GFP-Green fluorescent protein
TrisTtris(hydroxymethyl)aminomethane
GTP-Guanosine triphosphate
tRNA-Transfer ribonucleic acid
G1P-glucose 1-phosphate
TX-TL-Transcription and translation
G6P-Glucose 6-phosphate
UTP-Uridine triphosphate
HIC-Hydrophobic interaction chromatography
WGE-Wheat germ
xix
xx
Chapter 1
Introduction
Today, fossil fuels and their derivatives (methanol, ethylene, propane, butane, benzene) serve as a
building block for almost all chemicals and materials used daily (Moulijn u. a., 2013). This dependence
of fossil fuels and the petrochemical materials paradigm has consequences: supply limitations due to
increasing and fluctuating prices (and finite availability), undesirable climate effects (Höök und Tang,
2013), and constraints on materials innovation due to a limited set of petrochemical building blocks
(Bozell und Petersen, 2010). Thus, the desire to produce chemicals and materials derived from biomass
led to the development of novel, sustainable, and cost-effective technologies based on biological synthesis.
Biology is able to produce complex molecules and polymers from simple building blocks (Harris
und Jewett, 2012). Biological systems have innumerable pathways and macromolecular machines that
are capable of convert a precursor into a variety of products, with high fidelity, efficiency, and yield.
These combined characteristics is what makes the biological systems perfect for the production not
only of high-value products (Liese u. a., 2006), but also of commodity chemicals and fuels (Dudley u. a.,
2015). In the recent decades, there has been a growth of the industrial biotechnology and metabolic
engineering (Bozell und Petersen, 2010). This exploit growth promoted the exploit of enzymes as robust,
specific, and efficient catalysts of chemical reactions (Quin und Schmidt-Dannert, 2011), and the use of
living organisms to produce a variety of useful small molecules, peptides, and polymers (Nielsen u. a.,
2013). Recently, the first-generation ethanol (Cherubini, 2010), 1,3-propanediol (Dupont Tate & Lyle)
(Nakamura und Whited, 2003), polylactic acid (Cargill), and isoprenoids (Amyris) (Paddon u. a., 2013),
among other, were successfully commercially produced.
Although there is a number of success stories, the use of a cell-based system has some drawbacks.
The production is economically limited, as it requires hundreds of person-years of work to bring a single
pathway to market (Hodgman und Jewett, 2012). The major obstacle inherent to this system is the
limitation imposed by cells. It is very difficult to keep a balance between a active synthetic pathway
and cell growth and maintenance. There is a tight restriction to the physiological ambient conditions
(pH, temperature) and a necessity to prevent the accumulation of toxic compound. The concentration of
target molecules is limited to non-toxic levels and the production of unwanted by-products is common.
1
The scaling up of cultures to the industrial level and to separation and purification if the target product
are challenging problems. The productivity is affected by the inability to control the resources exclusively
towards to the target protein pathway. Therefore, the unwieldy complexity of cells makes rational design
unpredictable and difficult to engineer (Kwok, 2010).
In order to overtake the drawbacks aforementioned, many solutions are being designed. Synthetic
biology offers new advanced tools and generalised capabilities to modify living organisms for process
engineering objectives (Dudley u. a., 2015). Nevertheless, this is a major challenge: our knowledge
of how life works is incomplete, cells are inherently complex, there is unintended interference between native and synthetic parts, and the micro and macroevolution and adaptation of the cells creates
noise(Hodgman und Jewett, 2012).
Other solution to these problems can be the switch of focus from the whole cell to the reaction within
it. The synthesis can be conducted without using intact cells: using either purified enzyme systems, or
crude cell lysates. This way, the synthesis can be accurately monitored and modelled. In the recent
years, many advances in the cell-free systems were made by optimising and reducing the production
cost; the approach was transformed from a specialised analytical tool to a powerful preparative method
with broad applicability (Dudley u. a., 2015). These systems have the advantage of not requiring the
process of cell viability and growth and thus, offer a powerful platform for accelerating the optimisation
of the pathways –not only harnessing but also expanding the chemistry of life–(Dudley u. a., 2015).
1.1
1.1.1
State-of-the-art
Cell-free Protein Synthesis
Cell-free biology is defined as the activation of complex biological processes without using intact living
cells (Hodgman und Jewett, 2012; Swartz, 2012). The metabolism can focus cellular resources towards
an exclusive and defined objective. The removal of physical barriers enables the direct access to the
inner working of the cell: allowing easy substrate addition, product removal, system monitoring, and
rapid sampling. Furthermore, with the removal of genomic DNA, there is no longer the need for genetic
regulation (and cell viability is also removed). In short, cell-free biology decrease the dependence on
cells and increases the engineering flexibility (Forster und Church, 2007).
The most prominent and developed example of cell-free biology is cell-free protein synthesis (CFPS)
(Harris und Jewett, 2012). As the name implies, CFPS is described as the in vitro expression of recombinant proteins, without the use of living cells. It uses a cell lysate containing a diverse array of
biological and chemical components for transcription, translation, protein folding and energy metabolism
required to directly synthesise the target protein. The lysates can –theoretically– be created from any
cell source or origin and can be reconstituted for biosynthesis of proteins by adding exogenous genetic
information. The added substrates include amino acids, nucleotides, DNA or mRNA template encoding
the target protein, energy substrates, cofactors, and salts. As in a fermentation reaction, the cell-free
protein synthesis production continues until one of the substrates (e.g. ATP or cysteine) is depleted as
2
the by-product accumulation reaches an inhibitory concentration.
Figure 1.1: Comparison of in vivo protein expression with cell-free protein synthesis (CFPS). CFPS
systems provide a more rapid process/product development timeline. Example proteins shown include a
virus-like particle (VLP), single-chain antibody variable fragment (scFv), and a membrane bound protein
(MBP) (Carlson u. a., 2012).
Cell-free protein synthesis systems are becoming increasingly more popular due to them advantages
in the protein production process when compared to the in vivo approach (figure 1.1). They are considerably faster, because the process does not involve transfection or cell cultures, nor does it require
a difficult downstream purification. Moreover, only the desired protein is produced so there are no expenses in the production of proteins and metabolites involved in the cell maintenance and growth. It also
reduces the effect of toxicity, because there is no need to maintain the cell viability (it only maintains the
metabolisms required to the production).
With cell-free systems, one can influence the complex reaction network directly, by adjusting different
supplies for the optimal production. Catalysts and reagents can be added or removed: such as complex
3
enzymatic subtracts, cofactor or non-natural reagents, and energy supplier. Template or PCR product
concentration can be adjusted to optimal production. Another advantageous feature is the possibility
to monitor the complex reaction network directly, because it easy to acquire samples, and enables online monitoring. Duo to the absence of cell membranes, there are no barriers to access the product.
There is no need for transporters, and it simplifies the product harvest and the monitoring of the product
levels. The environment is diluted and therefore less crowded, which has several effects: There is
no background synthesis directed by chromosomal DNA, the sigma factors uncouple from native RNA
polymerase and no longer produce messenger RNA from DNA in the lysate, the rate of undesired
reactions is reduced, and diffusion rates are improved (Swartz, 2012). The dilution also has effects
on protein folding. The protein elongation is slowed due to lower concentrations of elongation factors:
allowing the protein to fold before the following domains emerge from the ribosome, also, there is less
chance for inclusion bodies to form. The catalytic system will be stabilised as the dilution reduces the
concentrations of proteases and nucleases.
In in vivo systems, proteins expressed in the cytosol have to be recovered by celular lysis, which
can result in protein denaturation. Since there are no barriers, there is no need to lysate the cells and
protein purification is simpler and safer. Furthermore, the CFPS can be performed on a microliter scale
making it ideal for high-throughput applications (mutant screening for optimal physicochemical/functional
properties) (Casteleijn u. a., 2013).
Cell-free systems allow the production of several proteins that otherwise would be quite difficult
to produce. First, it allows the production of proteins with co-translational modification. The system
can incorporate non-natural or chemically modified amino acids into the nascent polypeptide at defined
positions during translation. This has greatly facilitated labelling of proteins with isotopic, fluorescent,
biotin or photoreactive groups for downstream applications (He, 2008). Besides, the application of this
technique to the production of non-natural analogues with reactive side chains have immense potential
in structural and functional proteomics. The ability to engineer physicochemical properties of proteins
with relative ease would expand the utility of cell free system towards expression and production of
proteins with pharmaceutical relevance (Casteleijn u. a., 2013).
Disulfide-bonded proteins are ordinarily formed in extracytoplasmic compartments in which conditions are more oxidising (Katzen u. a., 2005): the periplasm of prokaryotes and the lumen of the endoplasmic reticulum (ER) of eukaryotes. One of the major drawbacks of E. coli in vivo systems is the
inability to produce these proteins. This is a serious limitation since many of the proteins with pharmaceutical relevance have multiple diffuse bonds that require proper folding. A set of nine complex proteins
with multiple disulfide bonds was expressed using a cell free protein synthesis system (Goerke und
Swartz, 2008). Cell-free protein synthesis systems also allow the expression of protein complexes and
membrane proteins. The production of protein complexes (consisting of hetero subunits) is achieved
using multiple mRNAs that will be co-translated and form the active protein complex (Matsumoto u. a.,
2008).
This system is also efficient to synthesise toxic protein that would inhibit the cellular machinery and
limit the expression in cell-based systems. Cell free systems provide an alternative to synthesise these
4
proteins (either as precipitates or translated directly) in the presence of surfactants or preformed liposomes. For instance, E. coli multi-drug transporters (EmrE, SugE, TehA and YfiK) were expressed
using a modified E. coli S30 extract at high levels as precipitates and the solubilised in detergent micelles
(Casteleijn u. a., 2013).
Finally, the cell-free protein synthesis has an important role in the production of proteins with multidomains eukaryotic proteins with high content of A/T and low complexity sequences. A major issue of
concern in malaria vaccine discovery research is the lack of an ideal recombinant protein synthesis system that can express A/T rich and low complexity sequences of the malaria genome. The wheat germ
system proved highly suitable for A/T rich malaria genes, not requiring codon optimisation (Casteleijn
u. a., 2013). Further exploring the versatility of these systems towards expression of eukaryotic multidomain low complexity region sequences is certainly a matter of further research.
1.1.2
cell lysates
Cell lysates contain active enzymes as well as helper factors for transcription, translation, and protein
folding. The components in the cell lysate act ad as chemical factory to synthesise and fold the target
protein upon an incubation with the essential substrates. A variety of cell lysate preparation methods
have been developed for CFPS.
In theory, any organism can provide a source of crude lysate. To date, a number of organisms were
successfully used to create lysates: E.coli, yeast, rabbit reticulocyte, wheat germ, hyperthermophile,
Drosophila embryo, hybridoma, Xenopusoocyte or egg, insect, mammalian and human cells (Endoh
u. a., 2006). Since all these cells are very different, the extracts derived from them behave very differently. Thereby, the first decision when using CFPS to produce biological active proteins is to choose the
source of lysate. There are some criteria to taking into account: the required amount of synthesised recombinant protein, the source that provide the most favourable background for promoting protein folding
and to increase the likeability of post-translational modifications, the protein origin and complexity, the
downstream processing, the system availability and cost.
The prokaryotic E.coli CFPS system is the most popular and it is commercially available. E.coli based
systems achieve the highest protein yield, from hundreds of micrograms to milligrams per millilitre, in a
batch reaction, depending on the protein of interest. For instance, it was achieved 1.7mg.mL−1 for
chloramphenicol acetyl (Kim u. a., 2011) and 0.7mg.mL−1 for human granulocyte-macrophage colonystimulating factor (Zawada u. a., 2011). In addition, the E. coli CFPS has the ability of activate metabolic
reactions in the extract that fuels high-level protein synthesis without the need for using expensive energy
substrates. Thus, E. coli based systems are very efficient and have higher yields, however they do not
provide most post-translational modifications nor specific eukaryotic folding systems.
So far, complex modifications, such as glycosylation, lipidation, or phosphorylation are only described
from systems with eukaryotic extracts such as rabbit reticulocytes (RRL), insect cells (ICE), or wheat
germ (WGE). However, these systems usually have more laborious extract preparation procedures, are
more costly, and have lower protein yields. Despite these negatives characteristics, they are better for
5
functional studies, particularly for post-translationally modified proteins.
The most productive eukaryotic based system is the one based on wheat germ. It is prepared from
isolated wheat seed embryos and typically produces between several hundred micrograms to milligrams
of recombinant protein per millilitre reaction (Madin u. a., 2000). While WGE is the most efficient at
producing proteins, it is not suitable for some post-translational modifications like glycosylation (Tarui
u. a., 2001).
Rabbit reticulacytes and insect cells have shown the most versatility in post-translational modifications. There are reports of isoprenylation, acetylation, N-myristoylation, phosphorylation, ubiquitinconjugation, signal peptide processing, and core glycosylation being achieve in this systems (Carlson
u. a., 2012). In terms of yield, RRL reactions typically report several to tens of micrograms protein per
milligram reaction (Tarui u. a., 2001).
ICE system are usualy prepared from Spodoptera frugiperda cells (Ezure u. a., 2010) and produce
several tens of micrograms per millilitre reaction. These systems have an advantage over RRL in terms
of glycosylation.They do not require the addition of micromosal membranes and enzymes (needed for
proper post-translational modifications in RRL). One of the disadvantages is that these microssomal
membranes must be purified separately. Thus, ICE system is one of the fastest growing CFPS platforms
(Hodgman und Jewett, 2012). Beyond the platforms listed above, eukaryotic CFPS systems based on
yeast (Wang u. a., 2008), cancer cells (Weber u. a., 1975), and hybridoma (Mikami u. a., 2006), have
also been developed.
There are limitations factors to protein production efficiency in cell extracts. They may have high
concentrations of endogenous degrading enzymes, poor synchronisation of ribosome activity during
cell growth, or stability problems of essential enzymes(Proverbio u. a., 2014). Also, lysates from cells
showing high expression activities in vivo may not be very efficient in cell-free expression. However, the
protocols are continuously being optimised and further potential for improved protein synthesis might
exist.
Cell lysates are not the only source of the enzymatic machinery. Despite being one of the most
complex basic cellular processes, the whole translational mechanism from E. coli was reconstituted in
vitro with more than 100 individually purified components. The Protein Synthesis Using Recombinant
Elements (PURE) system is based on the reconstitution of the translational machinery of the cell from
purified protein components, such as initiation factors, elongation factors, release factors, ribosome recycling factors, 20 aminoacyl tRNA synthetases, methilonyl tRNA formyltransferase, and pyrophosphatase
(Shimizu u. a., 2001). The system exhibits high translational efficiency with the added advantage of simpler manipulation of the reaction conditions and easy purification of untagged protein products (Katzen
u. a., 2005).
Wheat germ lysate
Alongside E. coli systems, WGE is the most used and developed cell-free system. WGE is frequently
operated as translation system with supplied mRNA as template and different concentrations of M g 2+
from transcription and translation (TX-TL) systems. The lysates are highly stable which allows the ex6
tension of reaction times for weeks with final protein yields up to 10mg.mL−1 at optimal conditions
(Sawasaki u. a., 2002b). These lysates are difficult to prepare because the embryo used is surrounded
by the endosperm containing high levels of protein and nucleic acids degrading enzymes as well as
translation inhibitors. To improve WGE systems, the endogenous inhibitory pathways of the translation
machinery originating from the endosperm can be blocked (Madin u. a., 2000). Besides, there is a high
batch variation in the lysate quality. This usually depends on the origin and source of the wheat germs.
In order to obtain high stables WGE lysates, the endosperm contaminants must be removed, through
extensive washing.
The high performance of WGE systems has been demonstrated in the so-called “human protein
factory study” (Goshima u. a., 2008). This project targeted the expression of 13364 human proteins,
where 12996 of their clones produced protein were produced with a wheat germ system (97.2%) and
12,682 of those were found in the soluble fraction (Arumugam u. a., 2014). Thus, WGE cell free systems
can be a very effective high-throughput expression system for rapid preparation of multiple proteins for
antigen characterisation, and fir generating quality antibody molecules. It is the method of choice for
production of stable, properly folded, appropriately post-translationally modified proteins and for highthroughput protein expression at various scales (Endo und Sawasaki, 2004).
E.coli S30 lysate
E. coli lysates are the most used from CFPS. The first procedure for preparation of this lysate was
developed by Nirenberg (Nirenberg, 1963) in 1963. Although Zubay (Zubay, 1973)and Pratt (Pratt,
1984)made some alterations to the method, it remains almost the same up until the last decade.The cell
lysate preparation is a key step to obtain successful and reproducible results using the cell-free protein
synthesis (Kigawa u. a., 2008). In general, the cells are harvested in the mid-exponential phase of a lowdensity fermentation and then processed by a high-presure lysis (20,000 psi) . The resulting lysate is
then centrifuged twice at 30000 × g to remove wall fragments and genomic DNA (Schwarz u. a., 2008). In
addition, it removes endogenous mRNA as well as all low molecular weight compounds –which helps to
suppress background expression and to have complete control over the amino acid pool in the reaction–.
The lysate is further clarified with a runoff reaction and dialysed to provide suitable storage buffer. The
extract obtained (denominated S30 extract) consist of the cell-crude, ribosome, proteins, factors and
soluble RNA necessaries to the protein production.
However, this procedure remains a time and labor-intensive process. Besides, it is also difficult
to standardise, leading to different lysate performances. Furthermore, this procedure involve a large
volume of cell culture, costly high pressure disruption equipment to lyse cell, and it has a low yield.
Obtaining and using a large number of cell extracts from different source strains is not yet routine. Thus,
it is surprising that only in the last decade, studies focusing alteration to this procedure for improved
productivity and reproducibility started to appear.
One of the most important change was the E.coli strain used in this preparation. Previously, E. coli
starins lacking the major RNase (such as A19 and MRE600) were used (Zubay, 1973) (Pratt, 1984).
Today, strains BL21-derivatives –containing extra copies of genes for minor tRNAs– are used. This
7
includes BL21 codon-plus strains (Stratagene, USA), Rosetta strains (Novagen, USA), or the originally
developed strain from (Chumpolkulwong u. a., 2006). The use of this strains bypasses the low productivity due to rare rare codons. BL21-Star (DE3)(Invitrogen,USA) is one of the best strains to used because
it is deficient in major RNase (RNase E) and in ompT endoproteinase (Ahn u. a., 2005).
In order to stabilise the energy supply, modifications to the growth medium were done. The development of a defined medium (2YT) for consistent growth produces active extracts from high-density
fermentations (Liu u. a., 2005). The addition of phosphates and excess glucose, avoidS the induction of
phosphatase which resultS in a 30% decrease of ATP hydrolysis activity and a 40% more productive cell
(Kim und Choi, 2000). Apart from medium composition, other aspects of cell growth were addressed.
The use of shake flask fermentation was reported twice to simplify the cell growth (Kigawa u. a., 2004;
Yang u. a., 2012). The addition to the medium of isopropyl β-D-1-thiogalactopyranoside (IPTG) during
the cell growth –to overexpress the T7 RNA polymerase– eliminates the need to add independently purified T7 RNA polymerase to the CFPS reaction, which is a very important and expensive component in
the reaction (Kim u. a., 2006).
The cell disruption method is another important modification. In order to disrupt the cell wall, but
keep the components necessary to the cell-free system intact, a mechanical method must be applied. A
french press is a popular device to disrupt the E. coli cells. However,it is difficult to obtain reproducible
cell disruption results on a laboratory-scale preparation (Kigawa u. a., 2008). One of the most used
alternatives is the high-pressure homogeniser and bead mill, but again they are a costly equipment.
There is a report on the use of bead vortexing (Shrestha u. a., 2012), and a sonicator (Kwon und Jewett,
2015) to produce this lysates.
The run-off reaction is a subject of discordance. The step consist in a preincubation (or run-off
reaction) which reduces the background incorporation of amino acids into undesired proteins. During
this reaction, the lysate is incubated with an energy source with no exogenous mRNA or DNA. This
releases the ribosomes and facilitates the degradation of endogenous mRNA and DNA (Nirenberg,
1963). The polysomes and the ribosomes in the extract dissociate into 30S and 50S ribosomal subunits
(Shrestha u. a., 2012). The nature of the extract activation during the run-off reaction is still unknown,
but one possibility is that the incubation activates certain factors or deactivates certain inhibitors that
improve protein yields in the cell-free system. Although almost all procedures available incubate the
lysate with an energy source, there is little effect on final lysate performance. However, without the
reagent additions, the 70S ribosomes do not dissociate into subunits (Shrestha u. a., 2012).
In 2006, Kim group presented a new protocol for the production of lysate (Kim u. a., 2006). Unlike the
conventional S30 lysate, the preparation of the S12 does not involve high-speed centrifugation or dialysis
steps. Instead, centrifugation is done at 12000 × g for 10 minutes and the run-off step is done with a
brief incubation without the pre-incubation mixture (Kim u. a., 2006). As a result, the overall processing
time and cost were reduced by 60 and 80% respectively. The translational activity of the centrifuged
lysate prepared with the simplified procedures was also substantially higher than that of a standard S30
lysates.
8
PURE system
The Protein synthesis Using Recombinant Elements (PURE) is a cell-free protein synthesis system
approach based on reconstitution of the translational machinery of the cell from affinity purified protein components (Shimizu und Ueda, 2010). The components include initiation factors (IF1, IF2, IF3),
elongation factors (EF-Tu, EF-Ts, EF-G), release factors (RF1, RF2, RF3), ribosome recycling factors,
20 aminoacyl tRNA synthetases, methionyl tRNA formyltransferase and pyrophosphatase, all bearing
a 6 × His tag. They are combined with ribosomes and tRNAs isolated from E. coli strains, NTPs,
aminacods, an ATP-generating catalytic module and recombinant T7 RNA polymerase (RNAP). This
will produce a self-contained reaction that can be used for protein synthesis with the addition of DNA
templates. This system has been commercialised (e.g., PURESYSTEM, Cosmo Bio, Tokyo, Japan;
PURExpress, New England Biolabs, Beverly,MA, USA), making it available for a variety of laboratory
research applications (Whittaker, 2013).
There are many advantages of the PURE systems over tradition lysate based ones: levels of contaminating proteases, nucleases, and phosphatases are reduced, greater reproducibility resulting from
more defined chemistry, and the flexibility of a modular system. Also, metabolic side reactions that
deplete the amino acid pool in cell extracts can be entirely avoided. The purification of the products
with the 6 × His affinity tags associated with the PURE components can be done by extracting the
tagged proteins by metal affinity chromatography. The major advantage of PURE systems its modularity: it supports a variety of modifications for specialised applications. It includes ribosome display and
site-selective incorporation of not genetic encoded amino acids (ngeAAs).
One the other hand, PURE system are very expensive (which is prohibitive for most commercial
applications) leaving crude extract systems the clear current choice (Hodgman und Jewett, 2012). In
addition, cell lysate systems have a better protein yield per ribosome (Jewett und Forster, 2010). Recently, there is an effort to close the gap between lysate-based and purified-based systems. Genome
engineering technology is being used simultaneously to tag multiple components from the translation
apparatus in a single strain for co-purification and to reconstruct in vitro (Wang u. a., 2009).
1.1.3
Cell free protein synthesis system templates
A typical Cell-free protein synthesis system is led by transcription from sub-nmol quantities of template.
With the increasing improvements in the efficiency of transcriptional processing has brought the technology near the single-molecule limit of template sensitivity. This level of sensitivity is important for a
variety of nano-scale processing applications, including protein printing (Whittaker, 2013).
CFPS systems can act as coupled or linked transcription and translation reactions. The linked reactions imply a two-step sequential process, where the transcript is formed first. Usually, these reactions require a mRNA template produced from native sources or by in vitro transcription. The coupled
reactions imply simultaneous synthesis of mRNA and protein within an extended polysome complex
(Whittaker, 2013). Most of these systems include a DNA template which can be a plasmid or a linear
DNA fragment such as a polymerase chain reaction (PCR) product. The DNA template must contain a
9
efficient promoter and a translation initiation signal such as a Shine–Dalgarno (prokaryotic) or a Kozak
(eukaryotic).
When comparing the coupled with the linked transcription/translation (TX-TL) in E.coli, it is clear that
greater quantities of mRNA (20-30fold) over plasmid DNA are necessary to produce similar amounts of
the target (Rosenblum und Cooperman, 2014). This can be a consequence of the instability of mRNA
in the reaction medium. This problem is mitigated when mRNA is generated in a coupled TX-TL system. In general, coulped CFPS sysem is prefered because it uses small amounts of plasmids or PCR
products which are easier to obtain and it eliminates the time and cost for mRNA in vitro transcription.
Nevertheless, the use of mRNA prepared separately can sometimes be advantageous. For instance, it
allows the study of effects of post-transcriptional mRNA modification. The study of these effects is determinant in tailoring synthetic mRNAs with desirable properties such as stability, translational capacity and
controlled immunogenicity (Karikó u. a., 2008). Another example is the study of how mRNA secondary
and tertiary structures affect the translation. This structures may contain stem-loops, pseudoknots and
G-quadruplexes that may be fully formed when linked TX-TL is used, but form only partially (if at all)
when the TX-TL processes are coupled. This allows for a detailed study of how such structures the
influence translation rate and how this influence can be manipulated by the addition of molecules and
proteins that specifically bind and stabilise these structures (Bugaut und Balasubramanian, 2012).
Coupled transcription and translation CFPS systems
Coupled CFPS systems imply the addition of a DNA template, formed either by a closed circular vector
(plasmid) or a linear fragment (PCR product). In either form, the template must be under control of
a specific and strong promoter sequence recognised by phage polymerases, such as T7, SP6, or T3
RNA-polymerase (RNAP). The T7 promoter is usually chosen since it is the most popular among E. coli
protein expression systems. There are many suitable vectors commercially available, such as pET (Novagen) or pIVEX (Roche Diagnostics) derivatives (Schwarz u. a., 2008). The transcription is performed
by recombinant phage T7 RNAP, generating the mRNA used by the ribosomal machinery will use to
produce the target protein. The T7 RNAP is a single-subunit polymerase with high promoter specificity
and transcriptional fidelity (Sousa und Mukherjee, 2003). The use of T7 RNAP also allows the use of
the same DNA templates in both in vivo and in vitro systems.
The DNA template used in CFPS systems must have the following components: A 5’ untranslated
region (UTR) comprising a T7 promoter sequence, a Shine-Dalgarno (SD) sequence (which serves as
ribosome entry point), and a 3’-UTR (including an efficient translation termination codon, followed by
six or more nucleotides). The Shine-Delgarno sequence should be at a optimal distance from the open
reading frame (ORF) (usually eight nucleotides from the AUG start codon) (Dreyfus, 1988). The SD
sequence interacts with the 3’ end of the 16S ribosomal RNA (rRNA) to allow efficient initiation.
Other components can be added to the template to improve the yield. An epsilon (Enchancer of
Protein Synthesis Initiation) sequence can be added to the 5’-UTR and a T7 terminator in the 3’UTR
improves the efficient release and recycling of the ribosome. In the prokaryotic systems, the productivity
highly depends on the rate of translation initiation (Schwarz u. a., 2008). The use of N-terminal tags (T7
10
tag, His × 6) or smaller fusion proteins can also enhance the expression.
For eukaryotic CFPS systems, an engineered 5’-UTR is used to induce efficient translation. In in
vivo systems, capped and poly-adenylated mRNA is required for efficient translation initiation. Although
capped mRNA can be used, this is expensive and has a low efficiency. Internal Ribosome Entry Site
(IRES) is a highly structured element found within viral mRNA that is able to induce eukaryotic initiation
(Jang u. a., 1988). Most eukaryotic cell-free systems use the IRES sequences to initiate translation.
They are unique for each organism and usually derived from viruses. For example, an upstream IRES
was shown to be important for the expressioncof large proteins such as GCN2 (160 kDa), Dicer (200
kDa) and mTOR (260 kDa) in a HeLa (human)-derived CFPS system (Mikami u. a., 2008).
A universal DNA sequence for protein initiation in both prokaryotic and eukaryotic systems has also
been designed. Species-independet translation sequences (SITS) eliminate species barriers to cell-free
translation. This universal adapter relaxes the secondary structure in the transcript and enables the
assembly of the translation complex in E.coli, yeast, wheat germ, insect cell, rabbit (Mureev u. a., 2009).
