Download Transcription factors Oct-1 and NF-YA regulate the p53

Oncogene (2001) 20, 2683 ± 2690
ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00
www.nature.com/onc
Transcription factors Oct-1 and NF-YA regulate the p53-independent
induction of the GADD45 following DNA damage
Shunqian Jin1, Feiyue Fan1, Wenhong Fan1, Hongcheng Zhao1, Tong Tong1, Patricia Blanck1,
Isaac Alomo1, Baskaran Rajasekaran2 and Qimin Zhan*,1,2
1
Department of Radiation Oncology, Cancer Institute, University of Pittsburgh School of Medicine. Pittsburgh, Pennsylvania,
PA15213, USA; 2Department of Molecular Genetics and Biochemistry, Cancer Institute, University of Pittsburgh School of
Medicine, Pittsburgh, Pennsylvania, PA 15213, USA
The p53-regulated GADD45 gene is one of the important
players in cellular response to DNA damage, and
probably involved in the control of cell cycle checkpoint,
apoptosis and DNA repair. There are both the p53dependent and -independent pathways that regulate
GADD45 induction. Following ionizing radiation, induction of the GADD45 gene is regulated by p53 through
the p53-binding motif located in the third intron of the
GADD45 gene. In contrast, GADD45 induction by
methyl methanesulfonate (MMS), UV radiation (UV),
and medium starvation is independent of p53 status
although p53 may contribute to these responses.
However, the regulatory elements that control the p53independent induction of GADD45 remain uncertain. In
this report, we have performed detailed analyses to
characterize the responsive components that are required
for the induction of the GADD45 promoter. We have
found that the region between 7107 and 762 of the
GADD45 promoter is crucial for the induction. Sequence
analysis indicates that there are two OCT-1 sites and
one CAAT box located in this region. Site-directed
mutations of both OCT-1 and CAAT motifs substantially abrogate the induction of the GADD45 promoter
by DNA damage. In addition, both Oct-1 protein
(binding to OCT-1 site) and NF-YA protein (binding
to CAAT box) are induced after cell exposure to DNA
damaging agents. Moreover, the Electrophoretic Mobility Shift Assay (EMSA) has demonstrated the direct
bindings of Oct-1 and NF-YA proteins to their consensus
sequences in the GADD45 promoter. Therefore, these
results have presented the novel observation that
transcription factors Oct-1 and NF-YA participate in
the cellular response to DNA damage and are involved in
the regulation of stress-inducible genes. Oncogene
(2001) 20, 2683 ± 2690.
Keywords: GADD45; p53; DNA damage; transcription
factor Oct-1; NF-YA
*Correspondence: Q Zhan, Cancer Institute, University of Pittsburgh
School of Medicine, BST W-945, 200 Lothrop Street, Pittsburgh, PA
15213, USA
Received 21 November 2000; revised 7 February 2001; accepted 12
February 2001
Introduction
Cellular response to DNA damage includes cell cycle
arrest, DNA repair and apoptosis. Tumor suppressor
p53 protein has been implicated to play a critical role
in these important biological events (Kastan et al.,
1992; Levine, 1997; Prives and Hall, 1999). It has been
well accepted that the biological role for p53 may be
mainly mediated through its down stream genes, such
as p21 (el-Deiry et al., 1993), GADD45 (Kastan et al.,
1992; Zhan et al., 1994a) and BAX (Miyashita and
Reed, 1995; Zhan et al., 1994b). GADD45 was initially
isolated from Chinese hamster ovarian cells on the
basis of UV induction. Subsequently, GADD45 was
found strongly induced by a wide spectrum of DNA
damaging agents, including ionizing radiation (IR),
methyl methanesulfonate (MMS) and UV radiation
(UV) (Fornace et al., 1988; Papathanasiou et al., 1991;
Zhan et al., 1996). Previous studies have demonstrated
that introduction of GADD45 into tumor cells by
transient transfection resulted in growth suppression
(Zhan et al., 1994c). The growth suppressive property
of Gadd45 protein has been proven to correlate with
its inhibition of Cdc2/cyclin B1 kinase activity (Jin et
al., 2000a; Zhan et al., 1999). In addition, Gadd45 was
found to interact with MTK1/MEEK4, an activator of
JNK kinase pathway, and in turn induce apoptosis
(Harkin et al., 1999; Takekawa and Saito, 1998).
Therefore, the roles for GADD45 in both cell cycle
arrest and apoptosis may contribute to its growth
suppressive properties. Clearly, these ®ndings indicate
that GADD45 is one of the important genes, which
play a role in the control of cellular response to DNA
damage. This can also be re¯ected by the evidence that
mice carrying GADD45 null mutations exhibit genomic
instability, as exempli®ed by chromosome aberration,
aneuploidy, centrosome disturbances and gene ampli®cation (Hollander et al., 1999).
