* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Primary structure of a soluble matrix protein of scallop shell
Ribosomally synthesized and post-translationally modified peptides wikipedia , lookup
Evolution of metal ions in biological systems wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Expression vector wikipedia , lookup
G protein–coupled receptor wikipedia , lookup
Gene expression wikipedia , lookup
Ancestral sequence reconstruction wikipedia , lookup
Signal transduction wikipedia , lookup
Matrix-assisted laser desorption/ionization wikipedia , lookup
Magnesium transporter wikipedia , lookup
Point mutation wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Nuclear magnetic resonance spectroscopy of proteins wikipedia , lookup
Interactome wikipedia , lookup
Protein purification wikipedia , lookup
Genetic code wikipedia , lookup
Biosynthesis wikipedia , lookup
Metalloprotein wikipedia , lookup
Western blot wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Biochemistry wikipedia , lookup
AmericanMineralogist,Volume 83,pages 1510-1515, 1998 Primary structure of a solublematrix protein of scallopshell: Implications for calcium carbonatebiomineralization I. SlnasurNA ANDK. ENoox GeologicalInstitute,Universityof Tokyo, Tokyo I l3-0033, Japan Ansrnacr Soluble proteins in the scallop (Patinopectenyessoensis)foliated calcite shell layer were characterizedusing biochemical and molecular biological techniques.SDS PAGE of these molecules revealed three major protein bands, 97 kD, 12 kD, and 49 kD in molecular weight, when stained with Coomassie Brilliant Blue. Periodic Acid Schiff staining and Stains-All staining indicated that these proteins are slightly glycosylated and may have cation-binding potential. N-terminal sequencingof the three proteins revealedthat all three sharethe same amino acid sequenceat least for the first 20 residues.A partial amino acid sequenceof 436 amino acids of one of these proteins (MSP-l) was deduced by characterization of the complementary DNA encoding the protein. The deduced sequenceis composed of a high proporton of Ser (3l%o), Gly (25Vo),and Asp (20Vo),typifying an acidic glycoprotein of mineralized tissues. The protein has a basic domain near the Nterminus and two highly conserved Asp-rich domains interspersedin three Ser and Glyrich regions. In contrast with prevalent expectations,(Asp-Gly)n-, (Asp-Ser)n-, and (AspGly-X-Gly-X-Gly)ntype sequencemotifs do not exist in the Asp-rich domains,demanding revision of previous theories of protein-mineral interactions. INrnooucrroN Minerals produced by organisms often have crystal shapesclearly different from those formed inorganically. Most such biominerals are a compositeof inorganic crystals and organic molecules such as lipids, polysaccharides, and proteins, collectively known as the organic matrix. It is generally postulated that the elaborate fabrication of biominerals arisesfrom specific molecular interactions at inorganic-organic interfaces (Mann et al. 1993), and that the organic matrix representsmany of the important molecules involved in the interactionscontrolling crystal growth (e.g., Watabeand Wilbur 1960; Lowenstam 1981; Weiner 1984; Lowenstam and Weiner 1989). Calcium carbonate is one of the most common biominerals, and its matrix molecules, especially of molluscan shells, have been studied to a considerableextent to unveil their roles in the mineralizationprocesses.The maffix molecules have been classif,ed conventionally into two types based on their solubility in aqueoussolutions: the insoluble matrix is thought to be largely intercrystalline (Krampitz 1982) and provides a framework where mineralization is to occur, whereas the soluble matrix is known as intracrystalline or located on the intercrystalline matrix surfaces,but its functions are still poorly understood (Addadi and Weiner 1997). Advocated functions of the mainly proteinaceous,soluble matrix of the molluscan shell in particular, include: * E-mail: endo @geol.s.u-tokyo.acjp 0003-004x/98/1 112-15l0$05.00 (l) induction of oriented nucleation(Weiner 1975;Weiner and Addadi l99l); (2) inhibition of crystal growth (Wheeler et al. 1981; Wheeler 1992); (3) control of aragonite-calcite polymorphism (Falini et al. 1996; Belcher et al. 1996); and (4) enhancementof mechanical properties of the crystals (Berman et al. 1988; Berman et al. 