Download RNA base pairing Worksheet

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

MicroRNA wikipedia , lookup

SR protein wikipedia , lookup

Genetic code wikipedia , lookup

Biochemistry wikipedia , lookup

Molecular evolution wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Molecular cloning wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Messenger RNA wikipedia , lookup

Promoter (genetics) wikipedia , lookup

List of types of proteins wikipedia , lookup

Holliday junction wikipedia , lookup

Non-coding DNA wikipedia , lookup

RNA interference wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Silencer (genetics) wikipedia , lookup

Transcriptional regulation wikipedia , lookup

Polyadenylation wikipedia , lookup

Biosynthesis wikipedia , lookup

RNA polymerase II holoenzyme wikipedia , lookup

Eukaryotic transcription wikipedia , lookup

Epitranscriptome wikipedia , lookup

Replisome wikipedia , lookup

Gene expression wikipedia , lookup

RNA-Seq wikipedia , lookup

RNA silencing wikipedia , lookup

Non-coding RNA wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Transcript
Name ____________________________________________pd.____________ Date ______________
RNA Base Pairing Worksheet
When a cell makes RNA from a DNA molecule:
1. DNA is unzipped.
2. The complementary RNA bases are added to one template strand.
3. The new RNA strand released.
When a cell creates RNA (transcription), the original DNA ladder is broken apart and new RNA
nucleotides are added to one of the strands (template strand). This creates a single stranded RNA
molecule.
•
•
•
RNA polymerase (the enzyme which builds RNA) will only attach bases which match with the
original strand of DNA.
In translation, Adenine bonds to Uracil, Thymine bonds to Adenine, Cytosine and Guanine
will bond with each other.
When creating the matching strand, the following pairing rules must be used:
A? U
T? A
C? G
Directions: Use the base pairing rules above to figure out the sequence of the new strand of RNA for the
original DNA (template) strands below.
1. AACGTACGATCGATGCACATGCATGGCTACGC
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
5. CCGCTTTCGCTATTATAAAAAGGGCTATAACTA