The signaling pathways that regulate the induction
of GADD45 following DNA damage remain to be
further de®ned. IR-induction of GADD45 requires
normal cellular p53 function probably through the
intron p53-binding motif of the GADD45 gene (Kastan
et al., 1992). In contrast, induction of GADD45 by
MMS, UV and other DNA base damaging agents or
The role of the Oct-1 and NF-YA in the induction of the GADD45 promoter
S Jin et al
2684
Oncogene
medium starvation can take place in a p53-independent
manner. Therefore, GADD45 induction is regulated by
both p53-dependent and -independent pathways (Zhan
et al., 1996). The GADD45 promoter does not contain
typical p53 binding sites and is not responsive to
ionizing radiation. Activation of the GADD45 promoter by UV and MMS does not require p53 but p53 is
able to exert its cooperative role in the induction of the
GADD45 promoter. In p53-de®cient cell lines, the UVor MMS-induction of the GADD45 promoter has been
found attenuated compared to that seen in cells with
functional p53. A previous report by our group has
demonstrated that p53 can regulate the GADD45
promoter through its interaction with WT1, which is
a transcription factor and directly binds to the
GADD45 promoter. These ®ndings indicate that p53
can still participate in transcriptional induction of the
GADD45 promoter in the absence of direct DNA
binding (Zhan et al., 1998). However, the responsive
elements that regulate the p53-independent activation
of the GADD45 promoter remain unclear.
The transcription factor Oct-1 is a member of the
POU homeodomain family and ubiquitously expressed.
Oct-1 binds to a divers range of cis-regulatory DNA
sequence (AGTCAAAT) through its DNA-binding
POU domain (Sturm et al., 1988a,b). High anity
Oct-1 binding sites were found in a number of cellular
promoters, including the broadly expressed histone
H2B gene (Fletcher et al., 1987; LaBella et al., 1988),
small nuclear RNA gene (Murphy et al., 1989),
immunoglobulin genes in B cells (Bergman et al.,
1984; Jenuwein and Grosschedl, 1991), TIF2 gene
(Fadel et al., 1999) and GnRH gene (Eraly et al.,
1998). Additionally, Oct-1 can negatively regulate
certain genes such as the von Willbrand factor and
VCAM (Schwachtgen et al., 1998). NF-Y is also a
ubiquitous transcription factor formed by three
subunits A, B, and C. NF-Y speci®cally recognizes a
CAAT-box motif, which is one of the most ubiquitous
elements, being present in 30% of eukaryotic promoters. Typically, the CAAT box is found as a single copy
element in the forward or reverse orientation between
760 and 7100 of the transcriptions start site
(Mantovani, 1999; Matuoka and Yu Chen, 1999).
However, the roles of the Oct-1 and NF-Y proteins in
cellular response to DNA damage are unknown.
In the present study, a series of experiments have
been performed to identify the regulatory elements of
the GADD45 promoter. We have found that two OCT1 binding sites and one CAAT box are located in the
region between 7107 to 762 in the GADD45
promoter. These OCT-1 sites and CAAT box were
shown to be required for the induction of the GADD45
promoter in response to DNA damaging agents. In
support of these ®ndings, we have also demonstrated
that both Oct-1 and NF-Y proteins are induced in a
p53-independent manner following MMS or UV
treatment. In addition, the binding anity of these
two proteins to their consensus sequences was also
enhanced after DNA damage. Therefore, these results
indicate that Oct-1 and NF-Y participate in the cellular
response to genotoxic stress, particularly in the
regulation of the GADD45 induction by DNA damage.
Results
Mapping of the DNA damage responsive elements in the
GADD45 promoter
Our previous reports have demonstrated that the
GADD45 promoter is strongly responsive to multiple
genotoxic stress, such as MMS and UV radiation. The
activation of the GADD45 promoter by DNA damage
is independent of normal cellular p53 function (Zhan et
al., 1996). To localize the DNA damage-responsive
elements in the GADD45 promoter, a series of the
CAT reporters that spanning the di€erent regions of
the human GADD45 promoter were constructed.
Following transfection of these reporter constructs
into the human colorectal carcinoma cells HCT116,
cells were subjected to the DNA damaging agents.