Template production
A purified template is one of the most expensive substrates in CFPS systems. Also, the purification
of templates is a time-consuming step and it can be a bottleneck when expressing a large number of
proteins. In the case of plasmids, although alkalise lysis and liquid chromatography are a well establish
techniques for plasmid preparation and purification, to produce a high pure product the procedure must
combine two chromatographic techniques as well as an efficient sample preparation method. Thus,
this process is time consuming and has a low yield. To overcome this, alternative methods are being
developed. DNA rolling circle amplification is a process of unidirectional nucleic acid replication that can
rapidly synthesise multiple copies of circular molecules of DNA or RNA. In a recent report, this method
was used to amplify 5µgof circular DNA from 100 ng of starting material (which served as a high-quality
template for protein synthesis) (Kumar und Chernaya, 2009).
For the preparation on linear DNA templates, a two-step PCR method was developed. This allows
virtually any coding sequence to be assembled together with promoter and terminator elements for
cell-free synthesis. First, the open reading frame (ORF) of a domain fragment of ORF is amplified by
PCR using using gene-specific primers and/or universal primers. Second, the first PCR product, a T7
promoter fragment (with the tag-coding sequence), a T7 terminator fragment, and the universal primer
(these are non-gene-specific and thus in common with all the genes) are subjected to overlapping PCR.
This produces a construct that expresses a fusion protein under the control of the T7 promoter (Kigawa
u. a., 2008). This method has the advantage that different tags can be attached simply by changing
the common tag-coding fragment at the second PCR step with the same specific primer pair for each
target. This method is so efficient and robust that it is routinely use in different labs (Kigawa u. a., 2008)
(Whittaker, 2013).
Another direction to address the problem is high-throughtput gene construction. The Gateway vector
system (available from Invitrogen) uses integrase enzymes for one-step insertion of a desired gene into
a vector. This avoids excess restriction digest and ligation reactions. This platform was used for high11
throughput production of 33,275 entry clones that were subsequently used for CFPS of a portion of the
human proteome (Goshima u. a., 2008).
An improved E. coli based CFPS system was recently developed. This system uses an endogenousE. coli RNA polymerase instead of the more standard bacteriophage polymerases. This may provide advantages for the synthesis of particular genes (Chalmeau u. a., 2011).
Multigene expression
Cell free protein synthesis systems can be used to produce multiple polypeptides in a single reaction
mixture simultaneously. The addition of multiple templates results in the parallel synthesis of distinct
proteins. This approach can be used to assemble complex multicomponent proteins, as successfully
demonstrated with the synthesis of the heterotrimeric core of Paracoccus denitrificanscytochrome coxidase in an E. coli CFPS system (Katayama u. a., 2010). An alternative strategy for multigene expression
from polycistronic constructs has been demonstrated for the production of up to five distinct protein products from a single ‘BioBrick’ plasmid template (Du u. a., 2009). Sequential synthesis is also possible by
immobilising template DNA on magnetic microbeads. Cell-free protein synthesis can then be arbitrarily
reset and reprogrammed which is an example of artificial gene circuits (Lee u. a., 2012).
1.1.4
Other components and Energy systems
Beyond lysate preparation, stabilising the reaction with a variety of essential compounds is critical for
cell-free protein synthesis systems. They help to control the concomitant accumulation of unwanted side
products to maximise protein production yield and the lifetime of the system.
One of the most essential compound in all CFPS system in the divalent M g 2+ . This ion is important
for many biological reactions, both for in vivo and in vitro systems. It is very difficult to determine the
concentration values for maximum protein production yields, but usually it ranges from 4 to 20 mM for
E.coli, and 2 to 4 mM for eukaryotic systems (Madin u. a., 2000). This concentration must be optimised
for every lysate batch. Potasssium and ammonium acetate or the corresponding glutamate are also
added to the E.coli system at high concentrations. ATP and GTP are sufficient to provide the required
energy for mRNA translation in WGE systems, but in E. coli the four nucleoside triphosphates (ATP,
CTP,GTP,UTP) are necessary.
Protein synthesis requires all 20 amino acids are present in amounts super-stoichiometric with the
amount of protein to be formed. It also requires the addition of all 20 amino acid tRNA synthetases
and the full complement of tRNAs (Whittaker, 2013). In cell-free systems, amino acids are supplied in
concentrations between 0.3 and 2 mM. Membrane protein production is dependent on the composition
of the amino acid pool, therefore, the individually adjustment of the concentration may result in higher
expression yields. Problems with codon usage upon synthesis of heterologous genes can be addressed
by manipulation of total tRNA concentration and by additing rare codon-enriched tRNA (Schwarz u. a.,
2008).
In cell-free reactions, the energy source (NTPs) are rapidly consumed. Moreover, E. coli lysates have
12
high endogenous phosphatase and ATPase activities resulting in uncoupled NTP hydrolysis. Therefore,
energy supply is the main limiting factor of CFPS systems. Many protocols for these systems have been
developed with the major different between them being the energy source and pathways for efficient ATP
regeneration.
In most protocols, the problem of energy depletion is addressed by the addition of high energy
source, such as phosphenol pyruvate (PEP), acetyl phospate, or creatine phosphate (CP) as a secondary energy substrate, together with the corresponding kinases (Kigawa u. a., 1999). The use of
these energy sources has some downsides: phosphenol pyruvate is degraded by the cell lysate and its
addition increases the levels of inorganic phosphate in the reaction. This accumulation leads to sequestration of magnesium ions and causes early stoppage of protein synthesis (even with sufficient amount
of ATP present) (Kim und Kim, 2009). Creatine phosphate, unlike PEP, is not a natural substrate of E.coli
metabolism, therefore, it can be consumed through a number of metabolic enzymes in the cell lysate.
Compared with other energy sources, CP can drive the regeneration of ATP with higher efficiency. Nevertheless, as in case of phosphate-containing compounds, its utilisations leads to the accumulation of
inorganic phosphate. This problem will always occur as long as ATP regeneration is conducted based
on direct substrate-level phosphorylation reactions.
There are protocols that propose a modified energy regeneration using oxidation of substrates from
glycolytic pathway for the generation of ATP concomitant with the consumption of reaction by-products
(Calhoun und Swartz, 2005a). Substrates used include pyruvate, glucose-6-phosphate, and glucose.
The key advantage of these energy substrates is that environmental factors like pH and inorganic phosphate concentrations are more stable, which leads to an extended duration of the protein expresstion
and a higher yield (Carlson u. a., 2012). Moreover,these substrates are substantially cheaper than the
conventional energy source (PEP).
PANOx system
The PANOx system (PEP, amino acids, N AD+ , oxalic acid) was the first energy system for Cell-free
protein synthesis (Kim und Swartz, 2001). This system is based on the activation for an E. coli pathway
involving pyruvate dehydrogenase (PDH) and phosphotranscetylase (PTA) (figure 1.2). In the presence
of nicotinamide adenine dinucleotide (NAD) as a cofactor, PDH catalyses the condensation of coenzyme A (CoA) and pyruvate to make acetyl-CoA. The acetyl-CoA is then converted to acetylphosphate
by PTA. Since these two enzymes are present in the cell lysate, the simple addition of the cofactor (NAD
and CoA) is sufficient to regenerate ATP from pyruvate. Besides, since PEP leads to the accumulation
of pyruate, the simple addition of the cofactors to the conventional PEP-utilising cell-free synthesis system improves the efficiency of ATP supply substantially through the secondary ATP regeneration from
pyruvate (Kim und Swartz, 2001). Also, the addition of sodium oxalate –which inhibits PEP synthase–
helps to retard the non-productive degradation of PEP. Using this energy regeneration protocol, approximately 300mg.mL−1 of protein can be generated in a single batch reaction.The PANOx technology was
licensed to Roche Diagnostics and provides the basis for their high yielding cell-free protein synthesis
kits (Swartz, 2006).
13
Figure 1.2: ATP regeneration pathways for cell-free protein synthesis. Commonly used reaction sequences (Cre-P (Creatinephosphate); PANOxSP (PEP, Amino acids, NAD+ , Oxalic acid, Spermidine
and Putrescine) are indicated (Whittaker, 2013).
Cytomim system
The Cytomim system was developed taking into account that cytoplasmic mimicry would encourage
more natural metabolism (Record u. a., 1998). The use of unnatural components such as HEPES buffer,
polyethylene glycol (PEG), and acetate was banned. Spermidine and putrescine were added as an
alternative to stabilise and regulate the function of DNA, RNA, tRNA, and several other components. In
addition, acetate was aloso replaced by glutamate. However, the most important change in the system
was the energy source.
The activation of oxidative phosphorylation was also explored in this system (figure 1.3). In the
presence of thiamine pyrophosphate (TTP) and flavin adenine dinucleotide (FAD), acetyl phosphate
is generated through the condensation of pyruvate and inorganic phosphate (Lian u. a., 2014). The
acetyl phosphate is Tthen catalysed by endogenous acetyl kinase in the E. coli S30 lysate. Oxygen is
required for the generation of acetyl phosphate and the H2 O2 (produced as a by-product) was sufficiently
degraded by endogenous catalytic activity (Kim und Kim, 2009). Nevertheless, this system requires
inverted membrane vesicles to perform oxidative phosphorylation. The vesicles are produced by the
high shear rate during cell lysis and remain in the cell extract after the clarification steps.
The Cytomim system provides a stable energy supply and maintains better homeostasis for protein expression without phosphate accumulation, pH change, or the need for expensive high-energy
phosphate compounds. With this system, the protein synthesis was extended for up to 6 hours with
thechloramphenicol acetyltransferase (CAT) expression fivefold greater than the PANOx system(Jewett
und Swartz, 2004a). Furthermore, it also promotes protein folding as it maintains a closer distance to
14
Figure 1.3: The active biochemical reactions in the Cytomim system. Glutamate is used as an energy source in this system to produce reducing equivalents (NADH) through the TCA cycle. NADH
fuels oxidative phosphorylation in which oxygen serves as the final electron acceptor, resulting in the
supply of ATP. ATP mainly generated from oxidative phosphorylation promotes the transcription and
translation processes.GLU-glutamate; SUC-succinate; MAL-malate; PYR-pyruvate; AC-acetate; OAAoxaloacetate; ASP-aspartic acid; Pi-inorganic phosphate; IMVs- inverted inner membrane vesicles;
ETC-electron transport chain; PMF-proton motive force (Lian u. a., 2014).
the physiological environment (Yin und Swartz, 2004).
Dual energy system
Glucose (one of the least expensive and most desirable commercial substrate) is also used as an energy
source for CFPS systems (Calhoun und Swartz, 2005b). The usage of glycolytic intermediaries was
also studied after the studies that use pyruvate as an energy source that demonstrated that much of
the endogenous enzymes related to energy metabolism remain active in the lysate, and pyruvate is a
downstream product of glycolytic pathway.
When the first intermediate (glucose 6-phosphate (G6P)) was tested, it was used in the same condition of the PANOx system. Under this conditions, G6P extended ATP supply and supported protein
synthesis (Kim und Kim, 2009). This indicated that all the enzymes required in glycolys to convert G6P
into pyruvate are active; meaning one can make use of different energy sources.
During the conversion of glucose into pyruvate through the glycolytic pathway, one molecule of glucose can generate 2 molecules of ATP. In cell-free systems, pyruvate can also be used in energy production through oxidative phosphorylation pathway, however, ATP is also consumed in the glycolytic
pathway. This consumption significantly impacts in ATP concentration in the reaction mixture in the initial phase of incubation. To overcome this problem, the dual energy system was developed (Kim u. a.,
2007). In this system, a mixture of creatine phosphate and glucose are used as energy sources (figure
1.4). The inorganic phosphate from creatine phosphate was recycled to the drive glycolytic pathway
(thereby generating additional ATP molecules and retarded the phosphate accumulation during cell-free
protein synthesis). However, with this system, an appropriate pH buffer with greater buffering capacity
has to be used to compete with the rapid decreased of pH caused by the accumulation of organic acids.
15
Figure 1.4: ATP regeneration in the dual-energy system combined creatine phosphate and glucose as
the energy sources. GAP-glyceraldehyde-3-phosphate; GAPDH-glyceraldehyde-3-phosphate dehydrogenase; DPG-1,3-diphosphoglycerate; CP-creatine phosphate;CK-creatine kinase (Lian u. a., 2014).
With this system, protein synthesis was extended up to 3 hours, accompanied by an enhanced yield
of protein synthesis. The amount of the synthesised protein was 2 to 3 times higher than that from the
reactions using creatine phosphate or glucose as the sole energy source (Kim u. a., 2007).
Maltose and Maltodextrin
Maltodextrin and maltose are also being study for energy supply. These systems uses maltodextrin or
maltose phosphorolysis, glycolysis, and PANOx pathways. Maltodextrin was first described as a way
to improve ATP regeneration by recycling inorganic phosphate accumulated during cell-free expression
(Wang und Zhang, 2009). In the presence of inorganic phosphate, maltodextrin is slowly cleaved into
glucose-1-phosphate (G-1-P) catalysed by maltodextrin phosphorylase. G-1-P is further converted into
G-6-P by exogenous phosphoglucomutase. Three moles of ATP can be generated from one mole of
G-6-P through the glycolytic pathway. Finally, one mole of ATP is generated from two moles of pyruvate
through the PANOx pathway. As a result, four molecules of ATP produced from one glucose equivalent of
maltodextrin without releasing phosphate in the system. Since no phosphate is generated by this energy
source, one avoids inorganic phosphate accumulation to an inhibitory level. Compared with glucose, the
generation of G-1-P from maltodextrin does not consume ATP, therefore one molecule of ATP is saved
from glucose phosphorylation. Due to the generation of more ATP per substrate consumed, less organic
acids are generated; the pH profile is also more stable. This system requires the addition of maltodextrin
phosphorylase maltodextrin and phosphoglucomutase to the lysate.
In the last year, maltose was also used as an energy source with great success (Caschera und
Noireaux, 2014). In their study, Caschera and Noireaux were able to produce 2.3mg × mL−1 of protein
. They showed that to produce the same amount of protein, a lower concentration of maltose was
needed (around 12 to 15 mM) when compared with maltodextrin (round 30 to 35 mM). Also, the addition
of the purified enzymes(maltodextrin phosphorylase and phosphoglucomutase) to the lysate did not
improve the production: meaning that they must be present in the lysate. Finally, by coupling maltose
or maltodextrin with 3-phosphoglycerate (3-PGA), the system was able to produce a higher protein yield
16
than previously described system using dual energy sources. For the first time, more than 2mg × mL−1
of protein was synthesised in vitro using a commercial E. coli strain (Caschera und Noireaux, 2014).
1.1.5
Configurations of Cell-free systems
Cell-free protein synthesis can be carried in different configurations. The first –and most widely used– is
the batch-mode CFPS system (figure 1.5a). This simple configuration has several advantages: higher
efficiency when using expensive reagents, easy to scale-up, amenable to high-throughput processes,
and convenience of operation. This format is still one of the most common approaches for protein
synthesis (Kim und Kim, 2009). It is a convenient process for quick protein production with the production
reaching from several micrograms to 1 milligram of protein per 1 mL reaction mixture (Jewett und Swartz,
2004b). Batch reactions are ideal for high-throughput expression screens in small scales with reaction
volumes as low as a few microliters. Also, the reaction can be carried out in a microplate format and
the whole process could be automated with the implementation of modified pipetting roboters (Schwarz
u. a., 2008). This configuration has been applied to screen protein constructs suitable not only for the
structural analysis but also to the functional analysis of proteins in a genome scale (Kigawa u. a., 2008).
Nevertheless, there are disadvantages when using this system. Usually the reaction time is limited
to rapid shortage of precursors and accumulation of inhibitory by-products. As a consequence, the
protein yield is relatively low. In order to overcome this, two approaches can be used: a more efficient
energy supply (as described above), or the development of novel formats for CFPS systems that take
the principle of continuous supply of substrates into account and simultaneously the continuous removal
of the small molecule by-products (which causes inhibitory effect) (Lian u. a., 2014).
Continuous-Flow Cell-Free Protein Synthesis System
The continuous system is a major technological breakthrough in cell-free system. The continuous flow
system (CFCFS) was the first being developed (Spirin u. a., 1988). This first prototype was a modified Amicon 8MC micro-ultrafiltration system. It consisted in a reservoir to keep the feeding solution
(containing ATP, GTP and amino acids), a reaction chamber containing all translation components, an
ultrafitration membrane, a peristaltic pump, and a fraction collector. The feeding solution is pumped into
the reaction chamber through the upper lid at constant flow rate and the reaction products are removed
through the membrane at the bottom and collected by the fraction collector. Despite the size of the membrane, the small proteins involved in the reaction don’t leak. This may happen because the components
form multi-protein units. With this system, the duration of the reaction is extended to 20 to 40 hours.
In order to improve reproducibility the Amicon unit is replaced with a chamber with the capacity
equal to the reaction volume, the feeding mixture is pumped from the bottom and the ultrafiltration
membrane is placed on the top (figure 1.5b) (Kigawa und Yokoyama, 1991). In addition, a reactor
with two membranes, named Y-flow CFCFS, was developed (Spirin, 2004). The two membranes have
different pore sizes: a small pore membrane (where low molecular weight by-products are removed) and
a large pore membrane (where the protein synthesised is collected) The advantage of this reactor is that
17
Figure 1.5: The formats of CFPS system. a) Conventional batch-formatted CFPS system. b) CFCF
protein synthesis system.c) CECF protein synthesis system. d) Hollow fiber reactor. e) Bilayer CFPS
system. f) Thin film format.Reaction mixture includes cell extract, template (DNA or RNA), and RNA
polymerase (when necessary). Feeding solution includes amino acids, energy components, NTPs or
NMPs, cofactors,etc (Lian u. a., 2014).
it allows the increase of the feeding solution supply and simultaneously avoids the excessive dilution of
protein product in the collection fractions.
The protein yields obtained with the CFCF system were dependent on the prolongation of the reaction lifetime. However, the rate of protein synthesis did not increase and the final amount of produced
protein was not significantly larger than the one obtained from an optimised batch system. Moreover,
the complexity and high cost of this system makes it impractical (Lian u. a., 2014).
Continuous-Exchange Cell-Free Protein Synthesis System
The continuous-exchange cell-free protein synthesis system (CECFS) was designed to simplify the operation complexity of the CFCF system (figure 1.5c). The idea is to separate the reaction into two
compartments: one holds the reaction mixture (RM) with the high molecular weight compounds (such
as the lysate, enzymes a nucleic acids); the second holds the feeding mixture (FM) composed of low
molecular weight compounds (such as NTPS, energy source and amino acids). The reaction mixture
18
is separated from feeding solution by the dialysis membrane (Kim und Choi, 1996). The diffusion between reaction mixture and feeding solution through the dialysis membrane allows continuous supply of
low molecular weight substrates for the reaction, and low molecular weight by-products were continuously removed from the reaction chamber. Sufficient exchange between the compartments is insured
by vigorous stirring or shaking during incubation
This strategy is very effective at extending the duration of active translation. By preventing the leakage of protein synthesis machinery, the initial rate of protein synthesis could be maintained for at least
for 14 hours and 1.2mg × mL−1 CAT protein was produced (Lian u. a., 2014). By using a condensed
E. coli S30 extract, the yield of CAT was raised to 6mg × mL−1 in the coupled transcription/translation
system (Kigawa u. a., 1999). This system was also successfully used to measure NMR spectra (Kigawa
u. a., 2008).
Hollow Fiber Reactor
In this CFPS system (figure 1.5d), the reaction mixture is placed inside or outside of the hollow fiber
with the feeding mixture placed on the opposite side (Yamamoto u. a., 1999). Because of the large ratio
of membrane/surface (compared to the reactor volume), sufficient exchange is achieved with a hollow
fiber reactor. In addition, in-place condensation of reaction mixture can be achieved, which increases
the protein production rate. One major advantage over other CECF systems is that this system can be
scaled-up easily for industrial production.
Bilayer System
Although the continuous CFCF and CECF systems are capable of producing larger amounts of proteins than batch systems, the complexity of the membrane makes them unsuitable for high-throughput
strategies. Thus, there is a need to develop a reaction system which is mechanically simpler and more
cost-effective than membrane systems and that can synthesise greater amounts of protein than the
batch reaction.
One system that overcomes this limitation is the bilayer system (figure 1.5e) system (Sawasaki u. a.,
2002a). In this systems, the feeding mixture is overlaid onto reaction mixture, without a mixing process. This allow a continuous supply of substrates as well as the continuous removal of small byproducts through the interphase between the two mixtures by diffusion. This system can be performed
in well plates 10µL and stay functional for a longer time (Rosenblum u. a., 2012). It produces than
ten times more than the similar batch reaction. The synthesised protein quantities in this system are
high enough for functional analysis of gene products, which makes bilayer systems a suitable option for
high-throughput processes in the post-genome era (Lian u. a., 2014).
New Formats of Batch Mode Reaction
Although hollow fiber can be easily scaled-up, it cannot use reagent effectively (since it is based in
continuous exchange system). It does not allow energy systems that require gas exchange, such as
19
the Cytomim system. The batch mode reaction has several advantages: it is relatively simple, it uses
reagents efficiently, and the gas exchange can be easily realised by a specific designed reactor. Despite
these advantages, the protein yield of protein per ml reaction may be limited due to reactants depletion,
and accumulation of inhibitory by-products.
To overcame this problems, a scale-up model for cell-free protein synthesis system was developed,
the thin film method (figure 1.5f) (Voloshin und Swartz, 2005). In this method, the batch reaction is
placed on a thin film. This provides a large gas/liquid interface allowing a continuous oxygen transfer, as well as a large hydrophobic surface. This facilitates protein expression and folding by binding inhibitory hydrophobic molecules such as misfolded polypeptide chains, lipids, and various small
molecules (Rosenblum und Cooperman, 2014). With this method, high concentration of active protein is
achieved in a format that can be scaled up without the loss of yield. The thin film reaction format may be
applicable to synthesise many target proteins under various cell-free systems and reaction scales (Lian
u. a., 2014).
A stirred tank reactor format was also developed as a scaled up method for CFP synthesis (Swartz,
2006). With the appropriate stirring rate, abundant gas supply, suitable temperature, real-time control of
pH, and sufficient substrates, protein synthesis rate can be maintained at a high level. Due to its high
controllability, the stirred tank reactor may be the most probably applicable reactor for industrial CFPS
use (Lian u. a., 2014).
1.1.6
Folding and post-translational modifications
The synthesis of complex and active proteins has always been a main goal for cell-free protein systems.
CFPS systems have the advantage of allowing the adjustment of the environmental conditions. This
provides a high degree of control over post-translational processing events. To improve protein folding
and post-translational processing many strategies have been developed: adding a variety of reagents to
stabilise the proteins, the addition of folding catalysts, or even the re-feeding of critical components. In
example, additives such as PEG can be supplemented to induce a molecular crowding effect. Besides,
DTT can also be added to the reaction to maintain T7 RNAP in its reduced and active form.
Nevertheless, even when the protein produced with a cell-free system is insoluble, it tend to be more
readily solubilised and re-folded than protein recovered from inclusion bodies in cell-based systems
(Swartz, 2012).
Membrane proteins
Production of integral membrane proteins in living cells can be difficult as a result of toxic side-effects
relating to membrane disruption. Due to their hydrophobicity, protein aggregation, misfolding and low
yield, membrane proteins may be toxic to the cell. Also, when expressing ion channel proteins, they can
disrupt the integrity of the cell membrane and lead to cell lysis.
In vitro systems allow the direct insertion of an integral membrane protein product into lipid structures
(Schneider u. a., 2010). These systems overcome all the problems present in the production of mem20
brane proteins in in vivo systems. Cell-free synthesis of membrane proteins has been accomplished
using a variety of lipid structures: liposomes, micelles, bicelles and nanodiscs (Lyukmanova u. a., 2012).
The presence of lipid structures mitigates aggregation and insolubility issues and there is no interfere
with the translation activity. As an example, bacteriorhodopsin was synthesised in a cell-free system and
co-translationally inserted into giant liposomes, where its photochemical proton pumping function was
demonstrated (Kalmbach u. a., 2007).
Chaperones
The exogenous supply of chaperones to cell-free protein synthesis systems has also been reported
(Jiang u. a., 2002). It suggest that the effect of these catalysts have in the system is protein-dependant.
For example, The addition of purified DnaK, DnaJ, GroEL and GroES has been reported to be beneficial
for the synthesis of single chain and fragment antigen binding (Fab) antibodies.
Besides the addition of natural foldases, synthetic approaches have also been developed. In order
to mimic chaperone-assisted folding in the endoplasmic reticulum, eukaryotic Hsp70 chaperone BiP
was tied to a trigger factor, which is a ribosome-associating E. coli chaperone. The result was an
improvement in soluble protein yields for secreted eukaryotic proteins (Welsh u. a., 2011).
Disulfide bond formation
The formation of disulfide bonds is another important post-translational processing step that can be problematic in prokaryotic expression systems. A cell-free system that can fold complex protein must secure
the hydrophobic regions of the target protein from one another, provide the proper natural chemical environment, incorporate cofactors (such as iron–sulfur clusters), encourage disulfide bond formation, and
promote disulfide bond (Carlson u. a., 2012). One of the main difficulty for CFPS systems is in reproducing in vivo oxidative folding pathways to allow for formation and isomerisation of disulfide bonds. Unlike
cell-based systems (which have different regions to separate protein biosynthesis from oxidative folding)
cell-free systems have to accomplish both tasks using the same compartment.
Despite these problems, considerable progress has been made towards enhancing the folding of
eukaryotic proteins with multiple disulfide bonds. In CFPS systems, it is possible to achieve an oxidising
environment balancing the redox potential reaction. For example, one can pre-treat the cell extract with
iodoacetamide (IAM) (which is an alkylating agent that covalently blocks the free sulfhydryl groups of
cellular enzymes). One can do this using a glutathione buffer to provide an oxidising environment, and
providing the disulfide bond forming enzyme DsbC. The synthesis of active urokinase and a truncated
form of tissue plasminogen activatator was achieved in (Kim und Swartz, 2004; Yin und Swartz, 2004).
In E. coli disulfide bond formation systems, there are a variety of enzymes to form these bonds and
help nascent polypeptides attain their active conformation without aggregation. Simple addition of these
molecules has been important for the production of complex proteins in vitro (Katzen u. a., 2005). In
the recent years, improved proper bond formation and protein folding was achieved by incorporating
amphiphilic polysaccharide nanogels into the cell-free reaction (Sasaki u. a., 2011). This allows the
21
binding and then controlled release of peptide chains, preventing aggregation and misfolding for some
proteins.
Glycosylation
Another post-translation modification is the glycosylation. It is the most widespread and complex form
of post-translational modification in eukaryotes. One major challenge for production of glycoproteins is
that these are produced as a mixture of glycoforms (Walter und Blobel, 1983). Proteins are translocated
to the lumen of the vesicles where their leader peptide is cleaved and they acquire the oligosaccharide
chain. In cell-free systems, this transportation is disrupted, therefore, further processing of the oligosaccharides is prevented. However, some variation in the glycosylation pattern can still be observed in
CFPS systems due to non homogeneous folding that restricts the access of the glycosylating enzymes
(Bulleid u. a., 1992). A cell-based lysate produced from Spodoptera frugiperda 21 was reported to provide core protein glycosylation enzymes without the need for supplementing the reaction with membrane
vesicles (Tarui u. a., 2001).
Other post-translational modifications, such as phosphorylation, myristylation, farnsylation, isoprenylation and adenylation have been observed in lysates from higher eukaryotes (Jackson u. a., 2004). Because of all these modifications and the dynamic nature of post-translational modifications, it is very
difficult to produce homogeneous protein samples in both in vivo and in vitro systems (Katzen u. a.,
2005). Methods for creating artificial post-translational modification that mimic the structure of the natural ones, have been proposed as a solution for this problem (Davis, 2004). Cell-free systems may be
the ideal platforms for this novel strategy.
