Download Targeting to the T. gondii plastid

3969
Journal of Cell Science 113, 3969-3977 (2000)
Printed in Great Britain © The Company of Biologists Limited 2000
JCS1679
Analysis of targeting sequences demonstrates that trafficking to the
Toxoplasma gondii plastid branches off the secretory system
Amy DeRocher1,2, Christopher B. Hagen2, John E. Froehlich3, Jean E. Feagin1,2 and Marilyn Parsons1,2,*
1Department
of Pathobiology, School of Public Health and Community Medicine, University of Washington, Seattle, WA 98195,
USA
2Seattle Biomedical Research Institute, 4 Nickerson St., Seattle, WA 98109, USA
3MSU-DOE Plant Research Laboratory, Michigan State University, East Lansing, MI 48824, USA
*Author for correspondence at address 2 (e-mail: [email protected])
Accepted 14 September; published on WWW 31 October 2000
SUMMARY
Apicomplexan parasites possess a plastid-like organelle
called the apicoplast. Most proteins in the Toxoplasma
gondii apicoplast are encoded in the nucleus and imported
post-translationally. T. gondii apicoplast proteins often
have a long N-terminal extension that directs the protein to
the apicoplast. It can be modeled as a bipartite targeting
sequence that contains a signal sequence and a plastid
transit peptide. We identified two nuclearly encoded
predicted plastid proteins and made fusions with green
fluorescent protein to study protein domains required for
apicoplast targeting. The N-terminal 42 amino acids of the
apicoplast ribosomal protein S9 directs secretion of green
fluorescent protein, indicating that targeting to the
apicoplast proceeds through the secretory system. Large
sections of the S9 predicted transit sequence can be deleted
with no apparent impact on the ability to direct green
fluorescent protein to the apicoplast. The predicted transit
peptide domain of the S9 targeting sequence directs protein
to the mitochondrion in vivo. The transit peptide can also
direct import of green fluorescent protein into chloroplasts
in vitro. These data substantiate the model that protein
targeting to the apicoplast involves two distinct
mechanisms: the first involving the secretory system and
the second sharing features with typical chloroplast protein
import.
INTRODUCTION
indicates that apicoplasts are the site of non-mevolonate
isoprene synthesis, a pathway not found in metazoans (Jomaa
et al., 1999). Fosmidomycin is a specific inhibitor of this
pathway and is an effective therapy for Plasmodium vinckei
infection in rats (Jomaa et al., 1999). Likewise, enzymes of
type II fatty acid biosynthesis reside in the plastid, and
thiolactomycin, which inhibits this pathway in other
organisms, is toxic to malaria parasites but has little effect on
the mammalian host cell (Waller et al., 1998).
Only a small fraction of the proteins in plastids are encoded
by the corresponding plastid genome; most plastid proteins
are encoded in the nucleus, and imported post-translationally
from the cytoplasm into the plastid (Keegstra and Cline,
1999). Proteins destined to reside in plastids that have two
membranes, such as the chloroplasts of green plants, typically
have an N-terminal transit peptide, which is cleaved upon
import. This transit peptide, typically rich in hydroxylated
and basic residues, is both necessary and sufficient for
translocation.
In contrast to plant chloroplasts, the plastids of several other
organisms are surrounded by either three or four membranes.
These plastids are thought to have been acquired through
a secondary endosymbiosis (McFadden and Gilson, 1995;
Palmer and Delwiche, 1996). Protein transport to these plastids
Toxoplasma gondii is an obligate intracellular parasite that is
capable of infecting all mammalian cell types and establishing
a latent infection in the host organism. T. gondii is a unicellular
parasite and during the tachyzoite phase of its life cycle it
resides in a parasitophorous vacuole within the host cell where
it divides synchronously every 8-10 hours. The host cell then
lyses, releasing up to 28 tachyzoites, which infect new host
cells. Tachyzoites can also differentiate into bradyzoites, which
are a quiescent cyst-forming stage that can persist for the
lifetime of the host (Lüder and Gross, 1998). The infection is
suppressed by the immune system in healthy individuals,
but T. gondii causes significant morbidity and mortality
in immunocompromised individuals, including AIDS and
chemotherapy patients. T. gondii is also a leading cause of birth
defects. It is used as a model system for other apicomplexan
parasites including Plasmodium sp., the causative agent of
malaria.