After cells treated with MMS and UV radiation, the
CAT assays were performed and CAT activities were
analysed. As shown in Figure 1a,b, the GADD45
promoter exhibited strong responses to DNA damaging agents. Most of the CAT reporter constructs were
highly induced by MMS and UV treatment. However,
with progressive 5'-deletion, pHg45-CAT13 that extended 5' only to 762 relative to the transcription start
site displayed little induction following exposure to
MMS and UV. These observations indicated that the
region between 7107 and 762 contains the controlling
elements required for the responsiveness of the
GADD45 promoter to DNA damaging agents. As
shown in Figure 1c, DNA sequence analysis indicates
that there are two OCT-1 motifs and one CAAT box
located in the region of the human GADD45 promoter.
Both OCT-1 and CAAT motifs contribute to the induction
of the GADD45 promoter by DNA damage
To de®ne whether these OCT-1 or CAAT motifs play a
role in the induction of the GADD45 promoter after
DNA damage, we constructed a variety of the mutants of
the GADD45 promoter reporters, where the OCT-1 or
CAAT sites were mutated in di€erent combinations (see
Materials and methods). Our previous work has
demonstrated that there are certain regulatory elements
located upstream of the GADD45 promoter, such as
EGR1/WT1 (Zhan et al., 1998). In order to exclude the
in¯uence of such responsive elements, we choose pHg45CAT11, which only contains the region between 7121
and +144 of the GADD45 promoter. As shown in Figure
2a,b, pHg45-CAT11 exhibited strong induction by MMS
and UV. Single mutation in either Oct-1 or CAAT box
(pHg45-CAT11m1, pHg45-CAT11m2 and pH45CATm3) did not evidently reduce the activation of the
GADD45 promoter by DNA damage. In contrast,
double mutations in Oct-1 and CAAT motifs (pHg45CAT11m4, pHg45-CAT11m5 and pHg45-CAT11m6)
were shown to signi®cantly a€ect the activation of the
The role of the Oct-1 and NF-YA in the induction of the GADD45 promoter
S Jin et al
2685
Figure 1 Localization of the responsive elements in the GADD45 promoter following DNA damage. (a). Four mg of the indicated
GADD45 promoter CAT reporter constructs were transfected into human colorectal carcinoma HCT 116 cells and treated with
MMS at a dose of 100 mg/ml or UV at a dose of 10 J m72. Cells were harvested 12 h after treatment, and CAT assay were
performed as described in Materials and methods. (b). Summary of results for the reporter constructs containing the indicated
regions of the GADD45 promoter linked to CAT reported gene. (c) DNA sequence analysis indicates that there are two OCT-1 sites
and one CAAT box located at the region of the GADD45 promoter from 7107 to 762
GADD45 promoter and the induction in these reporters
was reduced by approximately 70%. When all three sites
were mutated (pHg45-CAT11m7), the GADD45 promoter reporter construct did not show any induction after
MMS and UV treatment. The response of pHg45CAT11m7 was observed to be the same as that seen in
pHg45-CAT13, which only contains the region of the
GADD45 promoter from 762 to +144. We have also
examined induction of all those reporter constructs in
two p53-de®cient cell lines (HeLa, expressing HPV-E6
protein and HCT116 p537/7, where the p53 alleles were
deleted), and obtained similar results observed in
HCT116 (results not shown), indicating that p53 is not
required for OCT-1- and CCAAT box-mediated induction of the GADD45 promoter. Collectively, these results
demonstrate that both Oct-1 sites and CAAT box play a
major role in the activation of the GADD45 promoter by
DNA damage in a p53-independent manner.
It should be mentioned here that we made mutations
of all OCT-1 and CAAT motifs in pHg45-CAT2,
which covers a longer promoter region from 7909 to
+144. The activation of this mutated promoter
reporter (pHg45-CAT2ma) was reduced by 70%
compared to pHG45-CAT2 that contains the intact
GADD45 promoter (results not shown). In contrast,
induction of the pHg45-CAT11m7 by DNA damage
was completely abrogated (Figure 2a,b). This result is
in agreement with our previous observation that there
are certain regulatory sites located at the upstream of
the GADD45 promoter (Zhan et al., 1998). These
responsive elements are able to play a role in the
induction of the GADD45 promoter in response to
DNA damage, even when mutations were made in
OCT-1 and CAAT motifs.
Oct-1 and NF-YA proteins are induced following DNA
damage
Further experiments were carried out to determine if
the proteins bound to OCT-1 and CAAT motifs are
induced following DNA damage. Human colorectal
carcinoma cells HCT116 were treated with MMS at a
Oncogene
The role of the Oct-1 and NF-YA in the induction of the GADD45 promoter
S Jin et al
2686
Figure 2 Mutations of OCT-1 and CAAT motifs abrogate the activation of the GADD45 promoter following DNA damaging
agent. (a) Summary of results for the GADD45 promoter reporter constructs containing the indicated mutations either in OCT-1
sites or in CAAT box. After cells were transfected with the indicated constructs, cells were treated with MMS and UV radiation.