1990). Most of the evidence to support these hypotheses has been obtained through in vitro experiments. The weaknessof these studies is that unpurified proteins or protein fractions of dubious homogeneity have been applied in the biochemical analysesand in the in vitro mineralization experiments, and that the stereochemicalrelationships between the organic and inorganic phases have been presumed without precise information of the fine structuresof the proteins. To understandthe underlying mechanismsof the protein-mineral interactions,it seemsessentialfirst of all to know the primary structure of the proteins involved. However, only a limited number of amino acid sequences have been determined so far for the calcium carbonate matrix proteins. The available sequencescomprise those from spicules of sea urchin emryo (Sucov et al. 1987; Katoh-Fukui etal. l99l; Katoh-Fukui etal.1992; Benson and Wilt 1992), from pearl oyster shell layers (Miyamoto et al. 1996; Sudo et al. 1997\, and from the nacre of a gastropod shell (Shen et al. 7997), in addition to partial sequencesfrom brachiopod shells (Cusack et al. 1992), an oyster shell (Wheeler 1992), and gastrolith of a crayfish (Ishii et al. 1996, Ishii et al. 1998). Here we present a partial amino acid sequenceof the molluscan shell pro- 1510 SARASHINA AND ENDO: MATRIX PROTEIN OF BIO-CALCITE l5lI tein MSP-I, a major soluble matrix protein of the scallop quired to design unique primers to facilitate subsequent foliated calcite shell layer, and discussits bearing on the amplification of the DNA sequenceencoding the entire functions of matrix proteins in calcium carbonate proteln. biomineralization. We extracted the total RNA from the mantle tissue of a single specimenof P. yessoensis,using ISOGEN (NipMlrBnrlr,s AND METHoDS pon Gene) and the single-stepmethod for RNA isolation Isolation of MSP-I (Chomzynski 1993). The RNA (5 pg) was applied as a for reversetranscription to preparecomplementemplate Specimens of the commercial scallop Patinopecten yessoensiswere purchasedlocally. A single shell valve tary DNA (cDNA) in a 20-p,L reaction, primed with a was thoroughly cleaned mechanically and incubated for "hybrid" primer, TCGAATTCGGATCC-GAGCTC(T ),,, 48 h at room temperaturein a l0 volVosolution of sodium using the SuperScriptpreamplification system(Life Techhypochlorite to desffoy surface contaminants.After thor- nologies). The target cDNA sequence,encoding the Nough washing with ultrapure water, the marginal portion terminal sequenceof 20 amino acid residuesdetermined of the shell, consisting only of the outer shell layer of for the purified MSP-I, was amplified by a method foliated calcite, was crushedto fine fragments.The matrix known as reverseffanscription-polymerasechain reaction proteins were extractedby dissolution of the shell flakes (RT-PCR).The senseprimer and the antisenseprimer cor(100 g) in 3 liters of 0.5 M EDTA (ethylenediaminete- responded to the sequence encoding LDTDKD and traacetate),pH 8. The extraction was performed at 4 'C NAAED (for one-letter abbrevation of amino acids, see with continuous stirring for 12 h. The preparation was the caption for Fig. 1), respectively, each being degenthen filtered through cheeseclothto remove viscous in- erate, containing oligonucleotidesof all the possible sesoluble materials and desaltedby ultrafiltration using the quencesfor each amino acid sequence.The reaction mixMinitan tangential flow system (Millipore). In this pro- ture (50 pL) contained2 pL cDNA, 2 p.M of eachprimer, cedure, the amount of EDTA was reduced to less than 1 x Taq DNA polymerasebuffer (Life Technologies),3 l0 6 mol, at which point the sample was concentratedto mM MgC,,,100 p,M dNTB and I unit of Taq DNA polymerase(TOYOBO). A Cetus DNA Thermal Cycler (Perabout 50 mL, then lyophilized. kin Elmer) was employed with an initial step of 94 "C SDS PAGE analyses for 3 min, then 30 cycles at 94 "C for 30 s, 52 "C for 30 The extracted macromolecules(1 mg per each well) s,72'C for I min, followed by a final extensionstepof '72 "C for 5 min. The resulting PCR products of 60 base were separatedby SDS PAGE (Laemmli 1970), using slab gels (15 x 15 cm) of 2 mm thickness containing pairs (bp) in length (correspondingto 20 amino acids), l27o polyacrylamide. After elecffophoresis, gels were were sequenceddirectly by the chain termination method stained