T. gondii, like most other apicomplexan parasites, contains
an organelle that is related to plastids such as chloroplasts. This
organelle, called the apicoplast, is thought to be an essential
organelle (Fichera and Roos, 1997) and thus is an attractive
candidate as a therapeutic target. For example, recent evidence
Key words: Toxoplasma gondii, Apicoplast, Protein targeting,
Mitochondrion, Chloroplast
3970 A. DeRocher and others
is mediated by an N-terminal bipartite targeting sequence
composed of an ER signal sequence followed by a chloroplast
transit peptide-like domain (Schwartzbach et al., 1998). Like the
chloroplasts of diatoms and euglenoids, the T. gondii apicoplast
appears to have arisen by secondary endosymbiosis (Köhler et
al., 1997). The inner two membranes are presumably derived
from the chloroplast inner and outer membranes, the third from
the endosymbiont plasma membrane, and the outer membrane
from the phagocytic vacuole of the ancestral apicomplexan.
Sequence analysis suggests that the apicomplexan endosymbiont
was a green alga (Köhler et al., 1997).
The 35 kb apicoplast genome is the smallest plastid genome
described to date, with only a handful of protein coding genes.
Thus, it is likely that most apicoplast proteins are encoded in
the nucleus. A few nuclearly encoded plastid proteins of T.
gondii have been identified and these contain an N-terminal
extension with characteristics of a bipartite targeting peptide
(Waller et al., 1998). The N-terminal segment has
characteristics of an ER signal sequence, and the region
between the putative signal sequence cleavage site and the
predicted mature protein is rich in hydroxylated and basic
residues, characteristics of chloroplast transit peptides. The Nterminal extension of acyl carrier protein (ACP) has been
shown previously to direct a reporter protein to the apicoplast
(Waller et al., 1998). We demonstrate that, as predicted, the
targeting sequence of ribosomal protein S9 (S9) is functionally
bipartite, with the N-terminal portion targeting a reporter
protein for secretion. The transit portion is required for
localization to the apicoplast; however, much of the transit
peptide is dispensable for targeting to the organelle. The transit
peptide alone can target a reporter protein to the T. gondii
mitochondrion in vivo, and it is capable of directing import into
higher plant chloroplasts in vitro.
MATERIALS AND METHODS
Cloning and vector construction
A partial ribosomal protein S9 sequence (rps9 gene) was identified
from the T. gondii EST database, and the corresponding cDNA,
zy33g01, was obtained from Dr L. D. Sibley, rescued and sequenced.
The 5′ end of the rps9 cDNA was obtained by PCR amplification from
a cDNA library, TgME49 (gift of Drs J. Boothroyd and I. Manger),
with primers SC1 and SC2 (Table 1), cloned into pGEM-T and
sequenced (GenBank accession no. AF087139).
The T. gondii green fluorescent protein (GFP) expression vector
ptubP30-GFP/sag-CAT (Striepen et al., 1998), a gift from Drs D. Roos
and B. Streipen, was modified for better GFP fluorescence by
replacing the GFP coding sequence with GFP(S65T) provided by Dr
Kami Kim. An AvrII site (CCTAGG) was added to the 5′ end of the
GFP coding sequence to assist cloning. The initial S9 constructs were
prepared by polymerase chain reaction (PCR) amplification from
TgME49 DNA using primers that inserted a BglII site at the 5′ end
and an AvrII site at the 3′ end of the fragment. Fragments encoding
the indicated residues of S9 were amplified using the following
primers: S9(1-42), SA1s and SA5a; S9(1-159), SA1s and SA2a; and
S9(33-272), SA3s and SA4a. Primer sequences are listed in Table 1.