The CAT assays were performed and the CAT activities were measured as described in Materials and methods. The values represent
the relative induction with standard deviations compared to that of the untreated controls. (b) The representative experiment of
CAT assay is shown here
concentration of 100 mg/ml and collected at the
indicated time for Western analysis. Consistent with
our previous reports, Gadd45 protein displayed strong
induction by MMS. Interestingly, Oct-1 protein levels
were found to elevate following MMS treatment. In
addition to MMS, we have also found that multiple
DNA damaging agents are able to induce Oct-1 protein
expression in a p53-independent manner and induction
of Oct-1 protein is probably through a post-transcriptional mechanism (Zhao et al., 2000). In the case of the
proteins bound to CAAT motif, NF-YA was induced
Oncogene
after DNA damage. Two isoforms of NF-YA protein,
46 and 42 kDa, were detected in the immunoblotting
analysis. The large form (46 kDa) of NF-YA exhibited
a dramatic induction but the small form (42 kDa) did
not show evident elevation. However, NF-YB and NFYC proteins, both of which are subunits of the NF-Y
factor, did not reveal any induction following DNA
damage. As a negative control, detection of actin
protein was included and its expression level remained
the same after exposure to DNA damage. Therefore,
Oct-1 and NF-YA proteins are induced in response to
The role of the Oct-1 and NF-YA in the induction of the GADD45 promoter
S Jin et al
DNA damage and this induction may play a role in the
activation of the GADD45 promoter (Figure 3).
Both Oct-1 and NF-YA proteins bind to the GADD45
promoter
To determine whether Oct-1 and NF-YA proteins bind
to the GADD45 promoter, a labeled double-stranded
oligonucleotide corresponding to the GADD45 promoter region between 7107 and 757 were used for
Eletrophoretic Mobility Shift Assay (EMSA). In Figure
4a, when the labeled oligonucleotide (Intact) was
incubated with nuclear extracts isolated from
HCT116 cells, a prominent slowly migrating band
(C1) was observed. Density of this band was
substantially increased with the nuclear protein from
cells treated with MMS and UV radiation. However,
when the OCT-1 and CAAT motifs were mutated
(Mutant), this band disappeared. In competition
experiments (Figure 4b), this prominent band was
e€ectively competed away with an unlabeled intact
sequence (self) but not the oligo with mutated OCT-1
and CAAT motifs (mutant). Since this region contains
two OCT-1 and one CAAT motifs, we next carried out
supershift assay using di€erent antibodies. Those
NF-YA
NF-YB
NF-YC
Figure 3 Both cellular Oct-1 and NF-YA proteins are induced
in response to DNA damage. Human colorectal carcinoma
HCT116 cells were exposed to 100 mg/ml of MMS. Cells were
harvested at the indicated time points and cellular proteins were
prepared as described in Materials and methods. One hundred mg
of total cellular protein was loaded on SDS polyacrylamide gels.
After electrophoresis, the proteins were transferred to immobilon
membranes. Membranes were then blocked for 30 min in 5%
milk at room temperature. Measurement of Gadd45, Oct-1 and
NF-Y proteins was performed with antibodies against these
proteins (Santa Cruz Biotech, CA, USA). Immunoreaction was
revealed using chemiluminescence detection procedure. As a
loading control, detection of Actin protein was included. Only
visualized bands are shown; their estimated sizes were 21 kDa for
Gadd45, 97 kDa for Oct-1, 46 and 42 kDa for NF-YA and
43 kDa for Actin
included antibodies against Oct-1, NF-YA, NF-YB,
and NF-YC proteins and against several Oct-1
associated proteins such as Mat-1, cyclin H and TFII
H (Inamoto et al., 1997). As shown in Figure 4c, Oct-1
antibody was able to generate a convincing supershift
band (C2). In parallel, the density of the original band
(C1) was greatly diminished. In our experiments, the
antibodies against Oct1-associated proteins (Mat-1,
cyclin H and TFII H) failed to supershift a complex.
With the antibodies to the proteins bound to CAAT
motif, only NF-YA was able to supershift a complex.
Neither NF-YB nor NF-YC antibodies generated
convincing bands. Taken together, these results have
demonstrated that both DNA damage-induced Oct-1
and NF-YA proteins are able to bind to the GADD45
promoter and involved in the activation the GADD45
promoter following DNA damage.