1.1.7
History and applications
The first known example of a cell-free system is the Nobel Prize work by Eduard Buchner in 1897. Eduard Buchner was helping his brother, a physician, by looking for a way to preserve extracts from yeast
cells. Thinking about jams and jellies, he tried adding sugar. To his surprise the mixture began bubbling
as glycolysis converted the sugar to alcohol with the release of CO2 . This was the first realisation that
biological reactions could occur outside of a living cell, contradicting Louis Pasteur’s beliefs. Nevertheless, it was only in the beginning of 1950s that the first demonstrations of cell-free protein systems
appeared in different research labs, with the observation of the incorporation of radioactively labelled
amino acids into proteins using crude cell extracts (Borsook, 1950; Winnick u. a., 1950). Disrupted cells
or their isolated fractions were reported to be capable of synthesising proteins.
A revolutionary step in the development of cell-free translation system was the introduction of exogenous messages. This was achieved in 1961 by Nirenberg and Matthaei with a bacterial system. They
reported the use of CFPS to decipher the genetic code, earning the 1968 Nobel Prize in Physiology or
Medicine (Nirenberg, 2004). Nirenberg and Matthaei also proved the dependence of bacterial cell-free
system on the presence of DNA. Some years later, coupled transcription-translation systems were developed by using exogenous bacteriophage DNAs, but they were poorly active. This type of systems
22
became popular after major improvements made by Zubay research group. The Zubay group developed
a system with a simple preparation, stable extracts and highly active. In 1973, he and his coworkers
reported the cell-free synthesis of rat growth hormone (Bancroft u. a., 1973). In 1988, a substantial advance was made when Alexander Spirin reported the use of ultrafiltration membranes to stabilise the
small molecule environment by continually providing substrates and removing inhibitors. Protein synthesis catalysed by either E.coli or wheat germ extracts continued at constant rates for more than 40
hours and accumulated 100-fold more product than a batch reaction (Spirin u. a., 1988). This approach,
referred as continuous-exchange cell-free system, was commercialised but it had a major problem: a
large volume of the feeding solution made the technique relatively expensive.
Many years went by without huge modifications to the process developed by Zubay. In the recent
years, the Swartz laboratory made several advances. They focused on the commercial scale protein
production, and started to analyse the process cost and feasibility. They concluded that the energy
source and the nucleotide costs dominated and were unacceptable. Simple scale-up methods were
required and protein folding was inadequate (particularly for proteins requiring diffusible bonds). To
tackle the energy source cost, the PANOx (amino acids, NADPH, oxalic acid) system was first developed,
but it was still expensive. In 2008, Michael Jewett developed the Cytomim (cytoplasmic mimic) (Kim und
Swartz, 2004) , and Kim’s research group developed a system that used soluble starch or glycogen as
energy substrates (Kim u. a., 2011). They produced the highest known protein yield.
For the eukaryotic expression systems, Yaeta Endo’s group discovered that early wheat germ extracts contained a protein synthesis inhibitor (Madin u. a., 2000). This could be removed by extensive
washing to dramatically increase protein expression yields. The resulting system has now been extensively developed for the production of multiple proteins in parallel (Goshima u. a., 2008). Shimizu’s
group extended the concept further by demonstrating protein synthesis using only purified components
(Shimizu und Ueda, 2010). (This was named the PURE system.)
In 2010, the first effective production of granulocyte macrophage colony stimulating factor (GMCSF)
at the 100-L scale was reported by Sutro (Winnick u. a., 1950). Sutro is now establishing the first cellfree GMP capability for pharmaceutical protein production. Recently, founded biotechnology company
(GreenLight Biosciences) uses an unconstrained metabolism technology platform based on a cell-free
protein system to deliver an attractive solution for the production of chemicals and fuels from renewable
resources. Figure 1.6 PRESENTS a time line of cell-free protein synthesis milestones in the production
of complex proteins.
1.1.8
Applications
For decades, cell-free systems have been used as a tool in fundamental and applied research. However,
it was not until recently that cell-free systems have been considered commercial feasible for therapeutics, metabolites or non-natural products (Zawada u. a., 2011). As mentioned before, those systems
are capable of unconstrained metabolism, providing advantages for optimising pathway flux, bypassing
substrate limitations through metabolic channelling, and directing resources towards a single objective
23
Figure 1.6: Timeline for CFPS milestones in the production of complex proteins. Abbreviations: scFv:
single-chain antibody variable fragment, vtPA: variant of human tissue-type plasminogen activator, GMCSF: granulocyte macrophage colony stimulating factor, IGF-I: insulin-like growth factor I, cIFN-α: human consensus interferon-alpha, rhGM-CSF: human granulocyte macrophage colony-stimulating factor
(Carlson u. a., 2012).
(Hodgman und Jewett, 2012). Although cell-free systems are not yet well establish for industrial applications, the technology has tremendous potential to transform many aspects of biotechnology. This
potential has already been demonstrated in many fields in the last decades.
Incorporation of Unnatural Amino Acids
One of the most significant development in protein synthesis is the expansion of the genetic code.
This approach uses bioorthogonal cognate pair of tRNA and aminoacyl tRNA synthetase to suppress
nonsense or frameshift mutations, incorporating unnatural amino acids into the growing polypeptide and
thereby creating a chemical toolbox for protein engineering (Whittaker, 2013). Using this technique,
more than 70 distinct unnatural amino acids have been incorporated into proteins (Shrestha u. a., 2014).
Although the majority of this work has been done in vivo, cell-free systems offer some important
advantages. Unlike cell-based systems, CFPS systems are not susceptible to the toxic side-effect on
non-natural amino acids. Furthermore, these systems can be customised with unusual side chain structures by modifying the components of the translation machinery. The application of the technique to
cell-free systems is done by adding the bioorthogonal components.
The incorporation of unnatural amino acids with cell-free systems was successfully demonstrated
by the production of p-propargyloxyphenylalanine-containing proteins that can be crosslinked to form
bioconjugates via click chemistry (Bundy und Swartz, 2010). Milligram amount of ras protein were
also produced with this system, incorporating selenomethionine (Kigawa u. a., 2002). In addition, new
orthogonal aminoacyl-tRNA synthetase/tRNA pairs have been used for site-specific incorporation of
unnatural amino acids, and approximately 70 unnatural amino acids have been incorporated with high
specificity (Shrestha u. a., 2014).
24
Isotopic labeling
Labeling recombinant proteins with stable isotopes or radionucleides is important for a variety of applications including biological NMR and tracer experiments. When comparing cell-based with CFPS systems
for the production of labelled proteins, the latter have several advantages: less amino acid metabolic
scrambling, high protein yields, and selective labelling of almost any type of amino acids. The purity of
expressed products in cell-free systems can also allow for direct heteronuclear NMR analysis without
purification (Takai u. a., 2008).
Already, several thousands of protein structures have been discovered using cell-free systems (Endo
und Sawasaki, 2004). For example, these systems were used to produce 15 N and 2 H,13 C,15 N-labeled
calmodulin (CaM) samples for NMR studies (Torizawa u. a., 2004). The S30 lysate preparation protocol
was modified to decrease the content of endogenous amino acids. In addition, high yields of N-Glulabeled protein were obtained with the replacement of potassium L-glutamate with potassium NacetylL-glutamate and potassium glutarate (Jia u. a., 2009).
Virus-like particles
Virus-like particles (VLPs) are self-assembled complexes created from one or more structural proteins.
They are similar to virues, as they evoke an immunogenic response; because they do not contain genetic
material, they can be potentially used as safe vaccines (Jennings und Bachmann, 2008). Furthermore,
their self-assembled and hollow structure makes them interesting for drug delivery and gene therapy
agents.
The production of VLPs with cell-based systems is difficult due to the structural inconsistencies involved in the scale-up, protein impurities from in vivo production, and the high costs associated with
recombinant strain development (Rothengass, 2007). E. coli based CFPS platforms improved the efficiency of VLPs production. For example, the MS2 coat protein was efficiently synthesised in batch CFPS
reactions (Bundy u. a., 2008). An E. coli CFPS system was also used to incorporate click-chemistry functional unnatural amino acids into VLPs at a yield of 300µgmL−1 (Patel und Swartz, 2011). This showed
that multiple ligands can be added to these VLPs at once (with the surface composition depending on
the ligand ratios introduced). These advances demonstrate the merits of CFPS systems as a potentially
powerful VLP production platform for drug delivery and vaccines applications (Carlson u. a., 2012).
High-throughput production and screening
High-throughput protein expression platform are becoming increasingly important. Cell-free systems
serve as the basis of high throughput and automated platforms for protein production (Spirin, 2004).
Cell-free systems have many advantages: the direct use of PCR templates, high-yield batch reactions in
well plates, potential for miniaturisation and automation using microchips, easy manipulation of reaction
conditions and incorporation of isotope-labeled amino acids (Carlson u. a., 2012).
Cell-free systems are ideal for proteomics studies and protein engineering for identifying the desired
proteins from libraries of high-sequence diversity. As these systems can express protein population
25
in a single reaction, they are ideal for the comprehensive screening and isolation of cloned proteins
from libraries. In vitr o expression cloning (IVEC) is a technology where a large collection of clones is
first divided into pools of 50–100 cloned plasmids in multiple wells for expression in a cell-free system
followed by activity analysis (Jackson u. a., 2004). Pools with a positive active clones were further
subdivided until single clones were obtained. This way, cell-free protein synthesis has been used to
screen and isolate engineered proteins from a diversified mutant library fully in vitro. This system was
used to screen whole genome libraries to discover new genes from Arabidopsis talia (Sawasaki u. a.,
2002b).
Another application is to use cell-free systems to screen for optimal conditions and DNA constructs
before large scale protein production in vivo. Studies suggested that the optimised expression conditions
obtained in this system are applicable to in vivo production (Lamla u. a., 2006).
In Vitro Display Technology
In vitro display technologies (which include ribosome display, mRNA display, and DNA display) are powerful tools for the selection of proteins and peptides from large libraries. When compared with cell-based
systems, these technologies are faster and have a lower cost. They are based on the concept of the
linkage of phenotype to a genotype in CFPS systems. For example, in ribosome display, the individual
nascent proteins are coupled to their corresponding mRNAs, creating stable protein–ribosome–mRNA
complexes. In DNA display, the protein-DNA fusions are formed through the linkage of streptavidinfused polypeptides and their encoding biotinylated DNAs are formed in emulsion compartments. Other
hypothesis is the use of the cis-nicking activity of the replication initiator protein from E. coli bacteriophage (Rothe u. a., 2006).
In mRNA display technology, proteins are linked to encoding mRNA after dissociation from the translating ribosome (Roberts und Szostak, 1997). In this technology, hybrid RNA–DNA molecules are first
generated chemically in vitro and used as a template. When the ribosome reaches the RNA-DNA junctions forms a covalent linkage with the growing nascent polypeptide. Purified protein–mRNA fusion
molecules are then used as the selection entities (He, 2008). This technique has been used to select
both natural and synthetic libraries. For example, it has been used to obtain antigen-binding proteins
based on the scaffold fibronectin type III, producing high affinity molecules that bound TNF-α (Xu u. a.,
2002). mRNA display selected “adnectins” against VEGF receptor R2 is currently in clinical trials (He,
2008).
In ribosome display, the expression of constructs in which the stop codon has been deleted produces
protein–ribosome–mRNA complexes as selection particles in which the nascent polypeptide is linked to
its encoding mRNA. This linkage allows the isolation of the protein together with its encoding mRNA
and that can be used in a recursive cycle of functional selection and mutagenesis to drive molecular
evolution of proteins with improved activity. Both eukaryotic and prokaryotic in vitro ribosome display
systems (with different modifications and distinctive DNA recovery procedures) have been studied (He
und Khan, 2005). However, PURE systems are especially well suited for this application, because they
allow release factors to be omitted and can accommodate incorporation of unnatural amino acids (Watts
26
und Forster, 2012).
Ribosome display has been widely used in for in vitro antibody selection, evolution and humanisation (He und Khan, 2005). Antibody fragments with high affinity, recognising conformational epitopes or
having catalytic activities have been selected or evolved (Jackson u. a., 2004). Novel peptides, tag sequences, ligand-binding domains/motifs, transcription factors, proteases, receptors and enzymes have
also been successfully selected. Protease-resistant domains have also been engineered and isolated
for use as alternative scaffolds or antibody mimics (Binz u. a., 2004). Recently, an intracellular ribosome
display method was developed using E. coli Sec M translation arrest mechanism to generate complexes
inside living cells (Contreras-Martı́nez und DeLisa, 2007).
In proteomic applications, ribosome display allowed a comprehensive identification of antigenic proteins for use as potential vaccine candidates from an entire genomic cDNA library of Staphylococcus
aureus (Contreras-Martı́nez und DeLisa, 2007). In addition, a sequence of 5’-untranslated region (5’
UTR) –promoting translation efficiency– has been identified through ribosome display of diversified sequences (Mie u. a., 2008).
Cell-free protein array technologies
Protein microarray technology is a powerful tool for high-throughput, parallel analysis of proteins in a time
and cost-effective manner. It is composed by hundreds or thousands of proteins that are immobilised
on a solid surface in a miniaturised format. This technology has been applied to proteomic studies,
such as protein-protein interactions, protein expression profile, biomarker discovery and monitoring posttranslational modifications (Lian u. a., 2014). Traditional cell-based microarrays are a time-consuming
and cost-intensive technology, which requires the expression and purification of the individual proteins to
be arrayed. In addition, there are limitations in maintaining proteins in their functional state on surfaces
for long-term storage.
Cell-free systems offer an alternative to cell-based systems as they allow direct high-throughput
protein synthesis and screening. These proteins arrays are produced by in situ methods: proteins are
synthesised directly onto the surface from arrayed DNAs or mRNAs (He u. a., 2008b). This way, there is
no need to separate protein expression, purification, and spotting; there are also no limitations with the
maintenance of the stability during storage.
Cell-free based in situ protein microaarays can be produced in a variety of methods and take advantage of the programmability of protein synthesis by transcripts formed from either linear DNA or a plasmid
vector. There are several formats for protein microarrays including protein in situ array (PISA), nucleic
acid programmable protein array (NAPPA), DNA array to protein array (DAPA), and in situ puromycin
capture from a mRNA array (Lian u. a., 2014).
Protein in situ arrays (PISA) is performed on a surface precoated with a protein-capturing reagent
where the newly synthesised protein is captured and immobilised in situ (He und Taussig, 2001). In
nucleic acid programmable protein array (NAPPA), DNA and an antibody are spotted onto a glass side
and then covered with the cell-free system. This way, the expressed protein is trapped by the antibody in
each spot (Ramachandran u. a., 2004). NAPPA has been applied to produce high-density protein arrays
27
to identify immune response signatures of breast cancer autoantibodies in patient sera (Anderson u. a.,
2008). DNA array to protein array (DAPA) differs from the other methods because it allows the reuse of
the DNA array. It generates pure protein arrays on a separate surface (He u. a., 2008a). DAPA has been
used to array antibody fragments, GFP, GTP-binding protein and, transcription factors.
Therapeutics
The advances made in terms of costs, scale, and protein folding in the cell-free systems made them
commercial desirable which led to the use of this technology in therapeutics being intensified (Zawada
u. a., 2011). One potential use for this technology is the production of personalised medicines.
Cell-free system have some important advantages for the production of patient specific medicines.
The system is fast, flexible, has high-yield expression, and a simple downstream processing method.
A cytokine-fused single chain antibody fragment (scFv) of immunoglobulin (Ig) idiotype (found on the
surface of specific B-cell lymphoma) was produced using a E. coli CFPS system (Kanter u. a., 2007).
The scFv fusion was able to elicited an immune response against the native Ig protein. This vaccine
was produced in a matter of days, instead of moths as the traditional mammalian cell expression.
Besides patient specific medidices, CFPS systems have been used to identify new drug candidates
for existing and emerging threats in different diseases such as cancer, hepatitis, and malaria. The
Protein Truncated Test (PTT) was developed to identify open reading frames (ORFs) for diagnostics of
genetic diseases caused by translation-terminating mutations (Roest u. a., 1993). Screening of vaccine
candidates by cell-free systems led to the identification of effective vaccines that protected mice against
tumour (Kanter u. a., 2007). As another example, WGE systems were used to express 124 genes
from the malaria genome as possible vaccine candidates (Tsuboi u. a., 2008). CFPS was also used to
synthesise vaccine candidates for botulinum toxinsat in concentrations 1mg × mL−1 greater (Zichel u. a.,
2010).
1.1.9
Synthetic biology frontiers
Cell-free synthetic biology is emerging as a powerful technology, capable of complementing the work
in cellular in vivo systems. This is due to the extraordinary level of control and surprising diversity of
approaches available for building biosynthetic systems without the constraints that limit cellular engineering.
For decades, most cell-free systems have focused on obtaining and activating biocatalysts that make
a desired product. Less attention has been given to establishing a fundamental molecular ”toolkit” for
engineering. However, cell-free systems offer a flexible platform to use orthogonal chemistries in order
to synthesise non-natural products towards the goal of expanding the chemistry of life (Hodgman und
Jewett, 2012). Therefore, in the last years cell-free systems are being used to construct genetic circuits,
protein cascades, compartmentalisation, spatial organisation, and minimal cells. With the help of cell
free systems, synthetic biology continues to push the boundary of what does exist to what can exist.
One of the main fields in synthetic biology is the construction of genetic circuits. This relies on the
28
ability to use DNA as a language to write synthetic genetic programs comprised of ”parts” that rewire and
reprogram organisms. Cell-free system are being used to attempt to program circuits and logic gates.
Genetic circuits contain well-characterised promoters and regulatory sites with factors to implement
logic operators using circuit-like connectivity. A CECF system was used to synthesise ortgonal RNA
polymerases in series when controlled by the previous polymerase promoter region, and eventually
expressing a protein of interest (Noireaux u. a., 2003). This example is similar to a linear electrical
amplifier, but without instantaneous signals. In vitro transcriptional oscillators were also developed (Kim
und Winfree, 2011).
The reintroduction of synthetic compartments to a cell-free system offers a versatile approach for
confining enzyme systems to a specific geometry, linking functional phenotypes to the genes that encode
for them, or adding new function. There are two main approaches to encapsulate cell-free systems: in
phospholipid membranes and capturing enzymes and in water droplets suspended in an oil emulsion,
termed in vitro compartmentalisation (IVC). IVC is used for directed evolution of enzyme activity. For
example, it was used to increase the activity of bacterial phosphotriesterase, creating one of the fastest
hydrolases ever recorded (Griffiths und Tawfik, 2003). Besides encapsluation, functionality can also be
added by introducing synthetic biocompatible compartments, such as DNA hydrogels or lipid disks for
membrane bound protein expression (Hodgman und Jewett, 2012).
One of most important difference between in vitro and in vivo systems is the enzyme concentration. Since biochemical reaction networks involve multiple reactions, increasing the concentrations (and
hence proximity of enzymes and other mediating factors necessary for synthetic networks to function
optimally) may increase productivity. In order to overcome this, synthetic biologists have already developed a number of methods for immobilising or tethering enzyme pathways in a specified geometric
arrangement. One example is surface tethering in microships: by changing the composition of DNA on
the chip, pathways can be built, optimised, and reconstructed (Zhang u. a., 2005). Protein scaffolding
is another technology that can be used. The key idea is to localise the enzymes of a pathway using
protein–protein interactions so that they function as a metabolic channel (rather than as individually
dispersed enzymes). A more simple and non-specific method is to produce covalently linked enzyme
aggregate (CLEA) particles (van Rantwijk und Sheldon, 2007). This method was successfully used
to produce nucleotide analogs that are otherwise toxic to cells (Scism und Bachmann, 2010). Finally,
chemical or natural detergents and surfactants such as Tween-20 and Ranaspumin-2 can be used as a
foam to spatially disperse enzymes and (Hodgman und Jewett, 2012).
In order to improve the understanding of life, its origins and enable production of natural and unnatural
chemical entities, synthetic minimal cells are being designed (Jewett und Forster, 2010). There are
two methods to approach minimal cells: top-down approach (where efforts to reduce the complexity
in vivo by minimise cellular genomes), and a bottom up approach (where the synthesis of DNA, RNA,
protein and membrane in done in vitro). The intention is to build a minimal biological system that is
self-replicating, or autopoietic, from individual biomolecular parts that function together (Murtas, 2009).
In one example, a PURE system was used to produce active membrane-bound proteins that converts nglycerol-3-phosphate to phosphatidic acid, a key precursor to membrane synthesis. This demonstrates
29
a necessary step towards a self-sustaining system that can grow and maintain a bilayer membrane
(Kuruma u. a., 2009).
30
Chapter 2
Objectives
Cell-free protein synthesis has emerged as an important and effective alternative to both cell-based
expression systems and solid-phase protein synthesis. However, there still some challenges that must
be exceeded: the ability to reliably synthesize any biologically active protein in an universal platform, the
lack of a cost effective and scalable CFPS platform, and the inability to carry out humanized glycosylation
patterns (Carlson u. a., 2012).
The main objective of this work is to construct an E. coli cell-free system platform. Since a cell-free
system is constituted by complex variables, we decided to divide the work in 4 major task: Template
preparation and purification, tRNA purification, lysate preparation, and cell-free protein synthesis.
Template preparation and purification
In the first task (plasmid preparation and purification) the main goal is to construct a DNA template
suitable for this system. This template must contain all the key components and the simplicity necessary
to be successfully used in these systems. In order to achieved a higher purification at a lower cost,
alkalyne lysis and hydrophobic interaction chromatography (HIC) were tested for plasmid purification.
tRNA purification
Total tRNA purification methods are also being tested in this study. It is important to use exogenous
tRNA in these systems because the addition of pure tRNA will increase protein production; this also
allows a better control over the reaction.
Lysate preparation
Preparation of the S30 lysate is one of the most important steps for successfully constructing a cell-free
system. In this step it is important to chose the adequate E. coli strain along with the mechanism of cell
disruption. Here, the main objectives are to test BL21(DE3) strain and bead milling as lysis mechanism
for the lysate production. Besides testing the produced lysates with the cell-free production, we are also
quantifying the protein concentration and calculate cell-lysis efficiency.
31
Cell-free protein synthesis
Our last objective is to mount the cell-free system. First, t the DNA templates and the produced S30
lysates are going to be tested using a commercial kit. Next we are going build the cell-free system using
a cytomimic system as the energy system. Finally, some of the cell-free system variables (magnesium
concentrtion, plasmid concentration and lysate volume) are going to be further studied and optimised.
32
Chapter 3
Materials and Methods
3.1
Template preparation
Three plasmid template were chosen for this study: a pEXP5-NT/CALML3, a pETGFP and a pEXP5NT/GFP (figure 3.1). The plasmid pEXP5-NT/CALML3 was obtain from Lifetecnologies. It contains a
human calmodulin-like 3 gene (CALML3; GenBank accession number NM 005185) in frame with the
N-terminal tag (His-tag), a bacteriophage T7 promoter, a ampicilin resistance gene for selection in E.
coli, and a pUC origin. TOP10 (Invitrogen) competent cells were transformed with the protocol described
bellow.
The pETGFP plasmid was previous constructed in the laboratory. A GFP gene was isolated from
pVAXIGFP and inserted in a pEt28a+ vector. The resulting plasmid contains a GFP gene, a bacteriophate T7 promoter, a kanamycin resistance, a pBR322 origin, and a lacI coding sequence. The strain
JM109 was transformed with this plasmid.
The pEXP5-NT/GFP was produced in this study. The GFP gene was isolated from pVAXIGFPBHGI and inserted in pEXP5-NT vector. The pEXP5-NT was obtain by excision of the CALML3 gene.
The obtained plasmid has the same characteristics as pEXT-NT/CALML3. The BL21(DE3) (Invitrogen)
competent cells were transformed with this plasmid.
(a)
(b)
(c)
Figure 3.1: Representations of the plasmids used in this study. 3.1a) pEP5-NT/CALM3 (3194 bp); 3.1b)
pEXP5-NT/GFP (3685 bp); 3.1c) pETGFP (6088 bp).
33
3.1.1
pEXP5-NT/GFP construction
The E. coli strains (with the respective plasmid) were grown overnight in a 15 mL falcon tube with 5
mL of Luria-Bertani (LB) medium (Nzytech) in a rotary shaker at 37o C and 250 rotations per minute
(rpm). The growth was supplemented with the respective antibiotic in a concentration of 100µg × mL−1
for the ampicilin (Sigma), and 50µg × mL−1 for kanamycin (Amresco). The cells were harvested by
centrifugation in an Eppendorf centrifuge 5810R at 6000×g and 4o C for 5 minutes. The plasmid was
purified with high pure plasmid purification kit from Roche Life Sciences. The plasmid concentration was
measured in NanovuePlus (GE Healthcare). The plasmids were stored at 4o C for further use.
pEXT5-NT/CALM3 digestion
To obtain the vector for cloning, the pEXT5-NT/CALML3 plasmid was digested with restrictions enzymes.
To Analyse the plasmid sequence and the restriction enzymes available, PvuIII (ThermoScientific) and
SacII (Promega) were chosen. In order to optimise the digestion, a total four combinations with two
diffident buffers and two different buffer volumes were tested. All of the tests were performed at 37o C in
an incubator (Memmert) for 4 hours. The buffers used were the ones in which the respective enzyme had
100% activity: For PvuII, buffer G (ThermoScientific), and for SacII buffer C (Promega). The digestion
was set in a 1.5 mL eppendorf tube with a final reaction volume of 20 µL. For the 1000 ng of plasmid
added, 0.5 µL of each restriction enzyme was used. The volumes used in the digestion are represented
in table 3.1. Finally, water was added to make up the 20 µL volume of the digestion.
Digestion
Plasmid(ng)
C 10X Buffer(µL)
G 10X Buffer (µL)
PvuII (µL)
SacII (µL)
1
1000
2
0.5
0.5
2
1000
4
0.5
0.5
3
1000
2
0.5
0.5
4
1000
4
0.5
0.5
Table 3.1: Digestion tests. Four different tests were performed. In all tests, 1000 ng of plasmid and
0.5 of each enzyme (PvuII and SacII) were used. In the tests 1 and 2, 2 and 4µL of 10X buffer were
tested. The same volumes were tested for G 10X Buffer in 3 and 4. Water was also added to achieve
the volume of 20 µL
After optimisation, a final digestion with 3000 ng of plasmid in a final volume of 50 µL. The conditions
used were the same as previously. After cloning the plasmid was linearised with XmnI (Promega).
Insert preparation
A Polymerase chain reaction was used to amplify the GFP gene from the pVAXIGFP-BHGI plasmid. The
primers (forward and reverse) were design with the help of APE software and manufactured by STAB
vida. Upon arrival, the primers are diluted with PCR grade water to a concentration of 100 µM and
stored at −20o C.
The PCR was performed in 200 µL tubes. Before the reaction, both the primers and the plasmids
were diluted to 10 µM and 11ng × µL−1 respectively. For this reaction, a KOD HotStart DNA polymerase
34
(Novagen) was used. The reaction components and the volumes are described in table 3.2
Components
Buffer
Magnesium
Dntps
Primers
DNA
KOD
Water
Final volume
volume (µL)
5
4.5
5
1.5 (each)
1.5
1
30.5
50
Table 3.2: PCR components and volumes (in microliters) used in the reaction.
The PCR reaction was performed in a thermal cycler Biometer TGradient. The program was design
taking into account that the desired DNA fragment has 857 base pairs (pb) and KOD enzyme has an
extension time of 25 seconds per 1000 pb. The PCR program consisted on an enzyme activation cycle
of 2 minutes at 95o C and 30 cycles with the following parameters: 95o C for 20 seconds, followed by 10
seconds at 70.3o C and a final step of 30 seconds at 70o C. The PCR program is summarised in table
3.3.
Number of Cycles
1
30
Temperature (o C)
95
95
70.3
70
Time (seconds)
120
20
10
30
Table 3.3: PCR program.
Purification of PCR product and digested vector
Both the PCR product and the digested vector were purified from an agarose gel. After the electrophoresis, the bands corresponding to the PCR product and digested vector were excised from the gel and then
purified by NZYGelpure kit (Nzytech). After purification, the concentration of both products was measured in nanodrop NanovuePlus (GE Healthcare) and stored at 4o C for further use.
