* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download RNA base pairing Worksheet
Genetic code wikipedia , lookup
Biochemistry wikipedia , lookup
Molecular evolution wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Messenger RNA wikipedia , lookup
Promoter (genetics) wikipedia , lookup
List of types of proteins wikipedia , lookup
Holliday junction wikipedia , lookup
Non-coding DNA wikipedia , lookup
RNA interference wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Polyadenylation wikipedia , lookup
Biosynthesis wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Epitranscriptome wikipedia , lookup
Gene expression wikipedia , lookup
RNA silencing wikipedia , lookup
Non-coding RNA wikipedia , lookup
Name ____________________________________________pd.____________ Date ______________ RNA Base Pairing Worksheet When a cell makes RNA from a DNA molecule: 1. DNA is unzipped. 2. The complementary RNA bases are added to one template strand. 3. The new RNA strand released. When a cell creates RNA (transcription), the original DNA ladder is broken apart and new RNA nucleotides are added to one of the strands (template strand). This creates a single stranded RNA molecule. • • • RNA polymerase (the enzyme which builds RNA) will only attach bases which match with the original strand of DNA. In translation, Adenine bonds to Uracil, Thymine bonds to Adenine, Cytosine and Guanine will bond with each other. When creating the matching strand, the following pairing rules must be used: A? U T? A C? G Directions: Use the base pairing rules above to figure out the sequence of the new strand of RNA for the original DNA (template) strands below. 1. AACGTACGATCGATGCACATGCATGGCTACGC 2. CCCGGGTATGCATGTACGTACGTCGTATATCG 3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT 4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG 5. CCGCTTTCGCTATTATAAAAAGGGCTATAACTA