2687
Discussion
In the current study, we have carried out detailed
analysis to de®ne the regulatory element and factors in
the activation of the GADD45 promoter by DNA
damage. Mapping of the GADD45 promoter demonstrated that the region from 7107 to 762 contains the
important responsive elements. Further analysis indicated that the OCT-1 motifs and one CAAT site
located in this region are required for the induction
GADD45 promoter in response to DNA damaging
agents. Mutations made in these DNA binding sites
abrogated the induction of the GADD45 promoter by
DNA damage. Interestingly, both Oct-1 and NF-YA
protein levels were observed to elevate following
treatment with DNA damaging agent. Finally, both
Oct-1 and NF-YA proteins were found to bind to this
region and their binding anities were enhanced after
DNA damage. These results demonstrated that Oct-1
and NF-YA proteins play a central role in activation
of the GADD45 promoter in response to DNA
damage.
Oct-1 and NF-YA are ubiquitous transcriptional
factors involved in the development, cell cycle regulation (Roberts et al., 1991) and cellular senescence
(Matuoka and Yu Chen, 1999). Recently, we have
found that Oct-1 protein is induced after cells are
exposed to multiple DNA damaging agents and
therapeutic agents. The induction of Oct-1 protein is
mediated through a post-transcriptional mechanism
and does not require the normal cellular p53 function
(Zhao et al., 2000). Similarly, NF-YA was found to be
induced after ionizing radiation (personal communication with Dr Jaroudi). These observations indicate that
both Oct-1 and NF-YA proteins are able to participate
in cellular response to genotoxic stress, probably
through regulation on their downstream genes. In this
paper, we have shown that both Oct-1 and CAAT
binding motifs are required for the activation of the
GADD45 promoter after DNA damage, suggesting that
induction of the DNA damage-inducible gene GADD45
might require functional interaction between Oct-1 and
Oncogene
The role of the Oct-1 and NF-YA in the induction of the GADD45 promoter
S Jin et al
2688
Figure 4 Electrophoretic Mobility Shift Assay (EMSA) with the GADD45 promoter region containing the OCT-1 and CAAT
motifs. (a). The 51 bp (covering the region of the GADD45 promoter from 7107 to 757) oligo probes containing the intact OCT-1
and CCAAT motifs (Intact) or mutated OCT-1 and CAAT motifs (Mutant) were incubated with the nuclear extracts isolated from
the human HCT116 cells. The nuclear extracts were prepared from untreated cells (control) or cells treated with MMS (100 mg/ml)
and UV radiation (10 J m72). DNA-protein complexes were analysed by electrophoresis in a neutral polyacrylamide gel. (b) EMSAs
were performed in the presence of the indicated amounts (fold) of unlabeled oligo containing the intact OCT-1 and CAAT
consensus sequence (Self) or oligo containing the mutated OCT-1 and CAAT sites (Mutant). (c) EMSAs were performed in the
same manner in the presence of the antibodies against Oct-1, Mat-1, Cyclin H, TFII H, NF-YB, NF-YA and NF-YC. These
experiments were performed at least three times and the representative results were shown in the ®gure
NF-YA proteins. In support of our ®ndings, Oct-1 and
NF-YA proteins have previously been shown to
synergistically regulate histone H2B gene transcription
during Xenopus early development (Hinkley and Perry,
1992).
In addition, our most recent ®nding (the manuscript
was submitted to elsewhere) demonstrated that expression of either Oct-1 or NF-YA via transient transfection directly activated the GADD45 promoter. Coexpression of both Oct-1 and NF-YA proteins
exhibited an additive e€ect on the activation of the
GADD45 promoter. Induction of the GADD45 promoter following expression of Oct-1 and NF-YA was
comparable to that by treatment with MMS and UV
radiation. Finally, induction of the GADD45 promoter
by Oct-1 and NF-YA was observed in both HCT116
(wt p53) and HCT116 p537/7, where p53 alleles were
Oncogene
deletion through the strategy of homologous recombination, indicating that p53 status does not in¯uence
transcriptional activation of the GADD45 promoter by
Oct-1 and NF-YA (results not shown).
Regulation of GADD45 induction after DNA
damage is complex. In response to DNA strandbreaking agents, such as ionizing radiation, induction
of GADD45 strictly depends on normal cellular p53
function (Kastan et al., 1992; Zhan et al., 1994a).