by Coomassie Brilliant Blue R or silver (Silver using the BigDye Terminator Cycle SequencingKit and Stain kit; Bio-Rad) to visualize proteins, by Stains-All to an automated DNA sequencer (Perkin-Elmer Applied visualize cation-binding proteins (Campbell et al. 1983), Biosystems). and by periodic acid and Schiff's reagentto visualize carAmplffication and sequencingof cDNA 3'-end bohydrates(Holden et al. l97I). Threegene-specificsenseprimers,Pl,P2, and P3 (Fig. 1), designed based on the sequencedetermined by the N-terminal sequencedetermination above method, and the antisense"adaptor" primer (PA), Following separationby SDS PAGE, the proteins were TCGAATTCGGATCCGAGCTC, were synthesized for electroblotted onto polyvinylidene difluoride membrane the PCR amplification of the region between the point (ProBlott; ABI) in Caps buffer (10 mM, pH l l) contain- correspondingto the N-terminal end of the mature protein ing methanol (10 volTo solution), prior to staining with (MSP-l) and the 3'-end of the transcript(3' RACE: rapid Coomassie Brilliant Blue R. N-terminal amino acid se- amplification of cDNA ends protocol; Frohman 1990). quence analysis of the immobilized protein sampleswas The reactions using the primer pair of PI-PA were perby Edman degradation using an automated protein se- formed first, under conditions similar to those described quencer (Perkin-Elmer Applied Biosystems). Sequences above,except that the reactionswere catalyzedby Ex Taq were determined at least twice for each protein band re- (TAKARA) in this case. A second and a third round of produced by different SDS PAGE gels. PCR reactions were performed with the P2-PA and P3PA primer pairs, respectively,using the PCR products of RNA purification and RT-PCR the previous round of reactions as a template to verify A nucleotide sequencein mRNA (messengerribonu- specific amplification of the target cDNA fragment. PCR cleic acids) codes for the terminal amino acid sequence reactionswith only one primer (Pl,P2, P3, or PA) were found (as determined above) in P. yessoensisshell pro- included as negative controls. Unique PCR products were teins. The nucleotide sequenceis not uniquely determined digested with the restriction enzyme BamHI and subby the amino acid sequence,as up to six three-base cloned into the pUC 19 plasmid vector. The inserts engroups (codons) may code for the same amino acid. The compassingthe first 765 bp segmentof the PCR products actual sequenceencoding the terminal amino acids is re- were sequencedfor both sffands using the Ml3 forward t512 SARASHINA AND ENDO: MATRIX PROTEIN OF BIO.CALCITE D1 f, TTGATACTCATMCCMtr fACMTTTCATCTAGA]IqGEIIAEIASAIGgACC'CMCA LDTDKDLEFHLDSLLNAAED I 6O r20 GGGGDAAGAEEAAPAADLSG GGTAGCMGGAGGMGCMGGMGTAGCACMGMGTAGTMGGGAGGTAGTMGGGA GSKGGSKGSSTRSSKGGSKG 180 GGTAGTMGGGAGGCMTGGTGGTGGAGATGCTGATGATTCMGTAGCTCMGCGGTTCT GSKGGNGGGDADDSSSSSGS 240 GATTCGGGMGTTCTGGMGTGACGMGMTCAGATGATTCCAGCTCTAGTTCCAGTTCT DSGSSGSDEESDDSSSSSSS 300 GGTTCTGGTTCCGGCTCTGGCTCAGGTTCTGGCTCCGGCTCMGCTCCAGCTCTGGCTCA CSGSCSGSGSGSGSSSSSCS 36 0 TCCAGCGATMATCTGATGA SSDGSDDGSDDGSDSGDDAD 424 TGCTGAT TCCGCTMTGCTGATGACCTTGATTCCMTGATTCCGATGATTCCGATMCTCCGGTTCC 480 SANADDLDSNDSDDSDNSGS MTGGCGAGTCTGACTCTGA NGESDSDNSSSDDGDGSDSG 6OO SDSGNDSOSDDASNNDSDDS cATGAcrcGGATGATTcrrcrMrcArcrHrcurcu,@Nr D S D D S S N n Amino acid Asp Thr Ser Glu Pro Glv r|=N eso S D E S G P 120 GGYGGNGPAGNGGKGRKGGN _-BaEEI GGAGGAGGCMTGMGGCMTGGAGGCMTGGAGGTGAIEGAISIAGTTCTAGTTCGAGC'7 80 GGGNEGNGGNGGDGSSSSSS 840 SGSGSGSGSGSGSSSGSGSG CAGGTTCTGGGTCCGGCTCMGCTCTAGCTCTAGCTCATCCGGCGATGGATCTGATGAT 9OO SGSGSGSSSSSSSSGDGSDD 950 GSDDGSDDGDDANSANADDL GATTCCMTGATCCCGATGATTCCGATMCTCCGGTTCCMTGGCGAGTCTGACTCTGAT1020 DSNDPDDSDNSGSNGESDSD cys Val Met lle Leu 00 0.0 18 05 02 z.o 0.9 0.2 0.0 8.0 0.5 Tyr Phe Lys Arg His Trp Asn Gln Nofe-'ND : MSP-1 Scallop 195 0.9 31.0 3.0 14 250 46 0.0 Ala TGACTCC D TaeLe 1. Amino acid compositionsof MSP-1 (partial sequence),solublematrix (bulk)of Patinopecten yessoensis(Kasaiand Ohta 1981),and an hplc fraction of soluble matrix of the oyster Crassostrea virginica(Wheeler 1992) Solublefraction Scallop 25.2 to 224 60 2.4 zoJ 65 14 'I .1 00 o7 1.6 00 0.6 3.4 09 o7 Oyster el F 0.5 24.3 4.2 0.9 30.0 0.9 ND 0.2 ND 0.1 0.1 1.7 01 0.6 0.3 ND ND ND ND ND ND ND no data MCTCTTCCTCCGACGATGGCGATGGTTCCGATTCCGG?TCCGATTCCGGCAGAGATAGT 1080 NSSSDDGDGSDSGSDSGRDS