Molecular Cloning
After obtaining a pure insert and vector, the next step was the construction of the pEXP5-NT/GFP
plasmid. First of all, the volume of insert and vector was calculated taking into account that 100 ng of
vector are needed and the ratio of Vector/Insert is 3. The amount of necessary insert was calculated as
follows:
Vector concentration × Insert size
×3
Vector size
(3.1)
Taking into account the concentrations measured in the nanodrop, and the amount needed, the
volume of both vector and insert was obtained.
35
The cloning reaction was performed in 1.5 mL eppendorf tube, and the T4 DNA ligase kit (ThermoScientific) was used. The volumes of the components used for this reaction are represented in table
3.4
Components
Vector
Insert
T4 DNA ligase
T4 Buffer
Water
Total volume
Volume (µL)
3.8
2.2
0.25
2
11,75
20
Table 3.4: Molecular cloning reaction components and the respective volumes in µL
The reaction was performed in two different ways. First it was incubated at 22o C for 1 hour in a
dried bath (AccuBlock Digital dry bat, Labnet International). Then, 10µL were used to transform BL1
(DE3) competent cells and the remaining was incubated overnight at 4o C. In the next day, the overnight
reaction was also used to transform BL21 (DE3) competent cells.
3.2
Agarose gel electrophoresis
In order to access the plasmid quality, the digestions and the PCR product a agarose gel electrophoresis
was performed. The gel was prepared with 1% of agarose (Nzytech) in 1×TAE buffer. The agarose was
dissolved by heating the mixture in the microwave. When fully dissolved, the mixture was poured into
a tray it was left to solidify. After solidification the gel is transferred to an electrophoresis tray where it
stays submersed with TAE buffer (0.04 M Tris–acetate (Eurobio), 1 mM EDTA (Panreac)). The samples
were prepared by adding a 6× loading buffer (40% (w/v) sucrose (Sigma), 0.25%(w/v) bromophenol
blue (Sigma)) to a concentration of 1× and then inserted into the wells on the gel. A NZYDNA Ladder
III (Nzytech) was loaded into the gel. Electrophoresis was performed using TAE as ruining buffer at a
voltage gradient of 5 V/cm . The gel was stained in a 0.4µg × mL−1 ethidium bromide (Sigma) bath
for 15 minutes. Finally, the gel was visualised and photographed with Stratagene Eagle Eye II imaging
system.
3.3
3.3.1
Cell transformation
Preparation of chemically competent cells
In order to transform E. coli chemically, competent cells must be prepared first. Cells without plasmid
were grown overnight at 37o C and 250 rpm in 15 mL falcon tubes with 5 mL of LB medium without
antibiotic supplementation. In the morning, the optical density was measured at a wavelength of 600 nm
(OD600 nm) on a Hitachi U-2001 UV/Vis Spectrometer. The cells used to inoculate new LB medium to
an OD600 of 0.1. A 100 mL erlenmeyer with the 30mL of medium was incubated in an orbital shaker at
36
37o C and 250 rpm until it reached an OD600 of 1. The cells were centrifuged at 6000 rpm and 4o C for
3 minutes. The pellet obtained was resuspended in 1/10 of original volume of TSS with ice-cold TSS
buffer. This buffer is composed of 10% of PEG 8000 (Sigma), 1% DMSO (Sigma), and 20mM M gCl2
(Fragon) with a pH of 6.5. After resuspension, the cells were placed on ice for 10 minutes. The cell
suspension was conditioned in a volume of 100 mL in 1.5 mL eppendorf tubes, and store at −80o C for
further use.
3.3.2
Transformation of chemically competent cells
The pure plasmid obtained was inserted into competent cells by thermal transformation using a heat
shock. The plasmid was added to the chemically competent cells and left on ice for 30 minutes. Then,
the mixture was heated in a water bath for 1.5 minutes and immediately placed on ice for 2 minutes. The
mixture was added to 1 mL of LB and incubated at 37o C for one hour. 100 mL of the resulting culture
were spread on a LB agar (Nzytech) plates (supplemented with the respective antibiotic) and grown
overnight at 37o C. The next day, isolated colonies were picked from the plates and cultured in 15 mL
falcons with LB medium supplemented with the respective antibiotic to produce cell banks.
3.3.3
Cell banks preparation
Isolated colonies of previous cell banks were inoculated to a 15 mL falcon containing 5 mL of LB medium
supplemented with the respective antibiotic. The cells were cultured overnight at 37o C and 250 rpm in
an orbital shaker. In the next day, the optical density was measured. This culture was used to inoculate
30 mL LB medium to an OD600 of 0.1. The 30 mL were placed in a 100 mL erlenmeyer with the correct
antibiotic supplementation. The cells were grown until an OD600 of 1 at the previous conditions. The cell
culture is divided into 70 mL and it was mixed with 30µL of glycerol (Fluka), obtaining 100 mL mixture in
1.5 mL eppedorf tubes. The tubes were stored at −80o C.
3.4
3.4.1
Plasmid production and purification
Cell production
A cell banks with E. coli JM109 strain transformed with pETGFP cell were inoculated in a 100 mL
erlenmeyer flask with 30 mL of LB medium supplemented with kanamycin (50µg × mL−1 ). The culture
was grown overnight at 37o C in an orbital shaker at 250 rpm. In the next day, the optical density was
measured and 4 2000 mL elernmeyer flasks with 250 mL of LB medium (pH 7.4) were inoculated to an
DO600 of 0.1. This medium was also supplemented with the respective antibiotic. The elernmeyer flask
were cultured in the same conditions as before until the cultures reached an OD600 of 5 . The cells were
harvested by centrifugation in Sorvall RC-6 Plus superspeed centrifuge with SLC-300 rotor at 6000 × g
o
and 4o C, for 15 minutes. The supernatant was discharged and the pellet was stored at −20
use.
37
C
for further
A cell bank containing BL21(DE3) with pEXP5-NT/GFP was inoculated in a 500mL kitasato flask
with 100 mL of TB medium (pH 7.4) (12g × L−1 of tryptone (BD), 24g × L−1 of yeast extract (Himedia),
4mL × L−1 glycerol (JMGS)) supplemented with ampilicin (100µg × mL−1 ). The inoculum was grown
until it reached an OD600 of 3 in an orbital shaker at 37o C and 250 rpm. A 5 liter Biostat B fermenter,
containing 4L of TB medium (12g × L−1 of tryptone, 24g × L−1 of yeast extract, 4mL × L−1 , 17mM
KH2 P O4 and 0.72mM K2 HP O4 (Panreac)) at pH of 7.4 (supplemented with the respective antibiotic)
was inoculated with the previous culture. The culture was fermented overnight with an oxygenation
rate of 30%. The pH was not controlled. In the next day, the cells were harvested by centrifugation in
Sorvall RC-6 Plus superspeed centrifuge with SLC-300 rotor at 6000 × g and 4o C for 15 minutes. The
supernatant was discharged the pellet was stored at −20o C for further use.
3.4.2
Alkaline lysis
Both cell strains were disrupted by alkaline lysis. The pellets were resuspended with P1 buffer (50 mM
glucose (Merck), 25mM tris-HCl, pH 8.0, 10mM EDTA, pH 8.0). The volume of the P1 buffer used was
calculated as follows:
OD600 × Culture volume (mL)
60
(3.2)
The same amount of P2 buffer (0.2N NaOH (Merck), 1% (m/v) SDS (Merck) was added to the mixture
and then followed by a gentle homogenisation. The resultant solution was left to rest at room temperature
for 10 minutes. To stop the reaction, P3 (3M potassium acetate (Panreac), acid acetic (Fisher)) was
added to the mixture. After gentle homogenisation, the mixture was placed on ice for 10 minutes. The
neutralised alkaline lysate was centrifuged (Sorvall RC-6 Plus, SS34 rotor) twice at 20000×g and 4o C for
30 minutes. Between centrifugations the pellet was discharged. The supernatant obtained was stored
at −20o C until further processing.
3.4.3
Plasmid purification
0.7 volume of isopropyl alcohol (Sigma) was added to supernatant. After homogenisation, the mixture
was left for 2 hour at −20o C. Then, it was centrifuged (Sorval RC-6 Plus, SS34 rotor) at 2000 × g and
4o C for 30 minutes. The supernatant was discharged and the pellet was resuspended in 10 mM TrisHCL (pH 8). Ammonium sulphate was added to the solution in a concentration of 0.33g × mL−1 and
after homogenisation, the resulting solution was left on ice for 15 minutes. It was then centrifuged in an
Eppendorf centrifuge 5417R at 1300 rpm and 4o C for 30 minutes. The supernatant was collected.
3.4.4
HIC purification
The plasmids were purified by hydrophobic interaction chromatography (HIC) in an ÄKTA 100 Purifier
system, using a Phenyl Sepharose 6 fast flow (high sub) column (Tricorn 10/100 column, GE Healthcare). First, the column was equilibrated with 3 column volumes of 1.5M ammonium sulphate (Panreac)
38
in 10 mM Tris-HCL (pH 8). Then, 1 mL of the sample was injected into the column. To remove the
unbounded material, the column was washed with 2 column volumes of 1.5M ammonium sulphate in 10
mM Tris-HCL (pH 8). The run was performed at a flow of 1 mL× minute−1 . The elution was made with
3 column volumes of 10 mM Tris-HCL (pH 8) and 1.5 mL fractions were collected. After each run, the
column was washed with water and it was stored in 20 % ethanol solution at room temperature.
3.4.5
SEC purification
In order to exchange the buffer where the purified plasmid was accommodated, a size exclusion chromatography (SEC) was performed. The same column of HIC purification was used. 3 column volumes
of Tris-HCL (pH 8) were used to equilibrate the column. 1 mL of purified plamids in 1.5M ammonium
sulphate in 10 mM Tris-HCL (pH 8) was injected and the column was washed and eluted with 3 colunm
volumes of 10 mM Tris-HCL (pH 8) at a flow of 1 mL× minute−1 . 1.5 mL fractions were collected. After
use, the column was washed with water and stored in 20 % ethanol at room temperature.
3.4.6
Dialysis
The exchange of buffers from the purified plasmid was also attempted using a dialysis membrane with
12000-14000 MWCO (Orange Scientific). 1.5 mL eppendorf tubes without cap (containing the collected
fractions) were accommodated with squares of the dialysis membrane with a rubber band. The eppendorfs were placed in a water bath with agitation overnight.
3.4.7
Plasmid concentration
After purification, the plasmid was concentrated using a Savant DNA120 speedvac Concentration (ThermoScientific) at the medium temperature setting, until reached the final volume of 500 µL. The final
concentration was measured in the nanodrop and the plasmid was stored at −20o C for further use.
3.5
3.5.1
tRNA purification
Cell growth
E.coli cell banks were inoculated in an erlenmeyer flask containing 30 mL of 2 × Y T medium (16g × L−1
Tryptone, 10g ×L−1 yeast extract,5g ×L−1 NaCl (Sigma) ) (pH 7.4) and supplemented with the respective
antibiotic. The inoculum grown overnight at 37o C in an orbital saker at 250 rpm. In the morning, the
optical density was measure. 2 2000 mL erlenmeyer flaks containing 500 mL 2 × Y T medium each were
inoculated to an OD600 of 0.1 and the respective antibiotic was also added. The flasks were cultured in
the same conditions as before until the optical density reached an OD600 of 5. The cells were harvested
by centrifugation in Sorvall RC-6 Plus superspeed centrifuge with SLC-300 rotor at 6000 × g and 4o C for
15 minutes. The supernatant was discharged and the pellet was stored at −20o C until further use.
39
3.5.2
Phenol extraction
The extraction of the cellular RNA was done by the reported phenol extraction procedure with minor
modifications (Cayama u. a., 2000). All the buffers were prepared with autoclaved water. All centrifugations were performed at 4o C, unless specified. The cells were resuspended in 25 mL of 1.0 mM Tris–HCl,
10 mM M gCl2 , pH 7.2. The same amount of phenol saturated in the same solution was added and was
vigorously mixed for 2 hours. Then, it was centrifuged in an Eppendorf centrifuge 5810R at 15000 × g for
30 minutes.
After centrifugation, two different phases were observed: a fluid and transparent phase at the top
and one turbid viscous at he bottom. The fluid one was collected and 0.1 volumes of 20% potassium
acetate and 2 volumes of 70% were added. After homogenisation, the mixture precipitated overnight at
-4o C. In the next day, the mixture was centrifuged in an Eppendorf centrifuge 5810R at 15000 × g for 30
minutes. The pellet was then collected.
3.5.3
Contaminant removal
In order to remove the contaminants (such as DNA and rRNA) two protocols were tested. In the first
one, the separation is done by high salt concentration and stepwise precipitation (Zubay, 1962). The
pellet was resuspended in 1 volume of 1M of NaCl and mixed for 1 hour at 4o C. The mixture was
centrifuged in an Eppendorf centrifuge 5810R at 15000 × g for 30 minutes. This procedure was repeated
twice. 2 volumes of ethanol were added to the supernatant and it was precipitated for 2 hours at 4o C.
The precipitate was collected by centrifugation in the same conditions as before. The precipitate was
dissolved in 1 volume of 0.3M sodium acetate, pH 7. 0.5 volumes of isopropyl alcohol were added to
the mixture. Then, it was slow stirred for 1 hour at room temperature. The precipitate was removed by
centrifugation for 30 minutes at 15000 × g and 20o C. 0.5 volumes of isopropyl alcohol were added to
the supernatant, and precipitated for 2 hours at −20o C. The precipitated was collected by centrifugation
at 1500 × g for 30 minutes. The final pellet was dissolved in water, the concentration was measured in
nanodrop and it was stored at −20o C for further use.
The second procedure tested was based on a separation with a low pH buffer and purification by
anion-exchange chromatography (Kelmers u. a., 1965). 1 volume of 0.3 M sodium acetate, pH 5 and 0.5
volumes of isopropyl alcohol were used to resuspend the pellet. The mixture was vigorously stirred at
room temperature for 1 hour and the precipitate was removed by centrifugation in Eppendorf centrifuge
5810R at 15000 × g and 20o C for 30 minutes. The supernatant was cooled to 4o C and 0.5 volumes of
isopropyl alcohol were added. After 2 hours at −20o C, the precipitate was collected by centrifugation in
an Eppendorf centrifuge 5810R at 15000 × g for 30 minutes. The precipitate was dissolved in 10 mM of
Tris-HCl (pH 8).
3.5.4
Anion-exchange chromatography
The tRNA was further purified by Anion-exchange chromatography in ÄKTA 100 Purifier system using
a DEAE Sepharose 6 fast flow (GE Healthcare) column (Tricorn 10/50 column, GE Healthcare). First,
40
the column was equilibrated with 3 column volumes of 10 mM Tris-HCl (pH 8). 1 mL of the tRNA
samples was injected to the column. To remove the unbounded material, the column was washed with
equilibration buffer. The elution was made by a gradient from 0% to 100% of 1 M NaCl, 10 mM Tris-HCl
(pH 8). After chromatogram analysis, the elution method was altered to a gradient from 30% to 70% of
1M NaCl buffer. Finally, a equilibration with 0% of 1 M NaCl, 10 mM Tris-HCl (pH 8), and a elution with
a step of 45% of 1 M NaCl, 10 mM Tris-HCl (pH 8), was tested
3.5.5
RNA electrophoresis
The quality of the tRNA was assessed by a RNA electrophoresis. The method chosen uses TAE agarose
gels and the samples are denaturated with hot formamide (Masek u. a., 2005). First, a 1.2% agarose gel
was prepared in 1×TAE buffer (0.04 M Tris–acetate, 1 mM EDTA). The agarose mixture was dissolved
by heat in the microwave. When fully dissolved, the mixture was poured into a tray and left to solidify.
After solidification the gel is transferred to an electrophoresis tray where it stays submersed with TAE
buffer. The samples were prepared in 1.5 mL eppendorf tubes, by adding formamide (Boehringe), 6×
loading buffer (LB) and the collected fractions (in the volumes described in table 3.5). They were then
denaturated by heating in a water bath for 5 minutes at 65o C and immediately chilled on ice for 5 minutes.
The samples and a DNA marker (NZYDNA Ladder III, Nzytech) were loaded into the gel.
Components
Formamide
6× LB
Fraction sample
Total volume
Volume (µL)
15
2.5
7.5
25
Table 3.5: Components of RNA samples for electrophoresis in TAE agarose gels and the respective
volumes in µL.
Electrophoresis was performed using a TAE running buffer at a voltage gradient of 5 V/cm. The gel
was stained in an ethidium bromide bath for 15 minutes. Finally, the gel was visualised and photographed
with Stratagene Eagle Eye II imaging system.
3.5.6
tRNA concentration
The pure tRNA samples were precipitated to concentrate and remove the salt present in the buffer. The
samples containing tRNA were combined and 1 volume of 70% ethanol was added. The mixture precipitated overnight at 4o C. The precipitated was collected by centrifugation in an Eppendorf centrifuge
5810R at 15000×g. After drying, the pellet was dissolved in water. The final concentration was measured
at nanodrop.
41
3.6
GFP production and purification
JM109 E. coli cells containing pETGFP and BL21(DE) E.coli cells containing PEXP5-NT/GFP were
cultured. In order to purify GFP, two chromatografies were used: hydrophobic interaction and affinity
purification.
3.6.1
Cell production
JM109 cells banks were inoculated into a 100 mL erlenmeyer flask containing 30 mL of LB medium
supplemented with kanamycin (50µg × mL−1 ). The cells grown overnight at 37o C in an orbital shaker at
250 rpm. In the next day the optical density was measured. 1 erlenmeyer flask containing 250 mL of LB
medium and supplemented with kanamycin was inoculated to an OD600 of 0.1. The flask was cultured
at same conditions as the inoculum. When the culture reached an OD600 of 0.6, 1 M of isopropyl β-D1-thiogalactopyranoside (IPTG) was added to a concentration of 0.1 mM. The cells were harvested 8
hours later by centrifugation in Sorval R-6 superspeed centrifuge with SLC-300 rotor at 6000 × g for 15
minutes. The pellet was stored for further use.
BL21(DE3) cells banks were inoculated into a 100 mL erlenmeyer flask containing 30 mL of LB
medium supplemented with ampicilin (100µg × mL−1 ). The cells were grown at 37o C and 250 rpm until
they reached an OD600 of 3. 1 erlenmeyer flask containing 250 mL of LB medium, and supplemented
with amplicilin, was inoculated to an OD600 of 0.1. 1 M of isopropyl β-D-1-thiogalactopyranoside (IPTG,
Fisher) was added to a concentration of 0.1 mM. The flask was cultured at 30o C and 250 rpm overnight.
In the next day, cells were harvested by centrifugation in Sorval R-6 superspeed centrifuge with a SLC300 rotor at 6000 × g for 15 minutes. The pellet was stored at −20o C for further use.
Samples of both E. coli cells strains (expressing the respective GFP) were observed Leica DMLB
microscope with a blue filter.
3.6.2
Cell lysis
JM109 cell pellets were ressuspended in 100 mM phosphate buffer (NaH 2PO4, pH 8). They were then
disrupted by sonication (Bandelin) with a TT13 with an amplitude of 30% for 6 x 30 seconds on ice with
interruptions of 30 seconds. The resulting mixture was centrifuged at 12000 × g, for 20 minutes in an
Eppendorf centrifuge 5417R and the supernatant was recovered.
BL21(DE3) cell pellets were ressuspended in 50 mM N aP O4 , pH 8, 500 nM NaCl, 500 mM imidazole.
They They were then disrupted by sonication (Bandelin) with a TT13 with an amplitude of 30% for 5 x
30 seconds on ice with interruptions of 30 seconds. The resulting mixture was centrifuged at 12000 × g
for 20 minutes in an Eppendorf centrifuge 5417R and the supernatant was recovered.
3.6.3
HIC purification
GFP from JM109 cells was purified by hydrophobic interaction chromatography (HIC) using a Phenyl
Sepharose 6 fast flow (high sub) (GE Healthcare) in a Bio-Rad Econo-Pac column (Bio-rad). 5 mL of
42
4 M ammonium sulfate buffer (4 M (N H4 )2 SO4 , 10 mM Tris, 10 mM EDTA, pH 8) were mixed with 5
mL of the supernatant liquid containing GFP and then loaded onto the column. Unbound proteins were
removed with 3 washing steps: First, with 25 mL of 2 M ammonium sulfate buffer; secondly, with 25 mL
of 1.3 M ammonium sulfate buffer and finally with 50 mL of TE buffer (1 mM Tris, 10 mM EDTA, pH 8).
The bounded GFP was then eluted with water. The eluted GFP was stored at −20o C for further use.
3.6.4
IMAC purification
GFP from BL21(DE3) cells was purified by immobilised metal ion affinity chromatography (IMAC) using
Ni Sepharose 6 Fast Flow(GE Healthcare) in Poly-prep column (Bio-rad). The column was equilibrated
with 5 ml of 20 mM imidazole (Sigma), 500 mM NaCl, 50 mM N aP O4 , pH 8. 2mL of the sample was
injected and the column was washed in 2 steps: First, 5mL of 20 mM imidazole, 500 nM NaCl, 50 mM
N aP O4 , pH 8, then with 5 mL of 250 mM imidazole, 500 mM NaCl, 50 mM N aP O4 , pH 8. The protein
was eluted with 500 mM imidazole, 500 mM NaCl, 50 mM N aP O4 , pH 8. The eluted GFP was stored at
−20o C for further use.
3.7
S30 Lysate preparation
For the production of S30 lysate, BL21(DE3) strain with and without plasmid were used. The bead mill
was chosen to perform a mechanical disruption was bead mill (Sun u. a., 2013). A diagram of the lysate
processing used is represented in figure 3.2.
The S30 buffer was prepared as needed from autoclaved Milli-Q water and three separate 100×
concentrates (1 M Tris acetate pH 8.2, 1.4 M magnesium acetate (Fisher), and 6 M potassium acetate)
which were sterile filtered, and stored at room temperature. The pH of the 1 M Tris solution was adjusted
to 8.2 with 1 M of HCl (Acros Organics). All the centrifugation were made at 4o C.
3.7.1
Cell production
Cell banks containing BL21(DE) with and without plasmid were inoculated in a 100 mL elernmeyer flask
with 30 mL of 2 × Y T medium (16g × L−1 Tryptone, 10g × L−1 yeast extract,5g × L−1 NaCl ) (pH 7.4) and
supplemented with the respective antibiotic (when needed). The inoculum grown overnight at 37o C in an
orbital shaker at 250 rpm. The optical density was measured in the morning. Two 2000 mL elernmeyer
flaks containing 500 mL each of 2 × Y T P G ( 16g × L−1 Tryptone, 10g × L−1 yeast extract,5g × L−1 NaCl
,22 mM sodium phosphate monobasic (Sigma), 40 mM sodium phosphate dibasic (Panreac), 100 mM
glucose) supplemented (when necessary) with the respective antibiotic were inoculated to an OD600 of
0.1. The flasks were cultured in the same conditions as the inoculum until they reached an OD600 of 4.5.
The cells were chilled immediately and harvested by centrifugation in a Sorval RC-6 Plus superseed
centrifuge with a SLC-300 rotor at 6000 × g for 15 minutes.The cells were then washed with 100 mL
of 1 × S30 buffer (10 mM Tris acetate, 14 mM magnesium acetate, 60 mM potassium acetate) and
43
centrifuged again in the same conditions. The pellet was were weighed and stored at −20o C for further
use.
Furthermore, the same process was performed in a 2000 mL cell culture. In this case, the inoculum
was made in a 250 mL elernmeyer flask containing 50 mL of 2×Y T . The 2000 mL of 2×Y T P G medium
was divided by 4 2000 mL elernmeyer flaks with 500 mL each. The same amount of S30 buffer was
used to washed the cells.
3.7.2
Biomass processing
The pellet was ressuspended with 1 mL of room temperature S30 buffer per gram of cells. Once thawed,
the cell suspension was set on ice. Two concentrations of cell beads were mixed in the solution: 3 and
5 grams of autoclaved 1 mm beads × grams of cell. The cells were lysed in a bead mill (VibrogenZellmühle, Edmund Bühler). For 1000 mL of cell culture, 4 cycles of 1 minutes (30 seconds on, 30
seconds on ice) were performed and, for the 2000 mL culture, 6 cycles of 1 minute (30 seconds on, 30
on ice). To separate the beads and cell debris from the lysate, a centrifugation with a Sorval RC-6 Plus
superspeed witha SS34 rotor was performed at 30000 × g for 30 minutes. The lysate obtained should
not be turbid. The supernatant was collected and incubated in an orbital shaker at 37o C for 80 minutes.
Then, they were centrifuged in an Eppendorf centrifuge 5810R at 18000 × g for 20 minutes. The final
supernatant was aliquoted and stored at −80o C until further use.
Cell Culture
(Shake Flask)
Cell disruption
(Bead mill)
Centrifugation
Run-off reaction
(1X 30,000 g, 30 min, 4ªC)
(37ºC, 80 min, 250 rpm)
Centrifugation
(1X 18,000 g, 30 min, 4ºC )
Figure 3.2: Steps of the S30 lysate processing.
3.7.3
Cell lysis efficiency determination
To determine Cell lysis efficiency, the number of colonies present before and after lysis was compared.
For that, 20 µL from the lysates were plated on sterile LB agar petri dishes (without antibiotic) and
incubated overnight at 37o C. A sample the ressuspended pellets was diluted (1 : 109 ) and 20 µL were
plated and incubated as the lysates samples. In the next day, the number of colonies was counted and
the colony forming unit (CFU) per millilitre of sample was calculated by as follows:
CFU/mL =
no. of conolies × Dilution factor
Volume plated (mL)
(3.3)
The efficiency (η) was calculated by the following equation:
η=
CF U/mLp − CF U/mLl
CF U/mLp
Where CF U/mLp corresponds to the resuspended pellets, and tCF U/mLl to the lysates.
44
(3.4)
3.8
Cell free protein synthesis
A Expressway Cell-Free E.coli Expression system kit (Invitrogen) was acquired to test the plasmid and
lysates produced. This kit contained all the components needed to produce proteins and the pEXP5NT/CALML3 for a positive control. Besides the kit, a system based on Cytomim system Zawada (2012)
was tested and optimisation attempts were made.
3.8.1
Expressway cell-free kit
Pure plasmid template in a concentration of 500ng × µL−1 produced as described before to use with
this kit. The reaction was performed in a sterile 1.5 mL eppendorf tube at 37o C in an orbital shaker at
300 rpm for 6 hours. The final volume of each reaction was 25µL, and the reagents were added in the
amounts represented in table 3.6.
Reagents
E. coli sly D- Extract
2.5× IVIPS E. coli Reaction Buffer
50 mM Amino Acids (-Met)
75 mM Methionine
T7 Enzyme Mix
DNA template
Dnase/Rnase-free Distilled Water
Total volume
Volume (µL)
5
5
0.3
0.25
0.25
0.5
1.2
12.5
Table 3.6: Reagents used to perform cell-free protein synthesis from Expressway kit and the respective
volumes in µL
After the first 30 minutes of reaction, a feed buffer was added to each reaction. The feed buffer
contained the reagents represented in table 3.7.
Reagents
2× IVIPS Feed Buffer
50 mM Amino Acids (-Met)
75 mM Methionine
Dnase/Rnase-free Distilled Water
Total volume
Volume (µL)
6.25
0.3
0.25
5.7
12.5
Table 3.7: Feed buffer reagents from Expressway kit and the respective volumes in µL
Once the reaction finished, it was stored at −20o C for further analysis.
3.8.2
Cytomim system
A reaction based on th Cytomim system was performed in a sterile 1.5 mL eppendorf tube containing
25µL of reaction. Beforehand, two buffers were prepared: 10× Salt solution, containing 1.3 M potassium
acetate, 100 mM ammonium acetate (Sigma), 80 mM magnesium glutamate, and 10× Master mix,
containing 12 mM ATP, 8.5 mM GTP, 8.5 mM CTP, 8.5 mM UTP, 340µg ×mL−1 folinic acid, 1.7mg ×mL−1
45
E. coli tRNA. These buffers were aliquoted and stored at −20o C. The following reagents were prepared:
1 M Sodium pyruvate (Fisher), 100 mM Sodium Oxalate (Fisher), 100 mM Spermidine (Fisher). The
amino acid solutions used belonged to expression kit. T7 RNA polymerased 20 U ×L−1 from Life
Technologies was also used.