However, following non-IR agents, such as UV, MMS
or medium starvation, induction of GADD45 does not
require p53 function but p53 can contribute to these
responses (Zhan et al., 1996, 1998). These ®ndings
indicate that induction of GADD45 is regulated
through both p53-dependent and -independent pathways. It has been reported that IR-induction of
GADD45 is mediated via the p53-binding motif
The role of the Oct-1 and NF-YA in the induction of the GADD45 promoter
S Jin et al
located in the third intron of the GADD45 gene
(Kastan et al., 1992). The GADD45 promoter does not
contain any typical p53 sites and is not responsive to
the treatment with ionizing radiation. However, this
promoter exhibited a strong induction in response to a
wide spectrum of DNA damaging agents. Our
previous ®ndings have demonstrated that p53 can
participate in the transcriptional regulation of the
GADD45 promoter despite the absence of direct DNA
binding. This is probably through the p53 interaction
with WT1, which is a transcription factor and directly
binds to the GADD45 promoter (Zhan et al., 1998).
Recently, the GADD45 promoter was found to be
activated following expression of the breast cancerassociated gene BRCA1, mutations of which are
associated with more than 70% of the cases of
hereditary breast cancer (Jin et al., 2000b). Moreover,
expression of MEKK1, an up stream activator of
JNK, was found to greatly activate the GADD45
promoter in a p53-independent manner (unpublished
results in our group). Taken together, these observations indicate that regulation of the GADD45
induction following DNA damage may involve multiple distinct signaling pathways. These pathways have
presented regulatory machinery in order to ensure
cells will be able to precisely respond to environmental
stimuli.
Detailed biochemical mechanism(s) by which Oct-1
and NF-YA regulate induction of GADD45 following
DNA damage requires further investigation. In the
current study, we have demonstrated that both Oct-1
and NF-YA proteins are induced following DNA
damaging agents. Increased Oct-1 and NF-YA
proteins would most likely lead to enhanced binding
anity and in turn transactivate the GADD45
promoter. In Figure 2a,b, single mutation in either
Oct-1 or CAATT box did not substantially abrogate
the induction of the GADD45 promoter, suggesting
that the proteins bound to these two sites would be
able to compensate each other. In contrast, double
mutations in these two sites can greatly abrogate the
GADD45 induction by DNA damage. Mutations in all
three sites (two OCT-1 and one CAATT) are able to
completely eliminate the induction of the GADD45
promoter by DNA damage. These results indicate that
there is a functional interaction between the proteins
bound to the Oct-1 and the CAATT box. However, in
the attempt to determine the physical interaction
between the Oct-1 and NF-YA proteins, we did not
observe the NF-YA protein presented in Oct-1
complex by immuno-precipitation assay. Reasonable
interpretations for this result would be: (i). Oct-1 does
not physically associate with NF-YA; (ii) Oct-1
interacts loosely with NF-YA and; (iii) Oct-1 indirectly interacts with NF-YA through third protein(s).
Therefore, the future e€ort will be focused on
determining whether Oct-1 physically interacts with
NF-YA via di€erent strategies. In addition, examining
alterations of the phosphorylations in the Oct-1 and
NF-YA proteins will also be included in the future
investigation.
Materials and methods
2689
Cell culture and treatment
The human colorectal carcinoma cells HCT116 were grown
in F-12 medium supplemented with 10% fetal bovine serum.
For MMS treatment, cells were exposed in medium to MMS
(Aldrich) at 100 mg/ml for 4 h and then the medium was
replaced with fresh medium. Cells were then collected at the
indicated time points. For UV radiation, cells in 100 mm
dishes were rinsed with PBS and irradiated to a dose of
10 Jm72 (Zhan et al., 1996).
Plasmid clones
The following plasmid constructs were used: pHG45-CAT1,
constructed by inserting the SalI ± SmaI fragment of GADD45
promoter spanning 72256 to +144 relative to the transcription start site into pCAT-Basic (promega); pHG45-CAT2,
similarly constructed by inserting the HindIII ± SmaI fragment
of GADD45 promoter from 7909 to +144 into pCAT-Basic
(Zhan et al., 1998). pHG45-CAT11 contains the HindIII ±
XbaI fragment of GADD45 promoter from 7121 to +144.