CAGTCCGATGACGCTTCTMTMTGATTCTGATGACTCCGATGACTCTGATMTTCGTCT 1-1-40 OSDDASNNDSDDSDDSDNSS 97,72, and,49kDa in apparentmolecular weight, as well as three minor bands of smaller sizes, when stainedwith CoomassieBrilliant Blue or silver. This pattern was repCCAGCAGGCMTGGAGGTMGGGACGCMGGGAGGCMTGGAGGAGGCMTGGAGGCMT1260 P AGNGGKGRKGGNGGGNGGN licated several times using different shell exffact prepaGGC 1 30 8 rations. PAS and Stains-All stainedeach protein band red ""*"*"'. and blue, respectively, indicating that all these compo;";"i;;:j;.: r *r' andthede- nents are glycosylated and may have cation-binding poduced amino acid sequence.Numbers on the right indicate positions of the nucleotides in the MSP-I cDNA sequence.The tential. PAGE under non-denaturingconditions revealed residuesdeterminedby Edman degradationare in bold. Sequenc- a similar gel pattern as in SDS PAGE, confirming that es that correspond to the oligonucleotide primers (P1, P2, P3, these proteins are highly acidic. N-terminal sequencingof the three major components and P4) are boxed. Cloning site is also boxed (BamHI). Potential N-glycosylation sites are underlined. One-letter abbreviation of revealed that all three share the same amino acid seamino acid residues(threeJetter abbreviationin parenthesis):G quence at least for the first twenty residues (LDTDK : glycine (Gly); A : alanine (Ala); V : valine (Val); L = DLEFH LDSLL NAAED, in one-letter abbrevation of leucine (Leu); p : phenylalanine(Phe); p : proline (Pro); S : amino acids). These componentsmay have derived from serine (Ser); T : threonine (Thr); N : asparagine(Asn); Q : the same transcript, but were subjected to different deglutamine (Gln); Y : tyrosine (Tyr); D : aspartate(Asp); E : grees of post-transcriptional processing or post-translaglutamate(Glu); H : histidine (His); K : lysine (Lys); R = tional processing(such as glycosylation,phosphorylation, arginine (Arg). and C-terminal cleavage), or they may be encoded by different genes. At the moment, evidence is lacking to and reverse primers. PCR products were also sequenced support any of these possibilities, and MSP-I cannot be directly using an internal primer (P4: Fig. 1). Resulting specified to a particular band in the SDS PAGE gel. ACTGGTACTGGCGMTCCGATTCCGArcAGTCTGGGCCTGGAGGATATGGAGGCMTGGA 12OO TGTGESDSDESGPGGYGGNG sequence data were analyzed with the software GENETYX-MAC ver. 9 (Software Development). The DDBJ data bank (National Institute of Genetics, Mishima, Japan) was searched to find similar sequences. Rnsurrs Biochemicalcharacterization of MSP-I The exffaction procedureyielded about I mg of soluble total organic moleculesper 3 g of shell flakes. SDS PAGE of these molecules revealed three major protein bands of Amino acid sequenceof MSP-1 Figure I shows the nucleotide sequencefor the part of the cDNA encoding the first 436 amino acid sequenceof MSP-I. The deducedsequencecontains a high proportion of serine, glycine, and aspartateresidues (Table 1), in agreementwith the bulk composition of the soluble matrix of the same species(Kasai and Ohta l98l), supporting the fact that MSP-I representsthe major component of the soluble matrix. The amino acid composition is also t5l3 SARASHINA AND ENDO: MATRIX PROTEIN OF BIO-CALCITE N-teminua Basic SGD D-1 KGGSKGSSTRSSKGGSKGGSKGGN 66 GGGDADDSSSSSCSDSGSSGSDEESDD 93 sG-1 D-1 722 DGSDDGSDDGSDSGDDADSANADDLDSNDSDD ]-54 321 D-2 D-1 SDNSGSNGESDSDNSSSDDGDGSDSGSDSGND 186 D-2 SDNSGSNGESDSDNSSSDDGDGSDSGSDSGRD 359 D-L SQ SDDASNNDSDDSDDSDDS SNDIVNESNSDE 2L7 D-2 SQSDDASNNDSDDSDDSDNS STGTGE SDSDE 390 DGSDDGSDESDSGDDADSANADDLDSNDSDDSDNSGSNGESDSDNSS 254 295 DGSDDGSDIESDDGDDANSANADDLDSMPDDS SDDGDGSDSGSDSGRDSQS DmS 389 ****************** ** *** domains(Dalignmentof aspartate-rich Frcunn3. Sequence I andD-2) of MSP-I. Identicalaminoacidsareindicatedby assG-3 ssssss 436 terisks.Numberson therightindicatepositionsof theaminoacid Acidicresidues arein bold.For in theMSP-1sequence FIcunn 2. Modularstructureof MSP-I. The aspartate-rich residues of arninoacids.seecaDtionof Fisure1. one-letter abbreviation domainsare boxed.Acidic residuesare in bold. PotentialNglycosylationsitesareunderlined. For one-letterabbreviation of aminoacids,seecaptionofFigure 1. mains of MSP-I. The two D domains comprise 95 amino acids, containing 33-35 aspartateresidues,and share a high degree of sequencesimilarity with each other (Fig. comparablewith that