The reaction was performed at 37o C in an orbital shaker at 300 rpm for 5 hours. The reagents
concentrations and volumes used are described in table 4.2 . Once the reaction finished, the samples
were stored at −20o C for further analysis.
Reagents
10× Salt Solution
10× Master mix
50 mM Amino Acids (-Met)
75 mM Methionine
Sodium Pyruvate
Sodium Oxalate
Spermidine
T7 RNA polymerase
Lysate
Plasmid Template
Dnase/Rnase-free Distilled Water
Total volume
Stock concentration
10×
10×
50 mM
75 mM
1M
100 mM
100 mM
0.5 µg × mL−1
-
Reaction concentration
1×
1×
2 mM
2 mM
33 mM
4 mM
1 mM
-1
24%
33 µg × mL−1
-
Volume (µL)
2.5
2.5
0.6
0.5
0.83
1
0.25
2.1
1.7
8.12
25
Table 3.8: Reagents for 25µL reaction kit, stock and reaction concentrations and the respective volumes
used in µL
3.8.3
Optimisation
The first attempted optimisation was the lowering of the temperature in the reaction to 30o C. This test
was made with Expressway Cell-free kit, using pEXT-5NT/GFP as a template, and the lysate from the
kit. No alteration to the reagent concentrations or to other conditions were made with this kit. With
the Cytomim system several tests were made: lysate volume, plasmid concentration and magnesium
acetate concentration. The conditions and reagent concentrations were the same as before.
3.9
3.9.1
Protein analysis
Protein concentration
The lysates protein concentrations and GFP concentration were also determined. For that, a Pierce
BCA protein assay kit (ChemCruz) was used. A BSA calibration curve was prepared using S30 buffer
as diluent for the lysates, and with water for GFP. The samples were also diluted (1:50) with the same
buffer. They were measured at 562 nm in a plate reader (Molecular Devices).
46
3.9.2
SDS-PAGE
Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) was performed to analyse the
cell-free production and GFP purification. 5µL of the the cell-free production samples were precipitation
by the addition of 20 µL acetone (Sigma). The buffer sample was prepared with 62.5 mM Tris–HCl
pH 6.2, 2% (w/v) SDS, 0.01% (w/v) bromophenol blue, and 10% (v/v) glycerol. All samples were denaturated in reducing conditions with 100 mM dithiothreitol (DTT) (Sigma) at 100o C for 5-10 minutes.
Samples were loaded in a 15% acrylamide gel, prepared from a 40% acrylamide/bis stock solution
(37.5:1) (National Diagnostics), and ran at 120 mV using a running buffer composed of glycine 192 mM,
Tris 25 mM, and 0.1% SDS pH 8.3. Gels were stained with Coomassie PhastGel (Pharmacia AB Laboratory Separations). Gels were de-stained using a 30% ethanol/10% acetic acid solution. The molecular
marker used was the Precision Plus Protein Standarts Dual Color (BioRad).
When the intensity of the bands was unsatisfying, the gels were silver stained. First the band where
fixated using an oxidiser solution composed of 0.8 mM sodium thiosulphate for 10 minutes. After washing
3 times with Milli-Q water, the gels were incubated with a fresh silver nitrate solution (11.8 mM silver
nitrate, 0.02% formaldehyde), for 30 minutes. Then, they were washed 3 times and the band developed
was performed by incubating the gel in developer solution (composed of 0.566 M sodium carbonate, 0.02
mM sodium thiosulphate and 0.02% formaldehyde). The reaction was stoped with a solution containing
50% ethanol, 12% acetic acid in Milli-Q water, for 15 minutes.
The gels were scanned and analysed using GS-800 Calibrated Densitometer and Quantity one software (Bio-rad).
3.9.3
Western blotting
For the western blot, SDS-PAGE was performed without staining the gel. The Western blot was assembled (as instructed by the manufacturer (Bio-rad)), using two sponges, 2 filter papers and one nitrocellulose blotting membrane (Bio-rad). All the components were pre-weted in the transfer buffer 25 mM
Tris, 192 mM 30 glycine and 20% methanol (v/v) before assembly. The transfer was carried out at 100
V, 350 mA for 1h. The membrane was then blocked with a TBS-Tween buffer ( TBS with 0.5% Tween
20) containing 5 % non-fat milk. Then, the membrane was washed 5 times with TBS-Tween Buffer and
incubated overnight at 4o C with primary antibody anti poly-His in mouse (Santa Cruz Bioscience) diluted
1:500 in 5 % non-fat milk, TBS-Tween. In the next day, the membrane was incubated for 1 hour with the
secondary antibody goat anti-mouse IgG-HRP (Santa Cruz Bioscience) diluted 1:2000 in TBS-Tween
and washed five times with TBS-Tween. To visualise the bands, a 100 mL TBS solution containing 50
mg of 3,3’-diaminobenzidine (DAB)(Bio-rad). This solution was mixed with 300 µL 30% hydrogen peroxide. The Blot was incubated with this solution for 20 min. The reaction was stopped with tap water,
and the blots were dried at RT.
47
3.9.4
Fluorimetry
The GFP fluorescence was measured using VersaFluor Fluorometer (BioRad) containing EX490/10
excitation filter and EX510/10 emission filter. The samples were diluted with water and placed on a 200
µ L cuvette. The range was set to medium setting and the zero was done using water.
48
Chapter 4
Results and Discussion
4.1
Template preparation
The plasmids pEXP5-NT/CALML3 pETGFP and pEXP5-NT/GFP were chosen to be used in this work
because they contain: a bacteriophage RNA polymerase T7 promoter placed upstream of the gene of
interest (which is a strong promoter widely used in cell free systems), a prokaryotic Shine-Dalgarno
ribosome binding site (RBS), an ATG initiation codon, a stop codon, and a t7 termination. The pEXP5NT/CALML3 and pEXP5-NT/GFP contain an N-terminal peptide with 6×His tag and a TEV recognition
site which allow easy detection and purification. The TEV recognition site allows TEV protease-mediated
removal of the tag, generation an almost native recombinant protein.
The pEXP5-NT/CALML3 and pEXP5-NT/GFP contain a pUC replication origin, and the pETGFP a
pBR322 origin. This last regulates the number of plasmids using a protein called Rop/Rom. The pUC
origin is derived from pBR322 but contains a mutation in the origin itself and another that deletes the
Rop/Rom gene. This removes all the regulatory constraints on the plasmid replication allowing the cell
to produce over 500 plasmids per cells instead of 30-40 plasmids per cell with pBR322.
Other important aspect of the templates used in cell-free systems is their size. Bigger plasmids
tend to lower the protein yield. In this case, the plasmids are not very large, wherein the largest one is
pETGFP (6088 bp), followed by pEXT5-NT/GFP (3685 bp), and pEXT5-NT/CALML3 (3194 bp).
4.1.1
pEXP5-NT/GFP
The pEXP5-NT/GFP plasmid was constructed using a GFP gene from pVAXIGFP-BHGI plasmid and
PEXP5-NT/CALML3 as a vector. For that, the CALML3 gene was removed by a double digestion with
SacII and PvuII. Because these two restriction enzymes didn’t have 100% activity for the same buffer,
the digestion had to be optimised. 4 approaches were attempted: the use of the buffer C (for which SacII
has 100% activity, in the usual and the double concentrations); and the use of buffer G (for which PvuII
has 100%, again with the normal and double concentrations). This approach was chosen instead of a
sequential digestion because it has less steps and higher yield.
Before, the behaviour of the enzyme in buffer (for which the other enzyme has 100% activity) was
49
studied. SacII was tested with buffer G and PvuII with buffer C. A buffer in which both enzymes had 70%
activity (B). The figure 4.1 presents the reults for the undigested plasmids and the respective digestions
results. The undigested plasmid presens the 3 expected conformations: suppercoild (sc), linear and
open circular (oc) (from bottom to top). Furthermore, on top of oc pDNA, another isoform is observed.
Regarding the digestion, the enzymes didn’t present 100% activity in none of the tests. Nevertheless, it
seems that the digestion with buffer G was slightly more complete as the band corresponding to the sc
pDNA is less visible. The digestion with buffer B was the most incomplete.
Figure 4.1: A 1% agarose gel containing the plasmid and the respective digestions. 1-undigested
pEXP5-NT/CALML3 plasmid in different isoforms. 2- pEXP5-NT/CALML3 digestion with buffer G and
SacII. 3-pEXP5-NET/CALML3 digestion with buffer B, SacII and PvuII. 4-pEXP5-NT/CALML3 digestion
with buffer C and PvuII. M-NZYDNA Ladder III.
Tanking into account the results from figure 4.1, the buffer B was no longer tested. A different approach was attempted instead. Here, double digestions with buffer B and C in 1 ×and 2 × concentration
were tested. The results can be observed in the figure 4.2. The complete digestion was achieved in the
test 4 with double concentration of buffer G.
Figure 4.2: A 1% agarose gel containing the undigested plasmid and the double digestions. 1Undigested plasmid isoforms oc, linear and sc (from top to bottom). 2- Digestion with SacII, PvuII
and 1×C buffer. 3-Digestion with SacII, PvuII and 2× C buffer. 4-Digestion with SacII, PvuII and 1× G
buffer. 5-Digestion with SacII, PvuII and 2× G buffer. M- NZYDNA Ladder III.
Once the digestion was optimised, the insert was prepared. We use the pVAXIGFP-BHGI plasmid.
This plasmid was chosen because it was used successfully in other works. The primers were designed
taking into account that SacII and PvuII needed to be added to each end of the insert. The primers
sequences and properties are described in table 4.2. The PCR was performed with the conditions
already described. Then, the PCR result was double digested with SacII and PvuII in the optimised
50
conditions.
Primer name
GFPInsert Foward
GFPInsert Reverse
5’-3’ Sequence
ATCGATCAGCTGAAGGGAGACCCAAGCTGGCTAG
ATCGATCCGCGGGAAGGCACAGTCGAGGCTGAT
Properties
34 b, Tm 62.2o C 55.9% GC
33 b, Tm 60.3o C 60.6% GC
Table 4.1: Primers sequences and properties used in the PCR to produce the insert containing GFP and
the restriction enzymes locals used for cloning pEXP5-NT/GFP.
The figure 4.3 presents the result of the digestions and PCR. The PCR produced a DNA insert with
a size around 800-900 bp as expected (882 bp). The double digestion was complete and produced
a vector (top band) with a size between 2500-3000 bp was obtained (2828 bp). The top band of the
digestion and the PRC product band were cut from the agarose gel and purified. Both the insert and the
vector were used in the cloning step with T4 DNA ligase kit and with the two incubation methods (1 hour
at 22o C and overnight at 4o C).
Figure 4.3: A 1% agarose gel containing the pEXP5NT-CALML3 digestion and the PCR product. 1pEXP5NT-CALML3 double digestion with SacII and PvuII. 2- Digested PCR product. M- NZYDNA Ladder III.
The resulting reaction was used to transform BL21(DE3) competent cells. 3 isolate colonies from
the transformation were inoculated in liquid medium and the plasmids were purified. To confirm the
cloning, to each plasmid was tested with 2 digestions: a double digestion with SacII and PvuII, and
a digestion with XmnI for linearisation. Figure 4.4 shows the plasmids and the respective digestions.
By analysing the digestion pattern and the plasmid size, the plasmid 2 was selected to be the correct
pEXP5-NT/GFP. This plasmid (when linearised) have 3685 bp and when double digested presents two
fragments with the size correspondent to the insert and vector used. Further confirmation was obtained
with DNA sequencing.
4.2
Plasmid purification
The plasmids pETGFP and pEXP5-NT/GFP were produced from JM109 and BL21(DE3) respectively.
The cells were lysed by alkaline lysis. The nucleic acids and the proteins were precipitated by isopropyl
51
Figure 4.4: A 1% agarose gel containing the 3 purified plasmids obtained from cloning and the respective
digestions. 1-Plasmid obtained with a incubation for 1 hour at 22o C; 1a-Digestion with XmnI; 1b-Double
digestion with SacII and PvuII. 2-Plasmid obtained with incubation overnight at 4o C; 2a-Double digestion
with SacII and PvuI; 2b-Digestion with XmnI; 3-Plasmid obtained with incubation overnight at 4o C; 3aDouble digestion with SacII and PvuI; 3b-Digestion with XmnI. M- NZYDNA Ladder III.
alcohol and protein were precipitated with ammonium sulphate. Cell lysis is one of the most critical
downstream processing steps (Prazeres u. a., 1999). Alkaline lysis was the method of choice as it is
the most popular and widely adopted cel lysis technique (Zhu u. a., 2005). After cell lysis, the resulting
solution have a high concentration of salt and sodium acetate. In solution, sodium acetate will break
into N a+ and CH3 COO− . The positive charge ions will neutralise the negative charged P O3− groups
on the nucleic acids. This makes the molecule far less hydrophilic, and less soluble in water. The
isopropyl alcohol is added to lower the dielectric constant of the solution. Because water have a high
dielectric constant, it is difficult for positive ions to interact with the negative charged groups. When
isopropyl alcohol is present this interaction is facilitated and the nucleic acid became less hydrophilic,
precipitating.
Besides nucleic acids, proteins may also precipitate with isopropyl alcohol. To remove the remaining
proteins ”salting-out” technique is applied. Ammonium sulphate is added to the solution to a concentration of 2.5 M. This high salt concentration attract the water molecules and decreased the number
which interact with charged part of the protein. This way, the demand of solvent molecules increase and
protein-protein interaction became stronger. The proteins coagulates by forming hydrophobic interactions with each other. Besides proteins, some amount of the contaminant RNA is removed. The two
operations preformed sequentially concentrate the plasmid (50-fold) (Freitas u. a., 2006).
The plasmids were further purified by two chromatographic steps: hydrophobic interaction and size
exclusion.
4.2.1
Hydrophobic interaction chromatography
Hydrophobic interaction (HIC) is a method of choice when pDNA purified. It separates the pDNA based
on the difference in surface hydrophobicity between the supercoiled plasmid and the impurities (RNA,
endotoxins and proteins). It is a purification process that achieves high purity and considerable amounts
of plasmid DNA.
First, the samples is loaded and the column is washed with high salt concentration. In this step a
52
interaction between the hydrophobic functional regions of the solutes and hydrophobic function takes
place (Trindade u. a., 2005). Since the plasmid is double stranded, it contains a week hydrophobic
nature, and it is eluted while the impurities are retained in the column. Because HIC binding process in
more selective than the elution process, the plasmid separation depends on the optimization of the start
buffer conditions, such as the salt used, its concentration and purity.
In this case, 1.5 M ammonium sulphate was chosen as a binding buffer due to: its high salting-out
ability, high solubility (varying little in a range of 0–30o C), its stability (up to pH 8.0), and low cost (Behnke,
1983). For the elution buffer, 10 mM Tris-HCl pH 8 was chosen. 1 mL of the sample was injected to a column equilibrated with the binding buffer. The column was washed with 2 column volumes of the binding
buffer and eluted with 3 of 10 mM Tris-HCl pH 8. The flow was set at 1mL × min−1 and the flowtrough
was collected in 1.5 mL fractions. Figure 4.5 shows the chromatogram correspondent to the pETGFP
purification by this method after the injection (volume 0). The first peak after injection corresponds to
the purified plasmid. The second peak appears conjugated with a peak in conductivity. This may mean
that the peak is caused by the increase of salt in the flowtrough and not by any contaminant. The final
peak correspond to the contaminants and starts when the conductivity decrease. When conductivity
decreases, the salt concentration on the flowtrough also decreases, and the hydrophobic areas of the
contaminants stop to interact with the matrix and are eluted.
Figure 4.5: HIC chromatogram of the pETGFP purification. The x axis correspond to the volume of the
flowtrough, and the double y axis to the absorvance at 254 nm (green line) and the conductivity of the
flowtrough in mS/cm (blue line).
Figure 4.6 shiows a 1% agarose gel with selected fraction of the pETGFP purification chromatography from figure 4.5. The first 3 fractions are corresponded with to the first peak and they present pure
plasmid as expected. It is also observed that the second peak is indeed due to the increase of salt in
the flowtrough. The final peak contains RNA. It is noted that the salt concentration is so high that the
plasmid bands are not well defined and it is not possible to identify the plasmid isoforms.
A purification of pEXP5-NT/GFP plasmid was also performed using the same method. Figure 4.7
presents the chromatogram and the agarose gel with the selected fractions of the run. This chromatogram is very similar to the previous as it presents 3 peaks corresponding to the pure plasmid,
53
Figure 4.6: A 1% agarose gel of the selected fraction of pETGFP purification HIC chromatography. 1
to 3 correspond to purified plasmid peak. 4 corresponds to the second peak. 5 to 8 correspond to
contaminant peak. M-NZYDNA Ladder III.
salt and contaminants (RNA). These assumptions are verified with the agarose gel. The first 3 samples
exhibit purified plasmid, the samples 7 and 8 don’t show plasmid or RNA and in samples 9 to 12 RNA is
present. In this gel is also observed a sample of the feed injected in the column.
(a)
(b)
Figure 4.7: HIC chromatogram of the pEXP5/GFP purification and a 1% agarose gel of the selected
fractions. 4.7b) HIC chromatogram. The x axis correspond to the volume of the flowtrough, and the
double y axis to the absorvance at 254 nm (green line) and the conductivity of the flowtrough in mS/cm
(blue line). 4.7a) A 1% agarose gel of the selected fraction of pETGFP purification HIC chromatography.
1 to 4 correspond to the first peak (pure plasmid). 7 and 8 correspond to the second peak. 9 to 12
correspond to the final peak (contaminants). 13- Feed sample. M-NZYDNA Ladder III.
4.2.2
Plasmid desalting
The pure plasmid collected was in 1.5 M ammonium sulphate buffer. This high salt concentration does
not allow a correct analysis of the plasmid quality and quantity since it interferes with the agarose gel
analysis and with the concentration measurement. To overcome this issue two approaches were tested.
To exchange buffer, the plasmids were dialysed with a dialysis membrane with 12000-14000 MWCO.
This membrane allowed the salt ions to flow trough the membrane pores but the plasmid stayed trapped
inside. The other method tested was a size exclusion chromatography. This method separates the
molecules according to their size. Because the plasmid is larger than the salt ions, the plasmid will be
54
eluted before.
The fraction that contained pETGFP plasmid was dialysed against water overnight. Figure 4.8 shows
two 1% agarose gels containing the dialysed pETGFP. By observing the gel, we can conclude that the
plasmid has the correct size. Most of the time, the 3 plasmid forms are observed: open circular (oc),
linear (l), and supercoiled 8sc. In lane 3 of the picture on the right, one more isoform is observed. It is
also noted that in most samples, the open circular form is present in more quantity. This form decreases
the quality of plasmid and may affect the yield of cell-free protein synthesis (Zawada, 2012). This high
amount of open circular plasmid may be caused by the dialysis process. Comparing the agarose gels
before and after this steps, there is a difference. Before, a blur band corresponding to the suppercoild
plasmid is much more prominent.
Figure 4.8: Two 1% agarose gels containing pure pETGFP recovered from HIC chromatography after
dialisys. oc-open circular form; l- linear form; sc: supercoild form. M-NZYDNA Ladder III.
Alkaline lysis may also affect the amount of open circular. During alkaline lysis, the chromosomal
DNA is denatured while the supercoiled plasmid DNA remains intact, if the pH does not exceed a
threshold of approximately 12.3 (Vinograd u. a., 1966). However, the lysis solution used have a pH
of 13, and if the macromolecules released into the crude lysate do not provide enough acidity, the lysate
pH may not decrease bellow 12.3 (Cloninger u. a., 2008). This means that the plasmid may not recover
to the original supercoild form.
The fractions containing pEXP5-NT/GFP plasmid were used in SEC chromatography. The column
where HIC was performed was also used to desalt the samples by SEC. 10 mM Tris-HCl pH 8 was used
as buffer. Figure 4.9 shows a chromatogram of a SEC run with pEXP5-NT/GFP and a 1% agarose gel
containing selected fraction of the SEC runs. By analysing the chromatogram, we can say that almost
all plasmid was desalted. Both curves intersect almost at the end of the plasmid peak which means
that only one small portion of the plasmid contains a salt. This intersection could be avoid by using a
column with higher height. With a higher height, salt molecules will take longer to reach the bottom and
a greater separation would be achieved.
The 1% agarose gel of the SEC samples show multiple bands (figure 4.9b). In this case more than
the typical supercoild, linear, and open circular forms are presented. This may suggest a contamination
55
(a)
(b)
Figure 4.9: SEC chromatogram of pEXP5-NT/GFP desalting and 1% agarose gel of the selected fractions. 4.9a) SEC chromatography. The x axis correspond to the volume of the flowtrough, and the double
y axis to the absorvance at 254 nm (green line) and the conductivity of the flowtrough in mS/cm (blue
line). 4.9b) A 1% agarose gel containing the selected fractions (1-14) of multiple SEC chromatographies.
M-NZYDIA Ladder III
with a different size plasmid. To test this, a double digestion with SacII and PvuII and a simple digestion
with XmnI was performed. Figure 4.10 show the results of the digestions. With the simple digestion,
two bands appear (figure 4.10a and 4.10b, row 1). This suggests the contamination with a plasmid of a
greater size. However, with the double digestion (figure 4.10b, row 2) multiple bands appear. The band
corresponding to the insert is visible. Two bands with size between 1400 and 2000 bp appear above
that. The positions of these two bands is very similar to the last two bands found in the undigested
plasmid (figure 4.10a, row 2), which may be non digested plasmid. Other two bands are visible with size
between 2000 and 2500 bp, and on the top of them more two bands (between 3000 and 4000 bp). The
top one may correspond to linear plasmid (uncompleted digestion). The band below may correspond to
the plasmid without the GFP insert. A blur band on the top is also visible.
(a)
(b)
Figure 4.10: Two 1% agarose gels containing the digestion of pEXP5-NT/GFP purified by HIC and desalted by SEC. 4.10a) Agarose gel containing: 1-pEXP-NT/GFP digested with XmnI; 2-pEXP5-NT/GFP
undigested; M-NZYDIA Ladder III. 4.10b) Agarose gel containing: 1-pEXP-NT/GFP digested with XmnI;
2-pEXP-NT/GFP double digested with SacII and PvuII; M-NZYDIA Ladder III.
56
Besides these tests, a sample of the cell culture was observed with a fluorescent microscope and
the cells were green. Also, a bank of the same batch was used to confirm the sequence. It seems that
it was not a contamination but recombination of the plasmid. This event can be explain by the use of
BL21(DE3) strain as a host.
Unlike BL21(DE3), strains usually used for plasmid propagation (e.g. DH5α) contain recA mutation.
The recA gene is essential for homologous recombination and DNA repair in E.coli (Koomey und Falkow,
1987). EndA mutation is also important for plasmid stability. Strains without endA mutation were proven
to degraded plasmid when protein extraction was not perform before alkaline lysis (Taylor u. a., 1993).
Besides, E. coli genes mcrA, mcrB, mcrC, and mrr express the 5-methylcytosine-specific restriction
endonucleases McrA, McrBC and Mrr, respectively. These endonucleases degrade exogenous DNA
with the methylated sequences C m CGG, Rm C, C m AG, or Gm AC (Mulligan und Dunn, 2008).
Some of the upper bands can also be due to other isoforms, such as concactamers and catenanes.
Concatemers are dimerics plamids with double the size. Usually they are formed by homologous recombination. Catenanes are isolated plasmid that are interlocked as chain links. These forms are usually
found in plasmid preparations Schleef (2008). The extra bands observed in the undigested pEXP5NT/CALML3 (figures 4.1 and 4.2) can also have these forms.
Strain
BL21(DE3)
DH5α
TOP10
Genotype
F– ompT gal dcm lon hsdSB(rB − mB −) λ(DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5])
F- endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG
Φ80dlacZ∆M15 ∆(lacZYA-argF)U169, hsdR17(rK- mK+), λ−
F- mcrA ∆(mrr-hsdRMS-mcrBC) Φ80lacZ∆15 ∆lacX74 nupG recA1 araD139
∆(ara-leu)7697 galE15 galK16 rpsL(StrR) endA1 λ-
Table 4.2: Genotypes of the E.coli strains BL21(DE3), DH5α and TOP10.
4.3
tRNA purification
Amino acids are activated for peptide bond formation by amino acyl tRNA synthetases that are specific
for the amino acid substrate and the cognate set of tRNAs, covalently linking the residue to the 3’terminal adenosine of the tRNA (Ling u. a., 2009). For protein synthesis occurs, all 20 amino acids must
present in amounts super-stoichiometric with the amount of protein to be formed, in addition to catalytic
amounts of all 20 amino acid tRNA synthetases and the full complement of tRNAs.
The addition of exogenous tRNA to the cell-free system not only increases the protein yield, but also
allows to control the system through changing tRNA composition (Kanda u. a., 1996) and facilitates in
incorporation of unnatural amino acids.
To this work, total tRNA with amino acids attached to the terminal adenosine groups were purified.
Two protocols were tested. In the first, a attempt to separate RNA from pDNA and rRNA with high
salt concentration and a stepwise precipitation with isopropyl alcohol. The second method, a low pH
solution was used to precipitate pDNA and an anion-exchange chromatography was used to remove the
remaining contaminants.
In both methods, a phenol extraction method was performed. By adding a phenol saturated buffer to
57
the cell mixture, the permeability of the cell wall will increase, and small molecules, such as tRNA, can
diffuse out of the cell. This way, cell lysis is avoided. Besides, it allows the separation of nucleic acids
from the proteins. Since phenol and the buffer are immiscible, they form a two phases when centrifuged.
Phenol is less polar than water, and since nucleic acids are polar, they will stay soluble in the water.
This means that when phenol is mixed with water, they do not dissolve in the phenol ant remain in the
buffer. However, proteins are composed by polar and non-polar amino acids. Usually, when protein are
exposed to a less polar solvent, the folding changes and the less polar residues, which usually are inside
the protein structure, will interact with phenol and are forced to the outside. This means that the proteins
are denatured and they will stay in the phenol phase. Since the top phase, containing the nucleic acids,
is collected, most proteins will be removed.
In the first protocol tested, the step after ethanol precipitation is to add 1M NaCl in acetate buffer (pH
5). In the presence of this amount of salt, ribosomal RNA becomes insoluble and precipitates (Crestfield
u. a., 1955). After this removal, the solution still contains DNA and polysaccharides. Both of them are
removed by adding 0.2M of sodium acetate, pH 7 and 0.5 volumes of isopropyl alcohol. This precipitation
has the same principles as the isopropyl alcohol precipitation used in the plasmid purification.
In figure 4.11 a 1.2% agarose gel containing samples of this method is observed. Figure 4.11, 4
contains a sample of the recovered pellet after phenol extraction and ethanol precipitation. This samples
contains the plasmid, rRNA (23s and 16s) and small RNAs (5s and tRNA). It’s also visible that the
precipitation had some loss of tRNA since small RNA is visible in row 1 and 2. It should also be noted
that adding 1M NaCl in acetate buffer (pH 5) had little or none effect. The bands corresponding to the
ribosomal RNA are still visible in 8. On the other hand, they disappear with the precipitation with 0.2M
of sodium acetate (ph 7) but the pDNA is still there.
Figure 4.11: A 1.2% agarose gel containing different steps of tRNA purification. 1 and 2- Samples the
supernatant of the precipitation with ethanol. 4- Samples of the pellet resultant phenol extraction and
ethanol precipitation. 6- pellet obtained with the addition of 1NaCl in acetate buffer. 8- Supernatant
obtained after the purification step with 1NaCl in acetate buffer. 10- Pellet obtained after the last precipitation step. M-NZYDNA Ladder III.
Since RNA purification with multiple precipitation did not work, we attempted a different protocol. In
this case, after the phenol extraction and ethanol precipitation, the pellet was resuspended with 0.3M
58
sodium acetate (pH 5.2) and 0.5 volumes of isopropyl alcohol, and incubated at room temperature. In
this step, pDNA and large molecular weight RNA will be precipitated (Kelmers u. a., 1965). The tRNA
and remaining contaminants were precipitated with 0.5 volumes of isopropyl alcohol.