The other mutants of the GADD45 promoter reporters that
contain mutations in either Oct-1 or CATT box motifs were
constructed by PCR and followed by DNA sequencing. The
replacements of either Oct-1 or CAAT binding sites are listed
as the following.
pHg45-CAT11:
CTGATTTGCATAGCCCAATGGCCAAGCTGCATGCAAATGA
Oct-1
CAAT
Oct-1
pHg45-CAT11m1:
CTGgccTGCATAGCCCAATGGCCAAGCTGCATGCAAATGA
pHg45-CAT11m2:
CTGATTTGCATAGCCCAATGGCCAAGCTGCATGCAggcGA
pHg45-CAT11m3:
CTGATTTGCATAGCCtgATGGCCAAGCTGCATGCAAATGA
pHg45-CAT11m4:
CTGgccTGCATAGCCCAATGGCCAAGCTGCATGCAggcGA
pHg45-CAT11m5:
CTGgccTGCATAGCCtgATGGCCAAGCTGCATGCAAATGA
pHg45-CAT11m6:
CTGATTTGCATAGCCtgATGGCCAAGCTGCATGCAggcGA
pHg45-CAT11m7:
CTGgccTGCATAGCCtgATGGCCAAGCTGCATGCAggcGA
Cellular protein preparation and Western blotting assays
Following treatment with DNA damaging agents, cells were
rinsed with PBS and lysed in PBS containing 100 mg/ml
phenyl-methylsulfonyl ¯uoride, 2 mg/ml aprotinin, 2 mg/ml
leupeptin and 1% NP-40 (lysis bu€er). Lysates were collected
by scraping and cleared by centrifugation at 48C. For
Western blotting analysis, 100 mg of cellular lysates were
loaded onto 10% SDS ± PAGE gels and transferred to
Protran membranes. Membranes were blocked for 1 h at
room temperature in 5% milk, washed with PBST (PBS with
0.1% tween), and incubated with anti-Oct-1, Gadd45, NFYA, NF-YB, NF-YC and actin antibodies (Santa Cruz
Biotechnology, Santa Cruz, CA, USA) for 2 h. Membranes
were washed four times in PBST and HRP-conjugated antirabbit antibody was added at 1 : 4000 in 5% milk. After 1 h,
membranes were washed and detected by ECL (Amersham,
Arlington Height, IL, USA) and exposed to X-ray ®lm. The
estimated bands were scanned using ImageQuaNT analyzer
Oncogene
The role of the Oct-1 and NF-YA in the induction of the GADD45 promoter
S Jin et al
2690
(Molecular Dynamics, Sunnyvale, CA, USA) for the
measurement of density (Zhan et al., 1996).
sample. Each value represented the average of at least three
separate determinations (Zhan et al., 1993).
CAT assay
EMSA
Measurement of CAT activity was carried out as described
previously (Zhan et al., 1993). Cells were collected and
resuspended in 0.25 M TRIS (pH 7.8). Cells were disrupted
by three cycles of freeze ± thaw. The equal amounts of protein
were used for each CAT assay. The CAT reaction mixture
was incubated at 378C overnight and the CAT activity was
determined by measuring the acetylation of 14C-labeled
chloramphenicol by the thin-layer chromatography. Radioactivity was measured directed with Betascope analyzer. The
speci®c CAT activity was calculated by determining the
fraction of chloramphenicol that had been acetylated. The
relative CAT activity was determined by normalizing the
activity of the treated samples to that of the untreated
Nuclear extracts were prepared and an electrophoretic
mobility shift assay (EMSA) was carried out as described
previously (Zhan et al., 1993). DNA binding reactions were
performed for 10 min at room temperature in a binding
bu€er containing 20 mM HEPES (pH 7.8), 150 mM NaCl,
1 mM dithiothreitol, 1 mg of poly(dIdC), 10% glycerol and
20 mg of nuclear protein. 46 104 d.p.m. of labeled probe. The
probe was a 51-mer double stranded synthetic oligonucleotide
containing the region spanning 7107 to 757 of the
GADD45 promoter. Each strand was labeled separately and
the strands were annealed, and then puri®ed by G-25 column.
The samples were analysed on a 4% non-denaturing
acrylamide gel.
References
Bergman Y, Rice D, Grosschedl R and Baltimore D. (1984).
Proc. Natl. Acad. Sci. USA, 81, 7041 ± 7045.
el-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R,
Trent JM, Lin D, Mercer WE, Kinzler KW and Vogelstein
B. (1993). Cell, 75, 817 ± 825.
Eraly SA, Nelson SB, Huang KM and Mellon PL. (1998).
Mol. Endocrinol., 12, 469 ± 481.
Fadel BM, Boutet SC and Quertermous T. (1999). J. Biol.
Chem., 274, 20376 ± 20383.
Fletcher C, Heintz N and Roeder RG. (1987). Cell, 51, 773 ±
781.
Fornace Jr AJ, Alamo Jr I and Hollander MC. (1988). Proc.
Natl. Acad. Sci. USA, 85, 8800 ± 8804.