of a purified soluble fraction of oyster shell (Wheeler 1992; Table l), and is in fact typical 3). This sequence conservation suggests its functional for a mollusc soluble matrix fraction (Lowenstam and significance, which is most naturally thought to be that of calcium binding, with the calcium either in the solution Weiner 1989). The predicted sequencerevealed a modular structure or in the crystal, or both. A glycine-rich domain ("G" with a basic domain near the N-terminus and two aspar- domain) follows the D domain. As the two G domains tate-rich domains ("D" domains) interspersed among also exhibit a high degree of sequencesimilarity, they three serine- and glycine-rich regions (Fig. 2), and eight also may be important functionally. Soluble proteins in foliated calcite of mollusc shells are possible N-glycosylation sites localized in the aspartaterich domains (Figs. I and 2). Preliminary results indicare phosphorylated(Borbas et al. 1991). Thus it is likely that that the rest of the amplified cDNA coding region codes MSP-I is also phosphorylated becauseit has been exffacted from the foliate calcite layer of P. yessoensis.The for repetition of similar sequencemotifs. The N-terminal domain of MSP-I is 42 residueslong, deduced partial sequenceof MSP-I contains a total of and an a-helix was predicted for this domain by the anal- 137 serine,four threonine,and two tyrosine residues(Fig. yses of secondary sffucture using the method of Chou 1), and any of thesecan be consideredas a putative phosand Fasman (1978). The N-terminal domain is followed phorylation site. by a basic domain, containing f,ve Lys-Gly-X-Y (X : DrscussroN Gly or Ser, y : Ser or Asn) segmentsin tandem, interAspartate-rich domain and mineral-protein interactions calatedby a Thr-Arg-Ser-Sersegmentin the middle. Following the basic domain is a 27 residue serine and glyHow do organismsproduce delicately textured and yet cine-richregion ("SGD" domain),which is acidic due to rock-solid biominerals under physiological conditions?A the presence of seven aspartate and two glutamate key may be biopolymers, especiallyproteins,that interact residues. with the ions in the media and the growing crystals. A The SG domains are solely composed of serine and considerablenumber of in vitro studieshave demonstratglycine, dominated by (Ser-Gly), and (Ser)" repeats. ed that such interactions between calcium carbonateand Among the sequencesin the DDBJ data bank, this do- soluble matrix proteins are indeed possible. main showed the highest sequencesimilarity with the Examples of such observations include inhibition of "GS" domain of Lustrin A, a matrix protein of gastropod crystal growth by proteins (Wheeler et al. 1981), adsorpnacre (Shen et al. 1997), suggestingthat they are evolu- tion of proteins to specific crystal faces (Addadi and Weitionarily and/or functionally related. The "GS" domain ner 1985;Bermanet al. 1988;Bermanet al. 1990;Albeck of Lustrin A is suggestedto have an elastic property mak- et al. 1993;Wierzbicki et al. 1994; Aizenberg et al. 1994; ing the protein an extensor molecule (Shen et al. 1997). Aizenberg et al. 1995), and control of aragonite-calcite It seemspossible that the SG domains of MSP-I have a polymorphism by proteins (Belcher et al. 1996; Falini et similar function. However, becausethe SG domains of al. 1996). But how do these proteins interact with the MSP-I lack the aromatic residues of tryptophan and calcium carbonateto control crystal growth? phenylalanine,which are consideredimportant in Lustrin It is reasonableto assumethat the negatively charged A, their functions could well be different. acidic amino acid residuesand the positively chargedbaEach SG domain is followed by the D domain, the sic residues in the matrix proteins interact with the callargest and seemingly most important of the revealeddo- cium ions and carbonateions, respectively,somehowpro429 t5 l 4 SARASHINA AND ENDO: MATRIX PROTEIN OF BIO.CALCITE viding specific templatesfor the nucleationof biominerals (Hare 1963), although no evidencehas been reported for involvement of positively charged amino acids in these processes.In addition, the charged amino acids in these proteins can also interact with crystal planes and thus conffol growth. Using the amino acid composition data on maffix proteins hydrolyzed partially or completely, Weiner and coworkers