Figure 4.12 shows a 1.2% agarose gel containing samples of the purification is observed. In this
figure, 1 and 2 contain samples of the recovered pellet after phenol extraction and ethanol precipitation.
3 shows a sample of the recovered pellet after the purification with 0.3 M sodium acetate at ph 5.2
method. With is method, both pDNA and most of all the other RNAs were removed.
Figure 4.12: A 1.2% agarose gel containing different steps of tRNA purification. 1 and 2-Samples the
supernatant of the precipitation with ethanol. 3-Pellet sample after the purification with 0.3 M sodium
acetate. M-NZYDNA Ladder III.
tRNA was further purified with an anion exchange chromatography. The resin used was DEAE
sepharose and as buffers 10 mM Tris-HCl (pH 8) (equilibrium) and 1M NaCl, 10 mM Tris-HCl (pH 8)
(elution). An anion exchange chromatography is a process that separates based on molecules charge.
The resin is coated with a positively charged counter-ions and will bind to negatively charged molecules.
In the equilibrium phase, all cations are bonded to counter ions present in the equilibration buffers. When
the sample is injected, negatively charged molecules will bind to the resin. The unbounded molecules
are washed out. The elution is usually perform with a gradient to increase of ion strength. The molecules
are disordered according to the number of negativity charged groups. In this case, the charge phosphate
from tRNA will bind to the matrix. When the ion strength exceed the strength of the tRNA it will detach
and eluted from the column.
Figure 4.13 shows the chromatogram obtained from tRNA purification with anion exchange chromatography. The column was equilibrated with 3 column volumes of 10 mM Tris-HCl, pH 8. 1 mL of
sample was injected, and the column was washed with the same buffer. During the was a peak is visible. The elution was made with a step of volumes gradient where the percentage of 1M NaCl buffer in
the flowtrough (%B) went from 0 to 100. During the gradient, only one peak appeared.
Two 1.2% agarose gels containing the samples collected from the peaks present in the AEC chromatogram are observed in figure 4.14.Figure 4.14a shows the peak that appear during washing. Since
no nucleic acids are visible, the peak may correspond to contaminants such as proteins. The second
peak samples are observed in figure 4.14b. It seems that pure tRNA as obtained.
59
Figure 4.13: AEC chromatogram of tRNA purification. The x axis correspond to the volume of the
flowtrough, and the double y axis to the absorvance at 254 nm (green line), the conductivity of the
flowtrough in mS/cm (blue line) and the the percentage of 1M NaCl buffer in the flowtrough (%B) (orange
line).
(a)
(b)
Figure 4.14: AEC chromatogram of tRNA purification and 1.2% agarose gel of the selected fractions.
4.14a) AEC chromatography with a gradient elution from 30 to 70% of NaCl buffer. The x axis correspond to the volume of the flowtrough, and the double y axis to the absorvance at 254 nm (green line),
the conductivity of the flowtrough in mS/cm (blue line), and the percentage of 1M NaCl buffer in the
flowtrough (%B) (orange line). 4.14b) A 1.2% agarose gel containing: 1 to 2- Fractions from the first
peak; 2 to 9- The selected fractions corresponding to tRNA peak; 10-Feed sample. M-NZYDIA Ladder
III.
Considering that the AEC purification with a gradient presented only on peak, a chromatography
with a step elution was design. The elution step was set to be with 45% of 1 M NaCl buffer. Figure
4.15 shows the AEC chromatogram of tRNA purification with a 45% step elution and a 1.2% agarose
gel of the selected fractions. In the chromatogram (figure 4.15a) it is observed that 2 two peaks are
maintained. It is also noted that the tRNA peak is more condensed. This was verified with in the 1.2%
agarose gel (figure 4.15b). The fractions containing tRNA were reduced from 7 to 4. The first peak did
not contain any nucleic acid as before.
To confirm if the first peak contained any protein, a SDS-gel containing samples from fraction of the
first peak from different runs, was run. The gel was stained with silver stain. In figure 4.16 the gel is
observed. The band visible in this gel may justify the peak in the chromatograms.
60
(a)
(b)
Figure 4.15: AEC chromatogram of tRNA purification and 1.2% agarose gel of the selected fractions.
4.14a) AEC chromatography with a elution step of 45% NaCl buffer. The x axis correspond to the volume
of the flowtrough, and the double y axis to the absorvance at 254 nm (green line), the conductivity of the
flowtrough in mS/cm (blue line), and the percentage of 1M NaCl buffer in the flowtrough (%B) (orange
line). 4.14b) A 1.2% agarose gel containing: 1 to 5- Fractions from the first peak; 6 to 9- The selected
fractions corresponding to tRNA peak; 11-Feed sample. M-NZYDIA Ladder III.
Figure 4.16: A SDS-page gel silver stained containing samples from the first peak of tRNA purification
chromatogram. Marker: Precision Plus Protein Standards duo Color (Bio Rad)
4.4
GFP purification
GFP produced from the plasmids pETGFP and pEXP5-NT/GFP was purified to be use for charactering
the protein produced in the cell-free systems. First the cells were cultured using the protocols described
in the section 3.6.1. The production was verified by observing the cells with a Leica DMLB microscope.
The figure 4.7 represents the E.coli cells containing the GFP produced from pETGFP (figure 4.17a) and
pEXP5-NT/GFP (figure 4.17b).
(a)
(b)
Figure 4.17: E.coli cells containing the GFP produced from pETGFP (figure 4.17a) and pEXP5-NT/GFP
(figure 4.17b) seen with a flurescence microscope with blue filter.
After this verification the GFP was purified. GFP produced from the pETGFP plasmid was purified by
61
HIC chromatografy on the bench. HIC separates proteins and other biomolecules from a crude lysate
based on differences in hydrophobicity. Proteins best suited for purification by HIC include those with
hydrophobic surface regions and able to withstand exposure to salt concentrations in excess of 2 M
ammonium sulphate (Murphy u. a., 2011). In this case, 4 M ammonium sulphate is used to equilibrate
the column. In a high salt concentration environment, the GFP hydrophobic groups become exposed
and bound to the matrix. During the washing, the concentration of salt is lowered by using 2 M and 1.3
M ammonium sulphate buffer. This way, the proteins with less hydrophobic regions are washed out. The
elution was made with a low salt (TE) buffer (10 mM Tris, 10 mM EDTA, pH 8). By lowering the salt
concentration, the hydrophobic groups will return to the interior of the protein, and they detach from the
matrix. This way, pure GFP is eluted from the column.
The quality of purification was analysed with a SDS-PAGE gel. Figure 4.18 shows a SDS-PAGE gel
stained with comassie blue with samples of washing and elution steps of the GFP HIC purification. It is
observed that during the elution, step 4 fractions contained pure and almost pure GFP with a size of 33
kD. It sould also be noted that during washing (first 3 column), a high size proteins are eluted.
Figure 4.18: A 12% acrylamide gel stained with comassie blue containing samples from the washing
and elution of GFP HIC purification. Marker: Precision Plus Protein Standards duo Color (Bio Rad)
GFP produced by pEXP5-NT/GFP was purified with a different chromatografy process. Because
pEXP5-NT/GFP have a N-terminal peptide containing 6× tag, it was possible to purify by affinity chromatografy. This chromatography is based on the ability of reversible adsorption of biomolecules trough
bio-specific interactions on the ligant. In this case a metal affinity chromatography (IMAC) was performed. This chromatography is based on the specific coordinate covalent bonds of amino acids (histidine in particular) to metals. A Ni-sepharose resin was used, which is precharged with N i2+ . N i2+
usually is the preferred metal ion to purify proteins containing his-tag. To detach the tag from the matrix,
buffer containing imidazole is used. Imidazole is a ring compound present in histidine, which have electron donor groups that form bonds with the immobilised transition metal (Bornhorst und Falke, 2000).
To perform this chromatography, three buffers containing imidazole were use: an equilibration buffer
containing 20 mM, a washing buffer containing 250 mM, and an elution buffer containing 500 mM.
Figure 4.19 shows two 15% acrylamide SDS PAGE gels of the GFP purification by IMAC chromatography. The samples observed in the figure 4.19a belong to a IMAC chromatography before imidazole
concentration optimization. The equilibration and washing buffer both had 10 mM imidazole. Comparing
the gel in figure 4.19a with the figure to the gel after optimization (4.19b), the latter has less unwanted
62
protein bonded to the matrix. In the first gel, a feeding and a washing sample as also presented. In both
gels, two prominent bands are present in the elution fractions. The top band has 33kD (which is with
approximately 27 kD is also visible. This band does not seem to be present on the feed. Since GFP
protein with the tag has 27 kD, the lower band may correspond to it. This band is so salient that it is
unlikely to be a non specific bond to the matrix.
(a)
(b)
Figure 4.19: Two 15% acrylamide SDS PAGE gels containing samples of GFP purification by IMAC
chromatography. 4.19a) 15% acrilamide gel containing: 1- Feeding sample: 2 to 4- Elution samples
containing GFP; 5- Washing sample. 4.19b) 15% acrylamide gel containing two elution samples with
GFP after the optimization of imidazole concentration in the buffer used. M- Precision Plus Protein
Standards duo Color (Bio Rad)
To test if the lower band has the 6× His tag a western blot using His-tag anti-body was used. Figure
4.20, shows a 15% acrylamide gel stained with comassie blue containing samples from the washing (3)
and elution (1 and 2) of GFP purified by IMAC. Below in the figure 4.20, a western blot with His-tag antbody with the same samples as the acrilamide gel. Only one band was visible in the western blot: only
the upper band has the His tag. By this analysis, it is safe to say that the protein is being degraded in
the fusion site. The samples were run again in a SDS-PAGE gel to observe if the degradation increased
over time. The results showed that the GFP containing His-tag stayed the same throughout time. So, the
degradation should have occurred during chromatography. Since these proteins had to have the tag to
bind to the matrix, this degradation should have occurred during the elution. This degradation may oocur
because the chromatography was perform with gravity-flow and the temperature was not controlled. To
avoid protein degradation it is advised to spend little time as possible in an environment temperature
bigger than 4o C.
4.5
S30 lysate preparation
The first step to prepare the S30 lysate is to chose the E. coli strain. The first cell free systems used
strains that lacked a major Rnase, (i.e. rna and/or rne mutations) such as the MRE600 and the A19.
These mutations increase the mRNA half-life (Kigawa u. a., 2004). The strain should be deficient in
OmpT and lon protease activities to reduce proteolyic degradation of the target protein.
In this study, the BL21(DE3) strain was chosen to produce the S30 lysate. This strain has a
63
Figure 4.20: A 15% acrylamide gel stained with comassie blue containing samples from the washing (3)
and elution (1 and 2) of GFP purified by IMAC. A western blot with His-tag ant-body from with the same
samples as the acrilamide gel on top. Marker: Precision Plus Protein Standards duo Color (Bio Rad).
λprophage carrying the t7 RNA polymerase gene and a lacI q . This allows the protein production from
the plasmid containing the T7 promoter ( such as pEXP5-NT/GFP, pEXP5-NT/CALM3 and pETGFP).
The strain also lacks OmpT endoproteinase, lon protease, and a major RNase –making them one of the
best strains for the extract lysate. Besides, this strain doesn’t have a tight control for the production of
T7 RNA polymerase, which means that even without induction, the strain has a basal expression. This
way, some amount of T7 RNAP will be present in the lysate.
However, in recent studies a BL21-derivative strain containing extra copies of argU, ileY, and leuW
tRNA gene has been used. This strain encodes tRNA species that recognize the arginine minor codons
(AGA and AGG), the isoleucine minor codon (AUA), and the leucine minor codon (CUA), respectively
(i.e. BL21 codon-plus strains, Stratagene, or Rosetta strains, Novagen). These results showed that
lysates has 50% more activity for cell-free protein synthesis (Kigawa u. a., 2004).
Other important aspect that influences protein synthesis in a cell free system is the cell growth. The
growth rate of the culture determines the ribosomal content of the extract (Zawada und Swartz, 2006),
so a medium that supports rapid growth ( µ>0.5h−1 ) should be used for best results. Usually, 2× YT
supplement with glucose and inorganic phosphate is the medium of choice because it produces better
lysated and longer cell-free reactions. Studies demonstrated that, although the cell growth rate is similar
in 2× YT and 2× YTPG, the lysates prepared from with cells grown in the latter have a lower phosphatase
activity (Kim u. a., 2008). The glucose added is used for a more efficiently regeneration of ATP due to
enrichment of glucose-metabolizing enzymes. It was also demonstrated that the regeneration of ATP
due to glucose leads to a higher rate of protein synthesis in a cell free system.
In this study, the inoculum was prepared with 2× YT medium because the lag phase is smaller
(Zawada, 2012). The cells were cultured in 2× YTPG medium, with a pH of 7.3 (since optimum pH for
E. coli is typically about 7.2–7.4). The cells were harvested in the mid-log phase. Figure 4.21 SHOWS
the average and standard deviations of the E.coli BL21(DE3) growth curve until the harvest. Comparing
64
the growth of the BL21(DE3) strain with (dark blue line) and without plasmid (ligth blue line), it seems
that both cultures have a 2 hour lag phase followed by 2 hours exponential phase (without plasmid) OR
3 hours (for cells with plasmid). It seems that cells without plasmid grow faster, which is expected.
Figure 4.21: E.coli BL21 growth curve represented by average and the respective standard deviations
until the harvest. the y axis corresponds to the optical density (OD600 ) of the cells. The x axis corresponds to the culture time in hours. The curve corresponding cell growth without plasmid is represented
in light blue, and the dark blue represent cell growth with plasmid.
The second and most important step in the S30 lysate preparation is the biomass processing. The
first step is to add S30 buffer to the biomass. Most protocols call for the addition of 1 mL per gram
cell paste. This value can vary, since the use of more buffer leads to a more diluted cell lysate and
improves clarification. The choice of volume used must be the most convenient for the lysis method
used. However, the optimum volume of extract used for cell-free reactions will depend on the cell dilution
factor. If more buffer is used to resuspend the cells, more extract will be needed in the reaction. In this
case, a 1 mL per gram of cell paste was chosen to use.
After resuspension, the cell must be lysated. This step is a key operation on lysate preparation. The
first methods usually used a fresh press to produce the lysate. Nowadays the most common protocols
use a specialised high-pressure homogenizer. However, this equipment is expensive so there is an
effort to develop methods to lysate cells using a less expensive and more common equipment (Kwon
und Jewett, 2015). There are already studies that use bead milling, bead vortexing (Liu u. a., 2005), and
a sontication study from this year.
In this study, a bead mill was the equipment chosen for this step. The method used was based on
published studies (Sun u. a., 2013). In the first batch produced, 3 grams of beads per grams of cell were
used and, in the next 5 batchs, 5 grams were used. The first 3 batches were produced with cell paste
corresponding to 1L of cell culture. In the last 3, 2L of cell culture was used. For the 1L of cell, the
cycles of bead milling were optimised and the final protocol obtained was 4 cycles of 30 seconds on, 30
seconds on ice. For the 2L of cell culture the protocol used was 6 cycles of 30 seconds on, 30 seconds
on ice.
After cell disruption, the lysate was centrifuged. Usually, 2 sequential centrifugations are preform at
30000× g, for 30 minutes. Recent studies indicate that centrifugation can be done at a lower g-force and
65
for less time (Kim u. a., 2006). In this study, the centrifugation was performed just one time at 3000× g
for 30 minutes.
The next step is a reaction named run-off. It was thought that this step allowed the ribosomes to
finish translating their current mRNA substrate to be released for in vitro translation of the mRNA of
interest (Jermutus u. a., 1998). The usual reaction was performed with the addition of several expensive
components. In a recent study, these reagents were omitted, simplifying the process and its cost (Liu
u. a., 2005). An added benefit of the empty runoff is that the absence of the reagents prevents unnecessary dilution. However, without this addition, the 70S ribosomes do not dissociate into subunits. In this
study, the run-off reaction was perform without the addition of reagents, at 37o C for 80 minutes. Most
lysate preparation procedures include extensive dialysis after the runoff reaction. Typically this is done
at 4o C for four 45 minutes periods versus 20 volumes of S30 buffer (changed every 45 minutes) using
6–8000 Da molecular weight cut-off dialysis tubing. Recent studies showed little if any benefit of the
dialysis step for cell-free reactions (Liu u. a., 2005). In this study, the first 3 lysates were dialysed against
20 volumes of S30 buffer overnight using a 12-14000 Da dialysis tubing.
After preparation, the S30 lysate must be stored in aliquots at −80o C sin ce higher temperatures can
reduce the extract activity. Also, the lysate volume is usually obtained in small quantities. In most cases
2 mL of lysate is obtained from 1 L cell culture. Other important aspect is the protein concentration.
Usually, the lysate must contain between 27-30 mg × mL−1 of protein (Liu u. a., 2005). However, extract
characteristics vary from batch to batch. We evaluated the 6 lysate produced in two ways. First, the lysis
efficiency was evaluated by compare the number of colonies presented in the lysates with a sample
before lysis (as described in 3.7.3). Table 4.3 shows the efficiency of lysis for each lysate. It seems
that any alteration to the lysis method had no impact on the lysis efficiency. Although there was some
“apparent” difference between the first and the rest of the colonies –on the plate– since the mixture is
so concentrated (1 mL per gram of cells), the lysis efficiency is not affected.
Lysate
1
2
3
4
5
6
(η)
0.99
0.99
0.99
0.99
0.99
0.99
Table 4.3: Cell lysis efficiency of the 6 lysated produced calculated from equation 3.4.
This result does not mean that all the lysates had the same protein concentration. The table 4.4
shows the protein concentration found in the 6 lysates as well as a summary of the procedures used
with each of them. The final entry corresponds to the protein concentration on the lysate of Invitrogen
cell-free kit. Not much conclusions can be taken from this. None of the lysates have the desired protein
concentration. However it seems that the last one is closer that the other. This one was produced with
cells not containing plasmid. This low protein concentration may be due to the lysis equipment used.
The bead mill available in the lab did not allow to chose the velocity as the ones described on other
66
studies. Moreover, the cells were lysed all at once and then transferred to the centrifugation tubes;
since the solution was very viscous, during the transference some of solution was lost. Other studies
did the lysis and centrifugation in the same tubes (Sun u. a., 2013). To understand better if the low
protein concentration is due to the lysis equipment, another lysis method should be tested, such as
high-pressure homogenizer. Since it is widely used for this process it would be easer to compare the
results.
Lysate
1
2
3
4
5
6
Lysate from kit
Cell culture
1L
1L
1L
2L
2L
2L
-
Bead mill lysis
3 grams and 4 cycles
5 grams and 4 cycles
5 grams and 4 cycles
5 grams and 6 cycles
5 grams and 6 cycles
5 grams and 6 cycles
-
Dialysis
yes
yes
yes
no
no
no
-
Protein concentration (mg × mL−1 )
9.78
14.66
10.29
10.87
19.82
26.3
30.32
Table 4.4: Protein concentration for the 6 different lysates. The last entry corresponds to the protein
concentration from the lysate of Invitrogen cell-free kit.
4.6
Cell-free protein synthesis
The first step towards the construction of a cell-free platform was to test the plasmids pEXP5-NT/GFP
and pETGFP. In theory, this plasmid has all the components necessary to be used as a expression vector
in transcription/translation E.coli cell-free system. The test was performed with a Expressway Cell-Free
E. coli Expression System (Invitrogen). This kit contains an optimised E. coli extract, produced based on
the original protocol (Zubay, 1973),a reaction buffer composed of an ATP regeneration system, a feed
buffer containing salts and other substances to replenish depleted or degraded components, all amino
acids, T7 RNA polymerase, and the plasmid pEXP5-NT/CALML3 for use as a positive control. The tests
were performed as described in 3.8.1. pEXP5-NT/GFP was tested first. 4 reactions were prepared:
1 containing the positive control (pEXP5-NT/CALML3) and 3 containing the plasmid pEXP5-NT/GFP.
Figure 4.22 shows a 15% acrilamide SDS-PAGE with samples of the 4 reactions. In the samples 2 to 4,
corresponding to the reactions with pEXP5-NT/GFP plasmids, is visible a bands with approximately 33
kD that is not visible in the reaction with pEXP5-NT/CALML3. However, in the samples corresponding
to the positive control, the band corresponding to the CALML3 protein (19 kD) is not visible. This may
be due to the acrilamide concentration used, which only allows to separate proteins with a kDA higher
than 15 kD. Besides, the lysate seems to have proteins with the same size. To confirm the production of
CALML3 protein a western blot with His-tag or CALML3 anti-body could be used.
The GFP production was confirmed by measuring the fluorescence of active GFP using a VersaFluor
fluorometer with EX490/10 excitation filter and EX510/10 emission filter (Bio-rad). The GFP concentration was calculated by a concentration curve measured with pure GFP protein produced from BL21(DE3)
cells containing pEXP5-NT/GFP, as described earlier. Using this kit, we were able to produce 9.25 +5.79 µg × µL−1 . The high standard deviation may be due to operation errors since we are dealing with
67
Figure 4.22: A 15% acrilamide SDS-PAGE gel containg samples of pEXP5-NT/GFP tests using Expressway Cell-Free textitE. coli Expression System (Invitrogen). 1) Test containing the control vector
(pEXP5-NT/CALML3); 2 to 4) Tests containg pEXP5/GFP as expression vector. M) Precision Plus Protein Standards duo Color Marker (Bio Rad).
small volumes.
Then, pETGFP was tested. The same 4 tests were perform, but instead of using pEXP5-NT/CALML3
as a positive control, we used pEXP5-NT/GFP. The results can seen in figure 4.23. It seems that in
the first sample (corresponding to the positive control) a band with approximately 33 kD is observed.
However, in the other samples, any band with around 33 kD is observed. The presence of a lac operator
in front of the MCS, and a lacI gene from the lac operon that codes for the lac repressor (LacI) can
explain these results. The lacI gene produces a protein (LacI) that binds in a sequence specific manner
to the major groove of the operator sequence and blocks T7 RNA polymerase from binding the promoter
sequence. In order to unblock it, lactose must be present. Lactose will bind to LacI and induce a
conformation change in the LacI structure that makes it incapable of binding to the lac operon. Since
IPTG (which structurally mimics lactose) was not added to the the reaction, the T7 RNA polymerase was
not able to bind to the T7 promoter and, thereafter, the protein was not produce.
Figure 4.23: A 15% acrilamide SDS-PAGE gel containg samples of pETGFP tests using Expressway
Cell-Free textitE. coli Expression System (Invitrogen). 1) Test containing the control vector (pEXP5NT/GFP); 2 to 4) Tests containg pETGFP as expression vector. M) Precision Plus Protein Standards
duo Color Marker (Bio Rad).
Since adding (and optimising) IPTG to the reaction would be adding other variable to a highly complex
system, we decided to not use pETGFP to construct the cell-free system. All the tests bellow were made
using pEXP5-NT/GFP as a expression vector, since it seems to be expressed and this systems and it
68
GFP was easily detected.
One variable that influences the production of active protein is the incubation temperature. Usually,
the protein synthesis reaction incubation temperature ranges from 30o C to 37o C, and the optimal temperature depends on the solubility of the target protein (Zawada, 2012). In most of cases, the highest
yield is obtained at higher temperatures (i.e. 37o C). However, many studies suggest that a lower incubation temperature improves the activity of GFP protein (Iskakova u. a., 2006). Since in vivo GFP
production from pEXP5NT/GFP was optimised to a temperature of 30o C, this temperature was also
tested to produce in vitro with the Expressway cell-free kit. Figure 4.24 shows a histogram with the GFP
concentration produced at 37o C and 30o C. It seems that at 30o C more active GFP is produced, as some
studies already presented (Iskakova u. a., 2006).
Figure 4.24: A histogram containing the GFP produced with Expressway cell-free kit at two incubation
temperatures- 37o C (dark blue bar) and 37o C (light blue bar) and the respective standard deviations.
The 6 lysates produced were also tested with the Expressway cell-free kit. The lysate from the
kit was used as positive control. The tests were perform at the temperature recommended for the kit
(37o C). Figure 4.25 shows the results obtained. It seems that none of the lysates produced protein with
a comparable amount of the kit lysate. This was not a surprise for a number of reason: first, the kit
is optimised for the production with the lysate contained in the kit; second: The protein concentration
present in the lysates ( table 4.3) was lower than the one from the kit. The last lysate showed a slightly
higher protein production, when comparing to the other five. This one was also the one with a higher
protein concentration. Taking into account these results and the lysate volume achieved, the lysate 6
was the one that could be considered for further studies.
Figure 4.25: A histogram containing the average relative flurescence (RFU) of the produced GFP in the
6 lysates and the lysate from the kit.
After chosing the template and the lysate, the energy system was explored. The Cytomim system
was chosen to used in this cell-free system. This energy system expores the activation of oxidative phos69
phorylation. In the presence of thiamine pyrophosphate (TTP) and flavin adenine dinucleotide (FAD),
acetyl phosphate is generated through the condensation of pyruvate and inorganic phosphate (Lian u. a.,
2014). Then, the acetyl phosphate is catalysed by endogenous acetyl kinase in the E. coli S30 lysate.
This system requires the presence of oxygen for the generation of acetyl phosphate and produces H2 O2
as a by-product, but it is sufficiently degraded by endogenous catalysis activity (Kim und Kim, 2009).
The Cytomim system requires inverted membrane vesicles to perform oxidative phosphorylation. These
vesicles are formed during the lysis step, usually a high pressure homogenization, and remain in the
final lysate.
This system was tested as described in 3.8.2. The lysate 6 and pEXP5-NT/GFP were used. The
GFP obtained was measured in term of fluorescence of active GFP. 54.50 +- 3,25 relative fluorescence
units of GFP were obtained.
This system was further optimised. The most sensitive variable of a E.coli is the magnesium concentration (Zawada, 2012) (Sun u. a., 2013). The standard conditions (8mM) should provide a acceptable
activity, nevertheless the different concentrations concentration should be tested. In this case, the magnesium concentration was varied from 2 to 12 mM in increments of 2mM. The other variable optimised
was the plasmid concentration. Finally, taking into account that the lysate used has a low protein concentration, increasing the volume used was also screened. In figure 4.26 the results of the screens are
presented.
(a)
(b)
(c)
Figure 4.26: Optimisation screens of E. coli cell-free protein synthesis containing the cytomimic system
as a energy system, pEXP5-NT/GFP as a template and the lysate 6. 4.26a) Active GFP produced, in
relative fluorescence units, with the variation of magnesium concentration from 2mM to 12mM in increments of 2mM. 4.26b) Active GPF produced, in relative fluorescence units, with the variation of template
(pEXP5-NT/GFP) concentration in µg × mL−1 . 4.26c) Active GPF produced, in relative fluorescence
units, with the variation of lysate volume (%).
In the figure 4.26, the graphics correspondent to the volume increase screens are presented. Figure
70
4.26a shows the active GFP produced, in relative fluorescence units, with the increment of magnesium
concentration. It seems that the optimal M g 2+ is between 6 and 8 mM. However, these results can only
be applied to this lysate batch. For every lysate, magnesium concentration must be optimised (Zawada,
2012). In case of plasmid concentration optimisation (figure 4.26b), it seems that from 33 µg × mL−1 ,
increasing the concentration does not have much effect in protein production. This was already observed
in other studies (Kai u. a., 2013). Finally, the volume of lysate added was tested (4.26c). Since the lysate
buffer has a lower protein concentration, an increase in the lysate volume added should increase the
protein produced. This seems to be observed.
Besides these screens, it would be interesting to test variations in potassium and T7 RNA polymerase
concentrations. Another possible research direction could be to test other energy systems (e.g. dual
energy system or maltose energy system). Finally, it seems that the configuration also affects protein
production. With the energy system used in this dissertation, a good gas exchange system is required,
so using a thin film configuration would be interesting to test.
71
72
Chapter 5
Conclusions
Cell-free protein synthesis has emerged as an important and effective alternative to both cell-based
expression systems and solid-phase protein synthesis. The numerous vantages over in vivo systems,
such as the ability to monitor and control the reaction, makes these systems not only attractive for
protein production, but also opens the doors to new possibilities for applications in biotechnology, ranging
from microscale to industrial scale and diverse areas including protein microarrays, biotherapeutics,
biomaterials, and synthetic biology (Whittaker, 2013). In recent years, it has been an effort overcome
the cell-free systems challenges, such as the ability to reliably synthesize any biologically active protein
in a universal platform, the lack of a cost effective and scalable CFPS platform, and the inability to carry
out humanized glycosylation patterns (Carlson u. a., 2012).