The fragments were cloned into pCR2.1TOPO (Invitrogen, Carlsbad,
CA, USA) and the sequences verified. The inserts were removed by
digestion with AvrII and BglII and cloned into the modified ptubP30GFP/sag-CAT vector that had been digested with the same enzymes
to excise P30. The resulting plasmids pS9(1-42)-GFP, pS9(1-159)GFP and pS9(33-272)-GFP, encode GFP fusion proteins with the T.
gondii S9 sequence at the N terminus. The S9 and junction regions
were verified by DNA sequencing.
Sequences encoding residues 1-143 of the predicted apicoplast
ribosomal protein L28 were amplified from cDNA library TgME49
using primers LA1s and LA2a. The acpP coding sequence was PCR
amplified using primers AA1s and AA2a (Table 1) as described
(Waller et al., 1998). The resulting fragments were cloned into
pCR2.1TOPO, verified by sequencing, and then cloned into the T.
gondii GFP expression plasmid as described above.
Deletion constructs were generated from pS9(1-159)-GFP using the
Quick Change Site Directed Mutagenesis kit (Stratagene, LaJolla,
CA, USA) according to the manufacturer’s protocol. The construct
pS9(1-132)-GFP was generated using primers SM1s and SM2a,
pS9(1-95)-GFP was generated using SM3s and SM4a, and pS9(146,79-159)-GFP was generated using SM5s and SM6a.
T. gondii transfection
The RH strain of T. gondii was grown in human foreskin fibroblasts
as described (Roos et al., 1994). Extracellular parasites were
transfected with 50 µg of circular plasmid (Roos et al., 1994) via
electroporation in a 2 mm cuvette at 2 kV, 25 µF using a Biorad Gene
Pulser II. A portion of the cells were used to inoculate chamber slides
for viewing 18-24 hours post-transfection, and the rest were subjected
to selection with 20 µM chloramphenicol to isolate stable
transfectants.
Microscopy
T. gondii were grown overnight on chamber slides and either viewed
directly, or processed for immunofluorescence assays. Slides were
fixed in 4% paraformaldehyde in PBS for 5 minutes, then processed
as described (Das et al., 1998). Primary antibodies were rabbit antiGFP (a gift from Dr Jim Cregg) (1:1000) and mouse anti-T. gondii
mitochondrial HSP60 (a gift from Dr Stanislas Tomavo) (1:100).
Secondary antibodies were Texas Red-coupled anti-rabbit IgG and
fluorescein isothiocyanate (FITC)-coupled anti-mouse IgG (Southern
Biotechnology, Birmingham, AL, USA). Where indicated, slides were
incubated with 10 mM 4,6-diamidino-2-phenylindole (DAPI) for 10
minutes. Slides were mounted with antifade (Molecular Probes,
Eugene, OR, USA) and viewed on a Nikon Microphot FX microscope
equipped with a Photometrics SenSys camera and MetaMorph
software. The DAPI filter had excitation and emission peaks of 360
and 460 nm, the Texas Red filter had excitation and emission peaks
of 560 and 630 nm, and the FITC filter had excitation and emission
peaks of 484 and 510, nm respectively. Extracellular parasites were
stained with 1 µg/ml MitoTracker Orange CM-H2-TMRos (Molecular
Probes, Eugene OR, USA) for 30 minutes, rinsed, then incubated with
Table 1. PCR primers
Name
Oligonucleotide sequence*
SC1
SC2
SA1s
SA2a
SA3s
SA4a
SA5a
SM1s
SM2a
SM3s
SM4a
SM5s
SM6a
LA1s
LA2a
AA1s
AA2a
CGGCTGCGTCTCTGTTGTTG
GGAACAGCTATGACCATG
AGATCTAAAATGGCCCTCGAACGTTG
CCTAGGCCTTGCATAAGACCTTTTCCG
AGATCTAAAATGACTGCCTTCATAGTCCCTCAAC
CCTAGGCCGTTTGCTGTACTGTTCCTTC
CCTAGGCAGGTTGCGTTGAGGGACT
GATGCGACACTCTCAATGCATAAAGGAGAAC
GTTCTCCTTTATGCATTGAGAGTGTCGCATC
CGGCCTGGTCTGCGATGCATAAAGGAGAAC
GTTCTCCTTTATGCATCGCAGACCAGGCCG
CTGCATAGCTTTACCTCCCCTCGGTCACTC
GAGTGACCGAGGGGAGGTAAAGCTATGCAG
AGATCTAAAATGCAACGACCAAGGAGCGGG
CCTAGGGCACTCCATAGCCTGAAGAGG
GGAAGATCTAAAATGGAGATGCATCCCCGCAACGC
TGGACCTAGGCCGATCATCAGAACTCGCCTCGT
*Restriction endonuclease recognition sites are underlined.