developed an hypothesis that predicts that the soluble matrix proteins adopt antiparallel p-sheet, containing (Asp-Y)" domains, where Y representsserine or glycine (Weiner 1975; Weiner 1983; Weiner and Tlaub 1984; Weiner and Addadi 199!). It was further hypothesized that the spacing (6.95 A) between every second residue of the negatively charged aspartateis approximately similar to the distance(3.0-6.5 A) betweenthe calcium ions in the unit cells of aragonite and calcite, enabling the proteins to function as a template for mineralization(Weiner 1975). This model was further extended to explain the crystallography of the three types of foliated calcite by a precise stereochemicalfit between the amino acid residues of the matrix protein and the crystal lattices in the surface of a specific crystal face (Runnegar 1984). The spacing of calcium ions along the length of the laths is 19.3 A in one type of foliated calcite, a distancethat is matched by every sixth residueof a parallel B-sheet(I9.44 A). Taking account of the amino acid composition, the protein was predicted to have the repetitive sequenceof (Asp-Gly-XGly-X-Gly),. The other two types of foliated calcire were specifiedby the repetitive sequenceof (Asp-Y)" of either antiparallel or parallel B-sheet conformation (Runnegar 1984). However, thesehypothesesof the primary and secondary structures of the acidic matrix proteins have been basedon indirect observations.The (Asp-Y)" domains are absent in a phosphoprotein of oyster shell (Wheeler 1992). The primary sequenceof Nacrein, a major soluble protein of pearl nacre (Miyamoto et al. 1996), contains an acidic domain, but is not of the (Asp-Y), type. Our results indicate that (Asp-Y), type and (Asp-Gly-X-GlyX-Gly)" type domains do not exist at least in the sequenced part of MSP-I. MSP-I has aspartate-richdomains, which contain some regular motifs such as (Asp-Gly-Ser-Asp) and (Asp-Ser-Asp),but the overall arrangementof the acidic residuesin the domains suggests that two-dimensional simple models may be insufficient to explain the interactive relationshipsat the protein-mineral interfaces. Implications for the polymorph formation The calcium carbonateof mollusc shell occurs as calcite, aragonite, or vaterite (Wilbur 1960). Aragonite occurs in other animals as well as in plants, protists, and bacteria (Lowenstam and Weiner 1989). The problem of the formation of the much less stablearagoniteinsteadof calcite ("the calcite-aragoniteproblem") is long standing and still unresolved (Wilbur 1960; Lowenstam and Wei- ner 1989). Suggestedexplanationsinclude: (1) presence of foreign ions, especially Mg'* (Simkiss et al 1982); (2) structure of organic maffix; (3) influence of carbonic anhydrase; and (4) temperature(Wilbur 1960). Watabe and Wilbur (1960) repoted that insoluble organic maffix extracted from mollusc shells can control calcite-aragonitepolymorphism both in vitro and in vivo, but the evidencewas not conclusive.Recentfindings have demonstratedmore definitively that soluble matrix proteins, rather than insoluble ones, can conffol the polymorphism in vitro (Belcher et al. 1996; Falini et al. 1996). The fact that soluble aragonitic proteins alone can switch the polymorph of growing crystals (Belcher et al. 1996), and that a carbonic anhydrasehas been isolated as a major soluble matrix componentof the aragonitic shell (Miyilmoto et al. 1996), suggestthat the carbonic anhydrase activity to produce local accumulation of carbonateions at the site of crystal growth could be important in the formation of aragonite.The absenceof a carbonic anhydrase domain in the major soluble proteins of the calcitic shell in this study tends to support this hypothesis. CoNcr-usroNs To understand the functions of matrix proteins, and biomineralization processesin general, it is necessaryto determine primary, secondary,and tertiary structures;to localize the proteins precisely in the biominerals; and to perform refined in vitro experimentsusing pure proteins. The recombinant clones for the MSP-I gene provide a basis for those experiments.Furthermore, to understand the functions of maffix proteins in vivo, it would be useful to produce "transgenic shellfish" with a certain matrix protein gene disrupted. The kind of information obtained in this study is considered as a prerequisite for such a ventrue. Acxnowr,BDGMENTS We