In this dissertation, the first steps to construct a robust and cost effective platform for in vitro protein
synthesis in a coupled transcription–translation system were taken. First, an adequate DNA template
(pEXP5-NT/GFP) was designed, containing all the key components and the simplicity necessary to
be successfully used in these systems. The incorporation of GFP as the reported gene makes the
production analysis simpler and more direct, when compared to the incorporation of radiolabelled amino
acids traditionally used.
The use of alkaline lysis and HIC purification to plasmid purification allow us to achieved highly
pure plasmid in a higher quantity and lower cost than using available commercial kits. Using SEC
chromatography as desalting method proved to be better than dialysis. This step is important not only
maintain the plasmid integrity but also high salt concentrations may inhibit protein production. Other
important aspect is the strain used to plasmid production. A strain containing mutations in recA and
endE (such as DH5α or TOP10) should be used.
Purification of total tRNA was also tested in this dissertation. The addition of pure tRNA to a cell-free
systems not only increase the protein production, but also ensures a better control over the reaction.
The tRNA purification was achieved by extracting the nucleic acids by phenol extraction, then DNA
was then separated with sodium acetate at pH 5 and the remaining contaminants were removed by
anion exchange chromatography (Kelmers u. a., 1965). This protocol worked better than expected,
since almost all rRNA was removed in the DNA separation step. The use of phenol extraction simplifies
73
the purification because the cells are not lysed, and most proteins are removed. The anion exchange
chromatography with a step elution allows a rapid purification and in a high concentration. This protocol
could be easily scaled-up.
One of the most important steps in the construction of a cell-free system platform is the preparation
of the lysate. This preparation should be easy and reproducible (Shrestha u. a., 2012). One of the
key points in the E. coli strain used. A strain lacking major Rnase and deficient in OmpT and lon
protease was chosen. It is also important that the strain recognises the promoter used in the DNA
template. BL21(DE3) was used because it has all the characteristics referred and BL21-derivatives are
used in many studies (Ahn u. a., 2005). The second, and most important step is the cell disruption.
Usually mechanical methods are applied, such as high pressure homogeniser. In recent years, studies
successfully using bead vortexing (Shrestha u. a., 2012) and sonication (Kwon und Jewett, 2015) were
published. In this dissertation a bead milling was used to produce the lysate. Although the cell lysis was
efficient in all the attempts, the protein concentration never reached the desired values.
We finished our study in a attempt to construct the cell-free system from scratch. The incubation temperature was first studied. As in previous studies (Iskakova u. a., 2006), active GFP was better produced
at lower temperatures (in this case at 30o C). The cell-free system constructed uses the cytomim system
as an energy source. This system explores the activation of oxidative phosphorilation and it is dependent on the presence of inverted membranes (produced during lysis) and an efficient gas exchange.
In order to explore this energy system, the last lysate produced and the pEXP5-NT/GFP plasmid were
used. Unfortunately, the protein produced by this system was not comparable to the ones produced by
commercial kits. However, we attempted to optimised some of the variables. Cell-free system seem
to be very sensible to magnesium concentrations (Zawada, 2012). For the lysate, in this dissertation,
the ideal magnesium concentration appears to be between 6 mM and 8 mM. The plasmid concentration
was also screen. As previous reported (Kai u. a., 2013), increasing the plasmid concentration from 33
µg × µL−1 does not have much effect in active protein produced. Finally, the lysate volume was also
screen. Since the lysate have a lower protein concentration, increasing the volume added to the reaction
should increase the protein production. This is observed to the volumes tested.
Future Work
Although the main goal of construct a reproducible E. coli cell-free protein synthesis system platform was
not achieved, some major step were taken in this path. In the future, it would be important to improve the
lysate production. Different lysis mechanism (such as high pressure homogeniser or a sonicator) should
be tested. Also, lowering the centrifugation speed and produce the cell culture with pH control could
affect results. Another possible research direction could be to test other energy systems, such as dual
energy system and maltose energy system. Finally, it seems that the configuration also affects protein
production: it would important to experiment with a bilayer system or a thin film approach. Finally, in a
not so near future, it would be interesting to apply this systems to drug delivery or even to the study of
minimal cells.
74
Bibliography
[Ahn u. a. 2005]
A HN, Jin-Ho ; C HU, Hun-Su ; K IM, Tae-Wan ; O H, In-Seok ; C HOI, Cha-Yong ; H AHN,
Geun-Hee ; PARK, Chang-Gil ; K IM, Dong-Myung: Cell-free synthesis of recombinant proteins from
PCR-amplified genes at a comparable productivity to that of plasmid-based reactions. In: Biochemical
and biophysical research communications 338 (2005), Nr. 3, S. 1346–1352
[Anderson u. a. 2008]
A NDERSON, Karen S. ; R AMACHANDRAN, Niroshan ; W ONG, Jessica ; R APHAEL,
Jacob V. ; H AINSWORTH, Eugenie ; D EMIRKAN, Gokhan ; C RAMER, Daniel ; A RONZON, Dina ; H ODI,
F S. ; H ARRIS, Lyndsay u. a.: Application of protein microarrays for multiplexed detection of antibodies
to tumor antigens in breast cancer. In: Journal of proteome research 7 (2008), Nr. 4, S. 1490–1499
[Arumugam u. a. 2014]
A RUMUGAM, Thangavelu U. ; I TO, Daisuke ; TAKASHIMA, Eizo ; TACHIBANA,
Mayumi ; I SHINO, Tomoko ; TORII, Motomi ; T SUBOI, Takafumi: Application of wheat germ cell-free
protein expression system for novel malaria vaccine candidate discovery. In: Expert review of vaccines
13 (2014), Nr. 1, S. 75–85
[Bancroft u. a. 1973]
B ANCROFT, F C. ; W U, Guang-Jer ; Z UBAY, Geoffrey: Cell-free synthesis of rat
growth hormone. In: Proceedings of the National Academy of Sciences 70 (1973), Nr. 12, S. 3646–
3649
[Behnke 1983]
B EHNKE, U: RK Scopes: Protein Purification. Principles and Practice (aus der Serie:
Springer Advanced Texts in Chemistry, Herausgeber Ch. R. Cantor). 282 Seiten, 28 Tab., 145 Abb.
Springer-Verlag, New York, Heidelberg, Berlin 1982. Preis: 79,–DM. In: Food/Nahrung 27 (1983),
Nr. 8, S. 809–810
[Binz u. a. 2004]
B INZ, H K. ; A MSTUTZ, Patrick ; KOHL, Andreas ; S TUMPP, Michael T. ; B RIAND,
Christophe ; F ORRER, Patrik ; G R ÜTTER, Markus G. ; P L ÜCKTHUN, Andreas: High-affinity binders
selected from designed ankyrin repeat protein libraries. In: Nature biotechnology 22 (2004), Nr. 5,
S. 575–582
[Bornhorst und Falke 2000]
B ORNHORST, Joshua A. ; FALKE, Joseph J.: Purification of proteins using
polyhistidine affinity tags. In: Methods in enzymology 326 (2000), S. 245
[Borsook 1950]
B ORSOOK, Henry: Protein turnover and incorporation of labeled amino acids into
tissue proteins in vivo and in vitro. In: Physiological reviews 30 (1950), Nr. 2, S. 206–219
75
[Bozell und Petersen 2010]
B OZELL, Joseph J. ; P ETERSEN, Gene R.: Technology development for
the production of biobased products from biorefinery carbohydrates– The US Department of Energys
”top 10” revisited. In: Green Chemistry 12 (2010), Nr. 4, S. 539–554
[Bugaut und Balasubramanian 2012]
B UGAUT, Anthony ; B ALASUBRAMANIAN, Shankar: 5?-UTR RNA
G-quadruplexes: translation regulation and targeting. In: Nucleic acids research 40 (2012), Nr. 11,
S. 4727–4741
[Bulleid u. a. 1992]
ING ,
B ULLEID, NJ ; B ASSEL -D UBY, RS ; F REEDMAN, RB ; S AMBROOK, JF ; G ETH -
MJ: Cell-free synthesis of enzymically active tissue-type plasminogen activator. Protein folding
determines the extent of N-linked glycosylation. In: Biochem. J 286 (1992), S. 275–280
[Bundy u. a. 2008]
B UNDY, Bradley C. ; F RANCISZKOWICZ, Marc J. ; S WARTZ, James R.: Escherichia
coli-based cell-free synthesis of virus-like particles. In: Biotechnology and bioengineering 100 (2008),
Nr. 1, S. 28–37
[Bundy und Swartz 2010]
B UNDY, Bradley C. ; S WARTZ, James R.: Site-specific incorporation of p-
propargyloxyphenylalanine in a cell-free environment for direct protein- protein click conjugation. In:
Bioconjugate chemistry 21 (2010), Nr. 2, S. 255–263
[Calhoun und Swartz 2005a]
C ALHOUN, Kara A. ; S WARTZ, James R.: An Economical Method for Cell-
Free Protein Synthesis using Glucose and Nucleoside Monophosphates. In: Biotechnology progress
21 (2005), Nr. 4, S. 1146–1153
[Calhoun und Swartz 2005b]
C ALHOUN, Kara A. ; S WARTZ, James R.: Energizing cell-free protein
synthesis with glucose metabolism. In: Biotechnology and bioengineering 90 (2005), Nr. 5, S. 606–
613
[Carlson u. a. 2012]
C ARLSON, Erik D. ; G AN, Rui ; H ODGMAN, C E. ; J EWETT, Michael C.: Cell-free
protein synthesis: applications come of age. In: Biotechnology advances 30 (2012), Nr. 5, S. 1185–
1194
[Caschera und Noireaux 2014]
C ASCHERA, Filippo ; N OIREAUX, Vincent: Synthesis of 2.3 mg/ml of
protein with an all Escherichia coli cell-free transcription–translation system. In: Biochimie 99 (2014),
S. 162–168
[Casteleijn u. a. 2013]
C ASTELEIJN, Marco G. ; U RTTI, Arto ; S ARKHEL, Sanjay: Expression with-
out boundaries: cell-free protein synthesis in pharmaceutical research. In: International journal of
pharmaceutics 440 (2013), Nr. 1, S. 39–47
[Cayama u. a. 2000]
C AYAMA, Edmundo ; Y ÉPEZ, Antonio ; R OTONDO, Fernando ; B ANDEIRA, Ed-
uardo ; F ERRERAS, Ana C. ; T RIANA -A LONSO, Francisco J.: New chromatographic and biochemical
strategies for quick preparative isolation of tRNA. In: Nucleic acids research 28 (2000), Nr. 12,
S. e64–e64
76
[Chalmeau u. a. 2011]
C HALMEAU, Jerome ; M ONINA, Nadezda ; S HIN, Jonghyeon ; V IEU,
Christophe ; N OIREAUX, Vincent: α-Hemolysin pore formation into a supported phospholipid bilayer
using cell-free expression. In: Biochimica et Biophysica Acta (BBA)-Biomembranes 1808 (2011),
Nr. 1, S. 271–278
[Cherubini 2010]
C HERUBINI, Francesco: The biorefinery concept: using biomass instead of oil for
producing energy and chemicals. In: Energy Conversion and Management 51 (2010), Nr. 7, S. 1412–
1421
[Chumpolkulwong u. a. 2006]
C HUMPOLKULWONG, Namthip ; S AKAMOTO, Kensaku ; H AYASHI, Akiko ;
I RAHA, Fumie ; S HINYA, Naoko ; M ATSUDA, Natsuko ; K IGA, Daisuke ; U RUSHIBATA, Akiko ; S HI ROUZU ,
Mikako ; O KI, Kenji u. a.: Translation of ”rare” codons in a cell-free protein synthesis system
from Escherichia coli. In: Journal of structural and functional genomics 7 (2006), Nr. 1, S. 31–36
[Cloninger u. a. 2008]
C LONINGER, Cheri ; F ELTON, Marilyn ; PAUL, Bonnie ; H IRAKAWA, Yasuko ;
M ETZENBERG, Stan: Control of pH during plasmid preparation by alkaline lysis of Escherichia coli. In:
Analytical biochemistry 378 (2008), Nr. 2, S. 224–225
[Contreras-Martı́nez und DeLisa 2007]
C ONTRERAS -M ART ÍNEZ, Lydia M. ; D E L ISA, Matthew P.: In-
tracellular ribosome display via SecM translation arrest as a selection for antibodies with enhanced
cytosolic stability. In: Journal of molecular biology 372 (2007), Nr. 2, S. 513–524
[Crestfield u. a. 1955]
C RESTFIELD, Arthur M. ; S MITH, Kendric C. ; A LLEN, Frank W.: The preparation
and characterization of ribonucleic acids from yeast. In: J. biol. Chem 216 (1955), Nr. 1, S. 185–193
[Davis 2004]
DAVIS, Benjamin G.: Mimicking posttranslational modifications of proteins. In: Science
303 (2004), Nr. 5657, S. 480–482
[Dreyfus 1988]
D REYFUS, Marc: What constitutes the signal for the initiation of protein synthesis on
Escherichia coli mRNAs? In: Journal of molecular biology 204 (1988), Nr. 1, S. 79–94
[Du u. a. 2009]
D U, Liping ; G AO, Rong ; F ORSTER, Anthony C.: Engineering multigene expression in
vitro and in vivo with small terminators for T7 RNA polymerase. In: Biotechnology and bioengineering
104 (2009), Nr. 6, S. 1189–1196
[Dudley u. a. 2015]
D UDLEY, Quentin M. ; K ARIM, Ashty S. ; J EWETT, Michael C.: Cell-free metabolic
engineering: Biomanufacturing beyond the cell. In: Biotechnology journal 10 (2015), Nr. 1, S. 69–82
[Endo und Sawasaki 2004]
E NDO, Yaeta ; S AWASAKI, Tatsuya: High-throughput, genome-scale pro-
tein production method based on the wheat germ cell-free expression system. In: Journal of structural
and functional genomics 5 (2004), Nr. 1-2, S. 45–57
[Endoh u. a. 2006]
E NDOH, Takashi ; K ANAI, Tamotsu ; S ATO, Yuko T. ; L IU, David V. ; YOSHIKAWA,
Kenichi ; ATOMI, Haruyuki ; I MANAKA, Tadayuki: Cell-free protein synthesis at high temperatures using
the lysate of a hyperthermophile. In: Journal of biotechnology 126 (2006), Nr. 2, S. 186–195
77
[Ezure u. a. 2010]
E ZURE, Toru ; S UZUKI, Takashi ; S HIKATA, Masamitsu ; I TO, Masaaki ; A NDO, Eiji: A
cell-free protein synthesis system from insect cells. In: Cell-Free Protein Production. Springer, 2010,
S. 31–42
[Forster und Church 2007]
F ORSTER, Anthony C. ; C HURCH, George M.: Synthetic biology projects
in vitro. In: Genome research 17 (2007), Nr. 1, S. 1–6
[Freitas u. a. 2006]
F REITAS, SS ; S ANTOS, JAL ; P RAZERES, DMF: Optimization of isopropanol and
ammonium sulfate precipitation steps in the purification of plasmid DNA. In: Biotechnology progress
22 (2006), Nr. 4, S. 1179–1186
[Goerke und Swartz 2008]
G OERKE, Aaron R. ; S WARTZ, James R.: Development of cell-free protein
synthesis platforms for disulfide bonded proteins. In: Biotechnology and bioengineering 99 (2008),
Nr. 2, S. 351–367
[Goshima u. a. 2008]
G OSHIMA, Naoki ; K AWAMURA, Yoshifumi ; F UKUMOTO, Akiko ; M IURA, Aya ;
H ONMA, Reiko ; S ATOH, Ryohei ; WAKAMATSU, Ai ; YAMAMOTO, Jun-ichi ; K IMURA, Kouichi ;
N ISHIKAWA, Tetsuo u. a.: Human protein factory for converting the transcriptome into an in vitro–
expressed proteome. In: Nature methods 5 (2008), Nr. 12, S. 1011–1017
[Griffiths und Tawfik 2003]
G RIFFITHS, Andrew D. ; TAWFIK, Dan S.: Directed evolution of an extremely
fast phosphotriesterase by in vitro compartmentalization. In: The EMBO journal 22 (2003), Nr. 1,
S. 24–35
[Harris und Jewett 2012]
H ARRIS, D C. ; J EWETT, Michael C.: Cell-free biology: exploiting the interface
between synthetic biology and synthetic chemistry. In: Current opinion in biotechnology 23 (2012),
Nr. 5, S. 672–678
[He 2008]
H E, Mingyue: Cell-free protein synthesis: applications in proteomics and biotechnology. In:
New biotechnology 25 (2008), Nr. 2, S. 126–132
[He und Khan 2005]
H E, Mingyue ; K HAN, Farid: Ribosome display: next-generation display technolo-
gies for production of antibodies in vitro. (2005)
[He u. a. 2008a]
H E, Mingyue ; S TOEVESANDT, Oda ; PALMER, Elizabeth A. ; K HAN, Farid ; E RICSSON,
Olle ; TAUSSIG, Michael J.: Printing protein arrays from DNA arrays. In: Nature methods 5 (2008),
Nr. 2, S. 175–177
[He u. a. 2008b]
H E, Mingyue ; S TOEVESANDT, Oda ; TAUSSIG, Michael J.: In situ synthesis of protein
arrays. In: Current opinion in biotechnology 19 (2008), Nr. 1, S. 4–9
[He und Taussig 2001]
H E, Mingyue ; TAUSSIG, Michael J.: Single step generation of protein arrays
from DNA by cell-free expression and in situ immobilisation (PISA method). In: Nucleic acids research
29 (2001), Nr. 15, S. e73–e73
[Hodgman und Jewett 2012]
H ODGMAN, C E. ; J EWETT, Michael C.:
Cell-free synthetic biology:
thinking outside the cell. In: Metabolic engineering 14 (2012), Nr. 3, S. 261–269
78
[Höök und Tang 2013]
H Ö ÖK, Mikael ; TANG, Xu: Depletion of fossil fuels and anthropogenic climate
change– A review. In: Energy Policy 52 (2013), S. 797–809
[Iskakova u. a. 2006]
I SKAKOVA, Madina B. ; S ZAFLARSKI, Witold ; D REYFUS, Marc ; R EMME, Jaanus ;
N IERHAUS, Knud H.: Troubleshooting coupled in vitro transcription–translation system derived from
Escherichia coli cells: synthesis of high-yield fully active proteins. In: Nucleic acids research 34
(2006), Nr. 19, S. e135–e135
[Jackson u. a. 2004]
J ACKSON, Alison M. ; B OUTELL, Joe ; C OOLEY, Neil ; H E, Mingyue: Cell-free
protein synthesis for proteomics. In: Briefings in functional genomics & proteomics 2 (2004), Nr. 4,
S. 308–319
[Jang u. a. 1988]
J ANG, SK ; K R ÄUSSLICH, HG ; N ICKLIN, MJ ; D UKE, GM ; PALMENBERG, AC ;
W IMMER, E: A segment of the 5’nontranslated region of encephalomyocarditis virus RNA directs
internal entry of ribosomes during in vitro translation. In: Journal of virology 62 (1988), Nr. 8, S. 2636–
2643
[Jennings und Bachmann 2008]
J ENNINGS, Gary T. ; B ACHMANN, Martin F.: The coming of age of
virus-like particle vaccines. In: Biological chemistry 389 (2008), Nr. 5, S. 521–536
[Jermutus u. a. 1998]
J ERMUTUS, Lutz ; RYABOVA, Lyubov A. ; P L ÜCKTHUN, Andreas: Recent ad-
vances in producing and selecting functional proteins by using cell-free translation. In: Current opinion
in biotechnology 9 (1998), Nr. 5, S. 534–548
[Jewett und Forster 2010]
J EWETT, Michael C. ; F ORSTER, Anthony C.: Update on designing and
building minimal cells. In: Current opinion in biotechnology 21 (2010), Nr. 5, S. 697–703
[Jewett und Swartz 2004a]
J EWETT, Michael C. ; S WARTZ, James R.: Mimicking the Escherichia coli
cytoplasmic environment activates long-lived and efficient cell-free protein synthesis. In: Biotechnology and bioengineering 86 (2004), Nr. 1, S. 19–26
[Jewett und Swartz 2004b]
J EWETT, Michael C. ; S WARTZ, James R.: Rapid Expression and Purifi-
cation of 100 nmol Quantities of Active Protein Using Cell-Free Protein Synthesis. In: Biotechnology
progress 20 (2004), Nr. 1, S. 102–109
[Jia u. a. 2009]
J IA, Xinying ; O ZAWA, Kiyoshi ; L OSCHA, Karin ; OTTING, Gottfried: Glutarate and
N-acetyl-L-glutamate buffers for cell-free synthesis of selectively 15N-labelled proteins. In: Journal of
biomolecular NMR 44 (2009), Nr. 2, S. 59–67
[Jiang u. a. 2002]
J IANG, XiuPing ; O OKUBO, Yuji ; F UJII, Ikuo ; N AKANO, Hideo ; YAMANE, Tsu-
neo: Expression of Fab fragment of catalytic antibody 6D9 in an Escherichia coli in vitro coupled
transcription/translation system. In: FEBS letters 514 (2002), Nr. 2, S. 290–294
[Kai u. a. 2013]
K AI, Lei ; D ÖTSCH, Volker ; K ALDENHOFF, Ralf ; B ERNHARD, Frank: Artificial Environ-
ments for the Co-Translational Stabilization of Cell-Free Expressed Proteins. In: PLoS ONE 8 (2013),
02, Nr. 2, S. e56637. – URL http://dx.doi.org/10.1371%2Fjournal.pone.0056637
79
[Kalmbach u. a. 2007]
K ALMBACH, Rolf ; C HIZHOV, Igor ; S CHUMACHER, Miria C. ; F RIEDRICH,
Thomas ; B AMBERG, Ernst ; E NGELHARD, Martin: Functional cell-free synthesis of a seven helix
membrane protein: in situ insertion of bacteriorhodopsin into liposomes. In: Journal of molecular
biology 371 (2007), Nr. 3, S. 639–648
[Kanda u. a. 1996]
K ANDA, T ; TAKAI, K ; YOKOYAMA, S ; TAKAKU, H: Removing tRNA from a cell-free
protein synthesis system for use in protein production. In: Nucleic acids symposium series, 1996,
S. 319–320
[Kanter u. a. 2007]
K ANTER, Gregory ; YANG, Junhao ; VOLOSHIN, Alexei ; L EVY, Shoshana ; S WARTZ,
James R. ; L EVY, Ronald: Cell-free production of scFv fusion proteins: an efficient approach for
personalized lymphoma vaccines. In: Blood 109 (2007), Nr. 8, S. 3393–3399
[Karikó u. a. 2008]
K ARIK Ó, Katalin ; M URAMATSU, Hiromi ; W ELSH, Frank A. ; L UDWIG, János ; K ATO,
Hiroki ; A KIRA, Shizuo ; W EISSMAN, Drew: Incorporation of pseudouridine into mRNA yields superior
nonimmunogenic vector with increased translational capacity and biological stability. In: Molecular
Therapy 16 (2008), Nr. 11, S. 1833–1840
[Katayama u. a. 2010]
K ATAYAMA, Yukie ; S HIMOKATA, Kunitoshi ; S UEMATSU, Makoto ; O GURA,
Takashi ; T SUKIHARA, Tomitake ; YOSHIKAWA, Shinya ; S HIMADA, Hideo: Cell-free synthesis of cytochrome c oxidase, a multicomponent membrane protein. In: Journal of bioenergetics and biomembranes 42 (2010), Nr. 3, S. 235–240
[Katzen u. a. 2005]
K ATZEN, Federico ; C HANG, Geoffrey ; K UDLICKI, Wieslaw: The past, present and
future of cell-free protein synthesis. In: Trends in biotechnology 23 (2005), Nr. 3, S. 150–156
[Kelmers u. a. 1965]
K ELMERS, AD ; N OVELLI, G D. ; S TULBERG, MP: Separation of transfer ribonu-
cleic acids by reverse phase chromatography. In: Journal of Biological Chemistry, 1965 240 (1965),
Nr. ORNL-P–1177
[Kigawa u. a. 2008]
K IGAWA, Takanori ; M ATSUDA, Takayoshi ; YABUKI, Takashi ; YOKOYAMA,
Shigeyuki: Bacterial Cell-Free System for Highly Efficient Protein Synthesis. In: Cell-Free Protein
Synthesis: Methods and Protocols (2008), S. 83–97
[Kigawa u. a. 2004]
K IGAWA, Takanori ; YABUKI, Takashi ; M ATSUDA, Natsuko ; M ATSUDA, Takayoshi ;
N AKAJIMA, Rie ; TANAKA, Akiko ; YOKOYAMA, Shigeyuki: Preparation of Escherichia coli cell extract
for highly productive cell-free protein expression. In: Journal of structural and functional genomics 5
(2004), Nr. 1-2, S. 63–68
[Kigawa u. a. 1999]
K IGAWA, Takanori ; YABUKI, Takashi ; YOSHIDA, Yasuhiko ; T SUTSUI, Michio ; I TO,
Yutaka ; S HIBATA, Takehiko ; YOKOYAMA, Shigeyuki: Cell-free production and stable-isotope labeling
of milligram quantities of proteins. In: FEBS letters 442 (1999), Nr. 1, S. 15–19
[Kigawa u. a. 2002]
K IGAWA, Takanori ; YAMAGUCHI -N UNOKAWA, Emi ; KODAMA, Koichiro ; M ATSUDA,
Takayoshi ; YABUKI, Takashi ; M ATSUDA, Natsuko ; I SHITANI, Ryuichiro ; N UREKI, Osamu ; YOKOYAMA,
80
Shigeyuki: Selenomethionine incorporation into a protein by cell-free synthesis. In: Journal of structural and functional genomics 2 (2002), Nr. 1, S. 29–35
[Kigawa und Yokoyama 1991]
K IGAWA, Takanori ; YOKOYAMA, Shigeyuki:
A continuous cell-free
protein synthesis system for coupled transcription-translation. In: Journal of biochemistry 110 (1991),
Nr. 2, S. 166–168
[Kim und Choi 1996]
K IM, Dong-Myung ; C HOI, Cha-Yong: A semicontinuous prokaryotic coupled
transcription/translation system using a dialysis membrane. In: Biotechnology progress 12 (1996),
Nr. 5, S. 645–649
[Kim und Swartz 2001]
K IM, Dong-Myung ; S WARTZ, James R.: Regeneration of adenosine triphos-
phate from glycolytic intermediates for cell-free protein synthesis. In: Biotechnology and bioengineering 74 (2001), Nr. 4, S. 309–316
[Kim und Swartz 2004]
K IM, Dong-Myung ; S WARTZ, James R.: Efficient production of a bioactive,
multiple disulfide-bonded protein using modified extracts of Escherichia coli. In: Biotechnology and
bioengineering 85 (2004), Nr. 2, S. 122–129
[Kim und Kim 2009]
K IM, Ho-Cheol ; K IM, Dong-Myung: Methods for energizing cell-free protein
synthesis. In: Journal of bioscience and bioengineering 108 (2009), Nr. 1, S. 1–4
[Kim u. a. 2011]
K IM, Ho-Cheol ; K IM, Tae-Wan ; K IM, Dong-Myung: Prolonged production of pro-
teins in a cell-free protein synthesis system using polymeric carbohydrates as an energy source. In:
Process Biochemistry 46 (2011), Nr. 6, S. 1366–1369
[Kim und Winfree 2011]
K IM, Jongmin ; W INFREE, Erik: Synthetic in vitro transcriptional oscillators.