Harkin DP, Bean JM, Miklos D, Song YH, Truong VB,
Englert C, Christians FC, Ellisen LW, Maheswaran S,
Oliner JD and Haber DA. (1999). Cell, 97, 575 ± 586.
Hinkley C and Perry M. (1992). Mol. Cell. Biol., 12, 4400 ±
4411.
Hollander MC, Sheikh MS, Bulavin DV, Lundgren K,
Augeri-Henmueller L, Shehee R, Molinaro TA, Kim KE,
Tolosa E, Ashwell JD, Rosenberg MP, Zhan Q,
Fernandez-Salguero PM, Morgan WF, Deng CX and
Fornace Jr AJ. (1999). Nat. Genet., 23, 176 ± 184.
Inamoto S, Segil N, Pan ZQ, Kimura M and Roeder RG.
(1997). J. Biol. Chem., 272, 29852 ± 29858.
Jenuwein T and Grosschedl R. (1991). Genes Dev., 5, 932 ±
943.
Jin S, Antinore MJ, Lung FD, Dong X, Zhao H, Fan F,
Colchagie AB, Blanck P, Roller PP, Fornace Jr AJ and
Zhan Q. (2000a). J. Biol. Chem., 275, 16602 ± 16608.
Jin S, Zhao H, Fan F, Blanck P, Fan W, Colchagie AB,
Fornace Jr, AJ and Zhan Q. (2000b). Oncogene, 19, 4050 ±
4057.
Kastan MB, Zhan Q, el-Deiry WS, Carrier F, Jacks T, Walsh
WV, Plunkett BS, Vogelstein B and Fornace Jr AJ. (1992).
Cell, 71, 587 ± 597.
LaBella F, Sive HL, Roeder RG and Heintz N. (1988). Genes
Dev., 2, 32 ± 39.
Levine AJ. (1997). Cell, 88, 323 ± 331.
Mantovani R. (1999). Gene, 239, 15 ± 27.
Oncogene
Matuoka K and Yu Chen K. (1999). Exp. Cell. Res., 253,
365 ± 371.
Miyashita T and Reed JC. (1995). Cell, 80, 293 ± 299.
Murphy S, Pierani A, Scheidereit C, Melli M and Roeder
RG. (1989). Cell, 59, 1071 ± 1080.
Papathanasiou MA, Kerr NC, Robbins JH, McBride OW,
Alamo Jr I, Barrett SF, Hickson ID and Fornace Jr AJ.
(1991). Mol. Cell. Biol., 11, 1009 ± 1016.
Prives C and Hall PA. (1999). J. Pathol., 187, 112 ± 126.
Roberts SB, Segil N and Heintz N. (1991). Science, 253,
1022 ± 1026.
Schwachtgen JL, Remacle JE, Janel N, Brys R, Huylebroeck
D, Meyer D and Kerbiriou-Nabias D. (1998). Blood, 92,
1247 ± 1258.
Sturm RA, Dalton S and Wells JR. (1988a). Nucleic Acids
Res., 16, 8571 ± 8586.
Sturm RA, Das G and Herr W. (1988b). Genes Dev., 2,
1582 ± 1599.
Takekawa M and Saito H. (1998). Cell, 95, 521 ± 530.
Zhan Q, Antinore MJ, Wang XW, Carrier F, Smith ML,
Harris CC and Fornace Jr AJ. (1999). Oncogene, 18,
2892 ± 2900.
Zhan Q, Bae I, Kastan MB and Fornace Jr AJ. (1994a).
Cancer Res., 54, 2755 ± 2760.
Zhan Q, Carrier F and Fornace Jr AJ. (1993). Mol. Cell.
Biol., 13, 4242 ± 4250.
Zhan Q, Chen IT, Antinore MJ and Fornace Jr AJ. (1998).
Mol. Cell. Biol., 18, 2768 ± 2778.
Zhan Q, Fan S, Bae I, Guillouf C, Liebermann DA,
O'Connor PM and Fornace Jr AJ. (1994b). Oncogene, 9,
3743 ± 3751.
Zhan Q, Fan S, Smith ML, Bae I, Yu K, Alamo Jr I,
O'Connor PM and Fornace Jr AJ. (1996). DNA Cell Biol.,
15, 805 ± 815.
Zhan Q, Lord KA, Alamo Jr I, Hollander MC, Carrier F,
Ron D, Kohn KW, Ho€man B, Liebermann DA and
Fornace Jr AJ. (1994c). Mol. Cell. Biol., 14, 2361 ± 2371.
Zhao H, Jin S, Fan F, Fan W, Tong T and Zhan Q. (2000).
Cancer Res., 60, 6276 ± 6280.