thank Hiromichi Nagasawafor technical advice and the use of the protein sequencer.Maggie Cusack, Lia Addadi, and A P Wheeler are thankedfor valuable commentson the manuscript Thanks are due to Jill Banfield for providing us with the opportunity to publish our results and for helpful suggestionsWe appreciatethe discussionwith KazushigeTanabe and ThtsuoOji. This work was partly financedby grants from Mombusho (JapanMinistry of Education,no. 08740401and no 09304049)and ShimadzuFoundationto K.E. RrrnnBNcBScrrED Addadi, L. and Weiner,S. (1985) Interactionsbetweenacidic proteinsand crystals: stereochemicalrequirementsin biomineralization.Proceedings of the National Academy of Science,82, 4110-4114. -(1997) A pavementof perl Natue, 389,912-915 Albeck, S., Aizenberg,J, Addadi, L, and Weiner,S (1993)Interactions of various skeletal intracrystalline components with calcite crystals. Journal of American Chemical Society, 115, 1169l-11691 Aizenberg, J., Albeck, S., Weiner,S., and Addadi, L (1994) Crystal-protein interactionsstudied by overgrowth of calcite on biogenic skeletal elements.Joumalof Crystal Growth, 142, 156-164 Aizenberg, J , Hanson,J , Ilan, M , Leiserowitz, L., Koetzle, TF, Addadi, L., and Weiner,S (1995) Morphogenesisof calcitic spongespicules:a role for specializedproteins interactingwith growing crystals The FASEB Journal. 9. 262-268. Belcher,A M., Wu, X H, Christensen, R J, Hansma,PK, Stucky,G D, SARASHINA AND ENDO: MATRIX PROTEIN OF BIO-CALCITE and Morse, D E. (1996) Control of crystal phaseswitching and orientationby solublemollusc-shellproteins.Nature,381, 56-58 Benson,S.C. and Wilt, EH (1992) Calcificationof spiculesin the sea urchin embryo. In E. Bonucci, Ed, Calcification in biological systems, p 157-178 CRC Press,Cleveland,Ohio. Berman, A., Addadi, L., and Weiner, S (1988) Interactionsof sea-urchin skeleton macromoleculeswith growing calcite crystals-a study of intracrystallineproteins Nature, 331, 546-548. Berman,A, Addadi,L., Kvick, A, Leiserowitz,L, Nelson,M., and Weiner, S (1990) Intercalationof sea urchin proteins in calcite: study of a crystallinecompositematerial Science,25O,664-667 Borbas,J E , Wheeler,A P, and Sikes,C S. (1991)Molluscanshellmatrix phosphoproteins:Correlationof degreeof phosphorylationto shell mineral microstructure and to in vitro regulation of mineralization. The Journal of ExperimentalZoology,258, 1-13. Campbell,K P, Maclennan, D H, and Jorgensen,A O (1983) Staining of the Ca'?*-bindingproteins,calsequestrin,calmodulin, troponin C, and S-100, with the cationic carbocyaninedye "Stains-all" The Journal of Biological Chemistry, 258, 11261-11273. Chomzynski,P (1993) A reagentfor the single-stepsimultaneousisolation of RNA, DNA and proteins from cell and tissue samples.Biotechn l q u e s ,I ) , J J z - ) J I Chou, Ry. and Fasman,G D (1978) Prediction of the secondarysrucrure of proteins from their amino acid sequence.Advancesin Enzymology, 47. 45-148. Cusack,M, Cuny, G, Clegg,H., and Abbou, G (1992)An inrracrystalline chromoproteinfrom red brachiopodshells:implications for the process of biomineralization ComparativeBiochemistry and physiology, 1028,93-95 Falini, G, Albeck, S, Weiner,S, and Addadi, L. (1996)Conrrolof aragonite or calcite polymorphism by mollusk shell macromoleculesScience,2'71,6'7-69. Frohman, M A (1990) RACE: Rapid amplification of cDNA ends. In M A Innis, D H Gelfand, J J Sninsky, and T.J White, Eds., pCR protocols, p 28-38. Academic Press,San Diego, California Hare, PE (1963) Amino acids in the proteins from aragoniteand calcite in the shells of Mytilus californianus. Science, 139, 216-217. Holden,K.G, Yim, N.C.F, Griggs,LJ, and Weissbach, J.A. (1971)Gel electrophoresisof mucous glycoproteins I Effect of gel porosity Biochemistry,10, 3105-3109 Ishii, K, Yanagisawa,T, and Nagasawa,H. (1996) Characterizationof a matrix protein in the gastrolith of the crayfish Procambarus clarkii BioscienceBiotechnology Biochemistry, 60, 1479- I48Z Ishii, K, Tsutsui, N , Watanabe,T, Yanagisawa,T., and Nagasawa,H (1998) Solubilizationand Chemical characterizationof an insolublematrix protein in the gastroliths of a crayfish, Procambarus clarkii. BjoscienceBiotechnologyBiochemisny,62, 291-296. Kasai, H and Ohta, N (1981) Relationshipbetweenorganic matricesand shell structuresin recentbivalves In T. Habe and M Omori, Eds., Study of molluscanpaleobiology,p 101-106 