In: Molecular systems biology 7 (2011), Nr. 1, S. 465
[Kim und Choi 2000]
K IM, RG ; C HOI, CY: Expression-independent consumption of substrates in
cell-free expression system from Escherichia coli. In: Journal of biotechnology 84 (2000), Nr. 1,
S. 27–32
[Kim u. a. 2006]
K IM, Tae-Wan ; K EUM, Jung-Won ; O H, In-Seok ; C HOI, Cha-Yong ; PARK, Chang-
Gil ; K IM, Dong-Myung: Simple procedures for the construction of a robust and cost-effective cell-free
protein synthesis system. In: Journal of biotechnology 126 (2006), Nr. 4, S. 554–561
[Kim u. a. 2008]
K IM, Tae-Wan ; K IM, Ho-Cheol ; O H, In-Seok ; K IM, Dong-Myung: A highly effi-
cient and economical cell-free protein synthesis system using the S12 extract of Escherichia coli. In:
Biotechnology and Bioprocess Engineering 13 (2008), Nr. 4, S. 464–469
[Kim u. a. 2007]
K IM, Tae-Wan ; O H, In-Seok ; K EUM, Jung-Won ; K WON, Yong-Chan ; B YUN, Ju-
Young ; L EE, Kyung-Ho ; C HOI, Cha-Yong ; K IM, Dong-Myung: Prolonged cell-free protein synthesis
using dual energy sources: Combined use of creatine phosphate and glucose for the efficient supply
of ATP and retarded accumulation of phosphate. In: Biotechnology and bioengineering 97 (2007),
Nr. 6, S. 1510–1515
81
[Koomey und Falkow 1987]
KOOMEY, J M. ; FALKOW, STANLEY: Cloning of the recA gene of Neisseria
gonorrhoeae and construction of gonococcal recA mutants. In: Journal of bacteriology 169 (1987),
Nr. 2, S. 790–795
[Kumar und Chernaya 2009]
K UMAR, Gyanendra ; C HERNAYA, Galina: Cell-free protein synthesis
using multiply-primed rolling circle amplification products. In: Biotechniques 47 (2009), Nr. 1, S. 637
[Kuruma u. a. 2009]
K URUMA, Yutetsu ; S TANO, Pasquale ; U EDA, Takuya ; L UISI, Pier L.: A syn-
thetic biology approach to the construction of membrane proteins in semi-synthetic minimal cells. In:
Biochimica et Biophysica Acta (BBA)-Biomembranes 1788 (2009), Nr. 2, S. 567–574
[Kwok 2010]
K WOK, Roberta: Five hard truths for synthetic biology. In: Nature News 463 (2010),
Nr. 7279, S. 288–290
[Kwon und Jewett 2015]
K WON, Yong-Chan ; J EWETT, Michael C.:
High-throughput preparation
methods of crude extract for robust cell-free protein synthesis. In: Scientific reports 5 (2015)
[Lamla u. a. 2006]
L AMLA, T ; H OERER, S ; B AUER, MMT: Screening for soluble expression constructs
using cell-free protein synthesis. In: International journal of biological macromolecules 39 (2006),
Nr. 1, S. 111–121
[Lee u. a. 2012]
L EE, Ka-Young ; L EE, Kyung-Ho ; PARK, Ji-Woong ; K IM, Dong-Myung: Flexible
programming of cell-free protein synthesis using magnetic bead-immobilized plasmids. In: PloS one
7 (2012), Nr. 3, S. e34429
[Lian u. a. 2014]
L IAN, Qianqian ; C AO, Hongzhi ; WANG, Fengshan: The Cost-Efficiency Realization
in the Escherichia coli-Based Cell-Free Protein Synthesis Systems. In: Applied biochemistry and
biotechnology 174 (2014), Nr. 7, S. 2351–2367
[Liese u. a. 2006]
L IESE, Andreas ; S EELBACH, Karsten ; WANDREY, Christian: Industrial biotransfor-
mations. John Wiley & Sons, 2006
[Ling u. a. 2009]
L ING, Jiqiang ; R EYNOLDS, Noah ; I BBA, Michael: Aminoacyl-tRNA synthesis and
translational quality control. In: Annual review of microbiology 63 (2009), S. 61–78
[Liu u. a. 2005]
L IU, David V. ; Z AWADA, James F. ; S WARTZ, James R.: Streamlining Escherichia Coli
S30 Extract Preparation for Economical Cell-Free Protein Synthesis. In: Biotechnology progress 21
(2005), Nr. 2, S. 460–465
[Lyukmanova u. a. 2012]
LYUKMANOVA, EN ; S HENKAREV, ZO ; K HABIBULLINA, NF ; KOPEINA, GS ;
S HULEPKO, MA ; PARAMONOV, AS ; M INEEV, KS ; T IKHONOV, RV ; S HINGAROVA, LN ; P ETROVSKAYA,
LE u. a.: Lipid–protein nanodiscs for cell-free production of integral membrane proteins in a soluble
and folded state: comparison with detergent micelles, bicelles and liposomes. In: Biochimica et
Biophysica Acta (BBA)-Biomembranes 1818 (2012), Nr. 3, S. 349–358
82
[Madin u. a. 2000]
M ADIN, Kairat ; S AWASAKI, Tatsuya ; O GASAWARA, Tomio ; E NDO, Yaeta:
A
highly efficient and robust cell-free protein synthesis system prepared from wheat embryos: plants
apparently contain a suicide system directed at ribosomes. In: Proceedings of the National Academy
of Sciences 97 (2000), Nr. 2, S. 559–564
[Masek u. a. 2005]
M ASEK, Tomas ; VOPALENSKY, Vaclav ; S UCHOMELOVA, Petra ; P OSPISEK, Martin:
Denaturing RNA electrophoresis in TAE agarose gels. In: Analytical biochemistry 336 (2005), Nr. 1,
S. 46–50
[Matsumoto u. a. 2008]
M ATSUMOTO, Keisuke ; TOMIKAWA, Chie ; TOYOOKA, Takashi ; O CHI, Anna ;
TAKANO, Yoshitaka ; TAKAYANAGI, Naoyuki ; A BE, Masato ; E NDO, Yaeta ; H ORI, Hiroyuki: Production of yeast tRNA (m 7 G46) methyltransferase (Trm8–Trm82 complex) in a wheat germ cell-free
translation system. In: Journal of biotechnology 133 (2008), Nr. 4, S. 453–460
[Mie u. a. 2008]
M IE, Masayasu ; S HIMIZU, Shun ; TAKAHASHI, Fumio ; KOBATAKE, Eiry: Selection of
mRNA 5?-untranslated region sequence with high translation efficiency through ribosome display. In:
Biochemical and biophysical research communications 373 (2008), Nr. 1, S. 48–52
[Mikami u. a. 2008]
M IKAMI, Satoshi ; KOBAYASHI, Tominari ; M ASUTANI, Mamiko ; YOKOYAMA,
Shigeyuki ; I MATAKA, Hiroaki: A human cell-derived in vitro coupled transcription/translation system
optimized for production of recombinant proteins. In: Protein expression and purification 62 (2008),
Nr. 2, S. 190–198
[Mikami u. a. 2006]
M IKAMI, Satoshi ; KOBAYASHI, Tominari ; YOKOYAMA, Shigeyuki ; I MATAKA, Hiroaki:
A hybridoma-based in vitro translation system that efficiently synthesizes glycoproteins. In: Journal of
biotechnology 127 (2006), Nr. 1, S. 65–78
[Moulijn u. a. 2013]
M OULIJN, Jacob A. ; M AKKEE, Michiel ; VAN D IEPEN, Annelies E.: Chemical
process technology. John Wiley & Sons, 2013
[Mulligan und Dunn 2008]
M ULLIGAN, Elizabeth A. ; D UNN, John J.: Cloning, purification and initial
characterization of E. coli McrA, a putative 5-methylcytosine-specific nuclease. In: Protein expression
and purification 62 (2008), Nr. 1, S. 98–103
[Mureev u. a. 2009]
M UREEV, Sergei ; KOVTUN, Oleksiy ; N GUYEN, Uyen T. ; A LEXANDROV, Kirill:
Species-independent translational leaders facilitate cell-free expression. In: Nature biotechnology 27
(2009), Nr. 8, S. 747–752
[Murphy u. a. 2011]
M URPHY, Patrick J. ; S TONE, Orrin J. ; A NDERSON, Michelle E.:
Automated
hydrophobic interaction chromatography column selection for use in protein purification. In: Journal
of visualized experiments: JoVE (2011), Nr. 55
[Murtas 2009]
M URTAS, Giovanni: Artificial assembly of a minimal cell. In: Molecular BioSystems 5
(2009), Nr. 11, S. 1292–1297
83
[Nakamura und Whited 2003]
N AKAMURA, Charles E. ; W HITED, Gregory M.: Metabolic engineering
for the microbial production of 1, 3-propanediol. In: Current opinion in biotechnology 14 (2003), Nr. 5,
S. 454–459
[Nielsen u. a. 2013]
N IELSEN, Jens ; L ARSSON, Christer ; M ARIS, Antonius van ; P RONK, Jack:
Metabolic engineering of yeast for production of fuels and chemicals. In: Current opinion in biotechnology 24 (2013), Nr. 3, S. 398–404
[Nirenberg 2004]
N IRENBERG, Marshall: Historical review: Deciphering the genetic code–a personal
account. In: Trends in biochemical sciences 29 (2004), Nr. 1, S. 46–54
[Nirenberg 1963]
N IRENBERG, Marshall W.: Cell-free protein synthesis directed by messenger RNA.
In: Methods in enzymology 6 (1963), S. 17–23
[Noireaux u. a. 2003]
N OIREAUX, Vincent ; B AR -Z IV, Roy ; L IBCHABER, Albert: Principles of cell-free
genetic circuit assembly. In: Proceedings of the National Academy of Sciences 100 (2003), Nr. 22,
S. 12672–12677
[Paddon u. a. 2013]
PADDON, CJ ; W ESTFALL, PJ ; P ITERA, DJ ; B ENJAMIN, K ; F ISHER, K ; M C P HEE,
D ; L EAVELL, MD ; TAI, A ; M AIN, A ; E NG, D u. a.: High-level semi-synthetic production of the potent
antimalarial artemisinin. In: Nature 496 (2013), Nr. 7446, S. 528–532
[Patel und Swartz 2011]
PATEL, Kedar G. ; S WARTZ, James R.: Surface functionalization of virus-like
particles by direct conjugation using azide- alkyne click chemistry. In: Bioconjugate chemistry 22
(2011), Nr. 3, S. 376–387
[Pratt 1984]
P RATT, JM: Coupled transcription-translation in prokaryotic cell-free systems. In: Tran-
scription and translation: a practical approach (1984), S. 179–209
[Prazeres u. a. 1999]
P RAZERES, Duarte M. ; F ERREIRA, Guilherme N. ; M ONTEIRO, Gabriel A. ;
C OONEY, Charles L. ; C ABRAL, Joaquim M.: Large-scale production of pharmaceutical-grade plasmid
DNA for gene therapy: problems and bottlenecks. In: Trends in biotechnology 17 (1999), Nr. 4,
S. 169–174
[Proverbio u. a. 2014]
HARD ,
P ROVERBIO, Davide ; H ENRICH, Erik ; O RB ÁN, Erika ; D ÖTSCH, Volker ; B ERN -
Frank: Membrane Protein Quality Control in Cell-Free Expression Systems: Tools, Strategies
and Case Studies. In: Membrane Proteins Production for Structural Analysis. Springer, 2014, S. 45–
70
[Quin und Schmidt-Dannert 2011]
Q UIN, Maureen B. ; S CHMIDT-DANNERT, Claudia: Engineering of
biocatalysts: from evolution to creation. In: ACS catalysis 1 (2011), Nr. 9, S. 1017–1021
[Ramachandran u. a. 2004]
R AMACHANDRAN, Niroshan ; H AINSWORTH, Eugenie ; B HULLAR, Bhupin-
der ; E ISENSTEIN, Samuel ; R OSEN, Benjamin ; L AU, Albert Y. ; WALTER, Johannes C. ; L A B AER,
Joshua: Self-assembling protein microarrays. In: Science 305 (2004), Nr. 5680, S. 86–90
84
[van Rantwijk und Sheldon 2007]
R ANTWIJK, Fred van ; S HELDON, Roger A.: Biocatalysis in ionic
liquids. In: Chemical reviews 107 (2007), Nr. 6, S. 2757–2785
[Record u. a. 1998]
R ECORD, M T. ; C OURTENAY, Elizabeth S. ; C AYLEY, Scott ; G UTTMAN, Harry J.:
Biophysical compensation mechanisms buffering E. coli protein–nucleic acid interactions against
changing environments. In: Trends in biochemical sciences 23 (1998), Nr. 5, S. 190–194
[Roberts und Szostak 1997]
R OBERTS, Richard W. ; S ZOSTAK, Jack W.: RNA-peptide fusions for the
in vitro selection of peptides and proteins. In: Proceedings of the National Academy of Sciences 94
(1997), Nr. 23, S. 12297–12302
[Roest u. a. 1993]
R OEST, Pauline A. ; R OBERTS, Roland G. ; S UGINO, Shigeto ; O MMEN, Gert-Jan B.
van ; D UNNEN, Johan T. den: Protein truncation test (PTT) for rapid detection of translation-terminating
mutations. In: Human molecular genetics 2 (1993), Nr. 10, S. 1719–1721
[Rosenblum u. a. 2012]
R OSENBLUM, Gabriel ; C HEN, Chunlai ; K AUR, Jaskiran ; C UI, Xiaonan ;
G OLDMAN, Yale E. ; C OOPERMAN, Barry S.:
Real-time assay for testing components of protein
synthesis. In: Nucleic acids research 40 (2012), Nr. 12, S. e88–e88
[Rosenblum und Cooperman 2014]
R OSENBLUM, Gabriel ; C OOPERMAN, Barry S.: Engine out of the
chassis: Cell-free protein synthesis and its uses. In: FEBS letters 588 (2014), Nr. 2, S. 261–268
[Rothe u. a. 2006]
R OTHE, Achim ; H OSSE, Ralf J. ; P OWER, Barbara E.: In vitro display technologies
reveal novel biopharmaceutics. In: The FASEB journal 20 (2006), Nr. 10, S. 1599–1610
[Rothengass 2007]
R OTHENGASS, Barbara E.: Advocating for the quadravalent HPV vaccination,
Gardasil, by Merck. In: International journal of pediatric otorhinolaryngology 71 (2007), Nr. 4, S. 671–
672
[Sasaki u. a. 2011]
S ASAKI, Yoshihiro ; A SAYAMA, Wakiko ; N IWA, Tatsuya ; S AWADA, Shin-ichi ; U EDA,
Takuya ; TAGUCHI, Hideki ; A KIYOSHI, Kazunari: Amphiphilic Polysaccharide Nanogels as Artificial
Chaperones in Cell-Free Protein Synthesis. In: Macromolecular bioscience 11 (2011), Nr. 6, S. 814–
820
[Sawasaki u. a. 2002a]
MURA ,
S AWASAKI, Tatsuya ; H ASEGAWA, Yoshinori ; T SUCHIMOCHI, Masateru ; K A -
Nami ; O GASAWARA, Tomio ; K UROITA, Toshihiro ; E NDO, Yaeta: A bilayer cell-free protein
synthesis system for high-throughput screening of gene products. In: FEBS letters 514 (2002), Nr. 1,
S. 102–105
[Sawasaki u. a. 2002b]
S AWASAKI, Tatsuya ; O GASAWARA, Tomio ; M ORISHITA, Ryo ; E NDO, Yaeta:
A cell-free protein synthesis system for high-throughput proteomics. In: Proceedings of the National
Academy of Sciences 99 (2002), Nr. 23, S. 14652–14657
[Schleef 2008]
S CHLEEF, Martin: Plasmids for therapy and vaccination. John Wiley & Sons, 2008
85
[Schneider u. a. 2010]
S CHNEIDER, Birgit ; J UNGE, Friederike ; S HIROKOV, Vladimir A. ; D URST,
Florian ; S CHWARZ, Daniel ; D ÖTSCH, Volker ; B ERNHARD, Frank: Membrane protein expression in
cell-free systems. In: Heterologous Expression of Membrane Proteins. Springer, 2010, S. 165–186
[Schwarz u. a. 2008]
S CHWARZ, Daniel ; D ÖTSCH, Volker ; B ERNHARD, Frank: Production of mem-
brane proteins using cell-free expression systems. In: Proteomics 8 (2008), Nr. 19, S. 3933–3946
[Scism und Bachmann 2010]
S CISM, Robert A. ; B ACHMANN, Brian O.: Five-component cascade
synthesis of nucleotide analogues in an engineered self-immobilized enzyme aggregate. In: ChemBioChem 11 (2010), Nr. 1, S. 67–70
[Shimizu u. a. 2001]
GAWA ,
S HIMIZU, Yoshihiro ; I NOUE, Akio ; TOMARI, Yukihide ; S UZUKI, Tsutomu ; YOKO -
Takashi ; N ISHIKAWA, Kazuya ; U EDA, Takuya: Cell-free translation reconstituted with purified
components. In: Nature biotechnology 19 (2001), Nr. 8, S. 751–755
[Shimizu und Ueda 2010]
S HIMIZU, Yoshihiro ; U EDA, Takuya: PURE technology. In: Cell-Free Protein
Production. Springer, 2010, S. 11–21
[Shrestha u. a. 2012]
S HRESTHA, Prashanta ; M ICHAELE H OLLAND, Troy ; C HARLES B UNDY, Bradley:
Streamlined extract preparation for Escherichia coli-based cell-free protein synthesis by sonication or
bead vortex mixing. In: Biotechniques 53 (2012), Nr. 3, S. 163
[Shrestha u. a. 2014]
S HRESTHA, Prashanta ; S MITH, Mark T. ; B UNDY, Bradley C.: Cell-free unnatural
amino acid incorporation with alternative energy systems and linear expression templates. In: New
biotechnology 31 (2014), Nr. 1, S. 28–34
[Sousa und Mukherjee 2003]
S OUSA, Rui ; M UKHERJEE, Srabani: T7 RNA polymerase. In: Progress
in nucleic acid research and molecular biology 73 (2003), S. 1–41
[Spirin 2004]
S PIRIN, Alexander S.: High-throughput cell-free systems for synthesis of functionally
active proteins. In: Trends in biotechnology 22 (2004), Nr. 10, S. 538–545
[Spirin u. a. 1988]
S PIRIN, Alexander S. ; B ARANOV, Vladimir I. ; RYABOVA, Lubov A. ; OVODOV,
Sergey Y. ; A LAKHOV, Yuly B.: A continuous cell-free translation system capable of producing polypeptides in high yield. In: Science 242 (1988), Nr. 4882, S. 1162–1164
[Sun u. a. 2013]
S UN, Zachary Z. ; H AYES, Clarmyra A. ; S HIN, Jonghyeon ; C ASCHERA, Filippo ;
M URRAY, Richard M. ; N OIREAUX, Vincent: Protocols for implementing an Escherichia coli based
TX-TL cell-free expression system for synthetic biology. In: Journal of visualized experiments: JoVE
(2013), Nr. 79
[Swartz 2012]
S WARTZ, James R.: Transforming biochemical engineering with cell-free biology. In:
AIChE Journal 58 (2012), Nr. 1, S. 5–13
[Swartz 2006]
S WARTZ, Jim: Developing cell-free biology for industrial applications. In: Journal of
Industrial Microbiology and Biotechnology 33 (2006), Nr. 7, S. 476–485
86
[Takai u. a. 2008]
TAKAI, Kazuyuki ; S AWASAKI, Tatsuya ; E NDO, Yaeta: Development of key tech-
nologies for high-throughput cell-free protein production with the extract from wheat embryos. In:
Advances in protein chemistry and structural biology 75 (2008), S. 53–84
[Tarui u. a. 2001]
TARUI, Hiroshi ; M URATA, Masahiro ; TANI, Ikuko ; I MANISHI, Shigeo ; N ISHIKAWA,
Shigemichi ; H ARA, Toshio: Establishment and characterization of cell-free translation/glycosylation
in insect cell (Spodoptera frugiperda 21) extract prepared with high pressure treatment. In: Applied
microbiology and biotechnology 55 (2001), Nr. 4, S. 446–453
[Taylor u. a. 1993]
TAYLOR, Robin G. ; WALKER, David C. ; M C I NNES, RR: E. coli host strains signif-
icantly affect the quality of small scale plasmid DNA preparations used for sequencing. In: Nucleic
acids research 21 (1993), Nr. 7, S. 1677
[Torizawa u. a. 2004]
TORIZAWA, Takuya ; S HIMIZU, Masato ; TAOKA, Masato ; M IYANO, Hiroshi ;
K AINOSHO, Masatsune: Efficient production of isotopically labeled proteins by cell-free synthesis: a
practical protocol. In: Journal of biomolecular NMR 30 (2004), Nr. 3, S. 311–325
[Trindade u. a. 2005]
T RINDADE, Inês P ; D IOGO, Maria M. ; P RAZERES, Duarte M. ; M ARCOS, Joã.:
Purification of plasmid DNA vectors by aqueous two-phase extraction and hydrophobic interaction
chromatography. In: Journal of Chromatography A 1082 (2005), Nr. 2, S. 176–184
[Tsuboi u. a. 2008]
MOCHI ,
T SUBOI, Takafumi ; TAKEO, Satoru ; I RIKO, Hideyuki ; J IN, Ling ; T SUCHI -
Masateru ; M ATSUDA, Shusaku ; H AN, Eun-Taek ; OTSUKI, Hitoshi ; K ANEKO, Osamu ; S AT-
TABONGKOT ,
Jetsumon u. a.: Wheat germ cell-free system-based production of malaria proteins for
discovery of novel vaccine candidates. In: Infection and immunity 76 (2008), Nr. 4, S. 1702–1708
[Vinograd u. a. 1966]
V INOGRAD, Jerome u. a.: Physical and topological properties of circular DNA.
In: The Journal of general physiology 49 (1966), Nr. 6, S. 103–125
[Voloshin und Swartz 2005]
VOLOSHIN, Alexei M. ; S WARTZ, James R.: Efficient and scalable method
for scaling up cell free protein synthesis in batch mode. In: Biotechnology and bioengineering 91
(2005), Nr. 4, S. 516–521
[Walter und Blobel 1983]
WALTER, Peter ; B LOBEL, Günter: Preparation of microsomal membranes
for cotranslational protein translocation. In: Methods in enzymology 96 (1983), S. 84–93
[Wang u. a. 2009]
WANG, Harris H. ; I SAACS, Farren J. ; C ARR, Peter A. ; S UN, Zachary Z. ; X U,
George ; F OREST, Craig R. ; C HURCH, George M.: Programming cells by multiplex genome engineering and accelerated evolution. In: Nature 460 (2009), Nr. 7257, S. 894–898
[Wang u. a. 2008]
WANG, Xiao ; L IU, Juan ; Z HENG, Yan ; L I, Jing ; WANG, Hong ; Z HOU, Yabin ;
Q I, Mei ; Y U, Han ; TANG, Wei ; Z HAO, Wei M.: An optimized yeast cell-free system: sufficient for
translation of human papillomavirus 58 L1 mRNA and assembly of virus-like particles. In: Journal of
bioscience and bioengineering 106 (2008), Nr. 1, S. 8–15
87
[Wang und Zhang 2009]
WANG, Yiran ; Z HANG, YH P.:
Cell-free protein synthesis energized by
slowly-metabolized maltodextrin. In: BMC biotechnology 9 (2009), Nr. 1, S. 58
[Watts und Forster 2012]
WATTS, R E. ; F ORSTER, Anthony C.: Update on pure translation display
with unnatural amino acid incorporation. In: Ribosome Display and Related Technologies. Springer,
2012, S. 349–365
[Weber u. a. 1975]
W EBER, LA ; F EMAN, ER ; B AGLIONI, C: Cell free system from HeLa cells active
in initiation of protein synthesis. In: Biochemistry 14 (1975), Nr. 24, S. 5315–5321
[Welsh u. a. 2011]
W ELSH, John P. ; B ONOMO, Jeanne ; S WARTZ, James R.: Localization of BiP
to translating ribosomes increases soluble accumulation of secreted eukaryotic proteins in an Escherichia coli cell-free system. In: Biotechnology and bioengineering 108 (2011), Nr. 8, S. 1739–1748
[Whittaker 2013]
W HITTAKER, James W.: Cell-free protein synthesis: the state of the art. In: Biotech-
nology letters 35 (2013), Nr. 2, S. 143–152
[Winnick u. a. 1950]
W INNICK, Theodore u. a.: Studies on the mechanism of protein, synthesis in
embryonic and tumor tissues. 1. Evidence relating to the incorporation of labeled amino acids into
protein structure in homogenates. In: Arch. Biochem. 27 (1950)
[Xu u. a. 2002]
X U, Lihui ; A HA, Patti ; G U, Ke ; K UIMELIS, Robert G. ; K URZ, Markus ; L AM, Terence ;
L IM, Ai C. ; L IU, Hongxiang ; L OHSE, Peter A. ; S UN, Lin u. a.: Directed evolution of high-affinity
antibody mimics using mRNA display. In: Chemistry & biology 9 (2002), Nr. 8, S. 933–942
[Yamamoto u. a. 1999]
YAMAMOTO, Yuichi ; S UGIMOTO, Shunjiro ; S HEN, Xin-chun ; N AGAMUNE,
Teruyuki ; YAO, Shui-liang ; S UZUKI, Eiji: In-place condensation of reaction mixture using hollow fiber
membrane reactors improved productivity of cell-free protein synthesis. In: Biochemical engineering
journal 3 (1999), Nr. 2, S. 151–155
[Yang u. a. 2012]
YANG, William C. ; PATEL, Kedar G. ; W ONG, H E. ; S WARTZ, James R.: Simplifying
and streamlining Escherichia coli-based cell-free protein synthesis. In: Biotechnology progress 28
(2012), Nr. 2, S. 413–420
[Yin und Swartz 2004]
Y IN, Gang ; S WARTZ, James R.: Enhancing multiple disulfide bonded protein
folding in a cell-free system. In: Biotechnology and bioengineering 86 (2004), Nr. 2, S. 188–195
[Zawada und Swartz 2006]
Z AWADA, James ; S WARTZ, James: Effects of growth rate on cell extract
performance in cell-free protein synthesis. In: Biotechnology and bioengineering 94 (2006), Nr. 4,
S. 618–624
[Zawada 2012]
Z AWADA, James F.: Preparation and testing of E. coli S30 in vitro transcription trans-
lation extracts. In: Ribosome Display and Related Technologies. Springer, 2012, S. 31–41
[Zawada u. a. 2011]
Z AWADA, James F. ; Y IN, Gang ; S TEINER, Alexander R. ; YANG, Junhao ;
N ARESH, Alpana ; R OY, Sushmita M. ; G OLD, Daniel S. ; H EINSOHN, Henry G. ; M URRAY, Christopher J.: Microscale to manufacturing scale-up of cell-free cytokine production– new approach for
88
shortening protein production development timelines. In: Biotechnology and bioengineering 108
(2011), Nr. 7, S. 1570–1578
[Zhang u. a. 2005]
Z HANG, Kechun ; D IEHL, Michael R. ; T IRRELL, David A.: Artificial polypeptide
scaffold for protein immobilization. In: Journal of the American Chemical Society 127 (2005), Nr. 29,
S. 10136–10137
[Zhu u. a. 2005]
Z HU, Kaichun ; J IN, Huali ; M A, Yijie ; R EN, Zhihui ; X IAO, Chong ; H E, Zhonghuai ;
Z HANG, Fuchun ; Z HU, Qinghong ; WANG, Bin: A continuous thermal lysis procedure for the largescale preparation of plasmid DNA. In: Journal of biotechnology 118 (2005), Nr. 3, S. 257–264
[Zichel u. a. 2010]
Z ICHEL, R ; M IMRAN, A ; K EREN, A ; B ARNEA, A ; S TEINBERGER -L EVY, I ; M ARCUS,
D ; T URGEMAN, A ; R EUVENY, S: Efficacy of a potential trivalent vaccine based on Hc fragments of
botulinum toxins A, B, and E produced in a cell-free expression system. In: Clinical and Vaccine
Immunology 17 (2010), Nr. 5, S. 784–792
[Zubay 1962]
Z UBAY, G: The isolation and fractionation of soluble ribonucleic acid. In: Journal of
Molecular Biology 4 (1962), Nr. 5, S. 347–356
[Zubay 1973]
Z UBAY, Geoffrey: In vitro synthesis of protein in microbial systems. In: Annual review of
genetics 7 (1973), Nr. 1, S. 267–287
89
90