Kokusai Insatsu,Tokyo (in Japanese). Katoh-Fukui, Y., Noce, T., Ueda, T,, Fujiwara, Y, Hashimoto,N, Higashinakagawa,T., Killian, C E, Livingston,B T., Wilt, FH, Benson,S.C., Sucov,H M , and Davidson,E.H. (1991)The corected structureof the SM50 spicule matrix protein of Strongylocentrotuspurpuratus Developmental Biology, 145, 2Ol-222 Katoh-Fukui, Y, Noce, T., Ueda, T, Fujiwara, Y, Hashimoto,N, Tanaka, S., and Higashinakagawa,T. (1992) Isolation and characterizationof cDNA encoding a spicule matrix protein in Hemicentrotuspulchenimus InternationalJoumal of DevelopmentalBiology, 36,353- 361. Krampiu, C P (1982) Structure of the organic matrix in mollusc shells and avian eggshells In G H Nancollas,Ed., Biological mineralization and demineralization,p 219-232 Springer-Verlag,Berlin, Heidelberg, New York 1515 Laemmli, U K (1970) Cleavageof structuralproteinsduring the assembly of the head of bacteriophageT4. Nature, 227,680-685. Lowenstam,H.A. (1981) Minerals formed by organisms.Science,211, 1126-1131. Lowenstam, H.A and Weiner, S (1989) On Biomineralization Oxford University Press,New York Mann, S, Archibald,DD, Didymus,JM, Douglas,T., Heywood,B.R., Meldrum, FC, and Reeves,NJ. (1993) Crystallizationat inorganicorganic interfaces: biominerals and biomimetic synthesis.Science,261, 1286 1292 Miyamoto, H, Miyashita, T., Okushima, M , Nakano, S , Morita, T., and Matsushiro, A (1996) A carbonic anhydrasefrom the nacreouslayer in oyster pearls Proceedingsof the National Academy of Science,93, 9651 -9660 Runnegar,B (1984) Crystallographyof the foliated calcite shell layers of bivalve molluscs Alcheringa, 8, 273-29O. Shen,X, Belcher,A M., Hansma,PK, Srucky,G.D , and Morse, D E (1997) Molecular cloning and characterizationof Lustrin A, a matrix protein from shell and pearl nacre of Haliotis rufescens.The Journalof Biological Chemistry, 272, 32472-32481. Simkiss,K, Althofl J, Anderson,C., Bennema,P, Boyde,A , Crenshaw, M A , Fleisch,H., Hohling, H.-J.,Howell, D.S., Kitano, Y., Nancollas, G H., Newesely,H., Nielsen,A.E., Quint, P, and Termine,J D. (1982) Mechanismsof mineralization (normal) group report In G H Nancollas, Ed., Biological mineralization and demineralization,p. 351-363 Springer-Verlag,Berlin. Sucov,H.M, Benson,S, Robinson,J.J.,Britten, RJ, Wilt, F, and Davidson, E.H. (1987) A lineage-specificgene encoding a major matrix protein of the sea urchin embryo spicule II Structureof the gene and derived sequenceof the protein. Developmental Biology, 120,50751 9 . Sudo,S, Fujikawa,T, Nagakura,T, Ohkubo,T, Sakaguchi,K., Tanaka, M , Nakashima,K, and Takahashi,T. (1997) Structuresofmollusc shell framework proteins. Nature, 387, 563-564. Watabe,N and Wilbur, KM (1960) Influence of the organic matrix on crystaltype in molluscs Nature,188, 334 Weiner,S. (1975) Soluble protein of the organic matrix of mollusk shells: a potential templatefor shell formation. Science, 190, 987-989 -(1983) Mollusk shell formation: Isolation of two organic matrix proteins associatedwith calcite deposition in the bivalve Mytilus californianus Biochemistry, 22, 4139-41 45 -(1984) Organizationof organic matrix componentsin mineralized tissues American Zoologist, 24, 945-951. Weiner, S and Addadi, L (1991) Acidic macromoleculesof mineralized tissues:the controllersof crystal formation. Trendsin Biochemical Science,16,252-256 Weiner, S and Traub, W. (1984) Macromoleculesin mollusc shells and their functions in biomineralization.PhilosophicalTransactionsof Royal Society of London, 8304,425-434. Wheeler, AP. (1992) Phosphoproteinsof oyster (Crassostreavirginica) shell organic matrix. In S. Suga and N. Watabe,Eds , Hard tissuemineralizationand demineralization,p. I 7 1- I 87 Springer-Verlag,Tokyo Wheeler,A.P, George,J.W., and Evans, C A (1981) Control of calcium carbonate nucleation and crystal growth by soluble matrix of oyster shell. Science.212. 1397-1398 Wierzbicki,A, Sikes,CS, Madura,JD., and Drake, B. (1994) Atomic force microscopy and molecular modeling of protein md peptidebinding to calcite CalcifiedTissueInternational,54,133-141 Wilbur, K.M. (1960) Shell structure and mineralization in molluscs. In RF Sognnaes,Ed, Calcificationin biological systems,p. 15-40 American Association for the advancementof Science, Washington, DC. MeNuscptm RECETvED Mmcs 5. 1998 M,q.Nuscnrsr ACcEprtsD Aucusr 13, 1998 Plpnn geNtlLgogv JrrreN E Banucru