Targeting to the T. gondii plastid 3971
fibroblasts for 2 hours prior to viewing. This procedure avoided the
staining of host cell mitochondria, which cluster around the parasite
(Sinai et al., 1997). Where indicated, cells were incubated with 10 µM
cycloheximide for 1 hour prior to viewing. This concentration of
cycloheximide has been shown to be sufficient to inhibit >95% protein
synthesis in parasites (Beckers et al., 1995). Longer cycloheximide
treatment resulted in an increasing proportion of cells (of both cell
lines) showing atypical morphology and aberrant fluorescence
patterns.
In vitro transcription and translation
For in vitro translation reactions, the GFP fusion inserts were PCRamplified from the T. gondii GFP expression plasmids using primers
SA3s and SA4a. The PCR products were cloned into pGEM easyT
(Promega, Madison, WI, USA) and sequenced. In vitro
transcription/translation reactions were performed using either a T7
TnT-coupled wheat germ extract system (Promega, Madison WI,
USA) (for the experiments shown in Fig. 5), or sequential T7
transcription and translation using a wheat germ extract (for the
experiments shown in Fig. 6). For import assays, synthesized proteins
were labeled with [35S]methionine (NEN, Boston, MA, USA; 43
TBq/mmol) according to the manufacturer’s protocol. In vitro
translation of chloroplast ribulose-1,5-bis phosphate carboxylase/
oxygenase small subunit (RSS) from Pisum sativum was performed
using the rabbit reticulocyte system (Promega, Madison WI, USA).
Immunoblot analysis
Lysates were prepared from 107 T. gondii stably transfected with the
indicated constructs by suspending washed parasites in SDS-sample
buffer and boiling for 2 minutes. Samples were analyzed by SDSPAGE, and immunoblotted using anti-GFP (1:10,000 dilution). Bound
antibody was detected with 125I-protein A (NEN, Boston MA, USA).
Protein import into chloroplasts
Proteins were translated in vitro and then imported into isolated pea
chloroplasts as previously described (Bruce et al., 1994). Intact
chloroplasts were recovered by sedimentation through a 40% (v/v)
Percoll cushion and treated with thermolysin as described (Cline et
al., 1984) in the presence or absence of 1% v/v Triton X-100 (final
concentration). The proteolytic digestion was stopped by the addition
of EDTA to 10 mM. Chloroplasts were sedimented through 40%
Percoll containing 5 mM EDTA and the resulting pellets were
resuspended in lysis buffer (25 mM Hepes-KOH, pH 8.0, 4 mM
MgCl2), and incubated on ice for 15 minutes. After ultracentrifugation
at 100,000 g, crude membrane and soluble fractions were obtained
and solubilized in 2× SDS-PAGE sample buffer. All fractions were
analyzed by SDS-PAGE and fluorography.
RESULTS
The N-terminal extension of apicoplast proteins
confers targeting
We searched for the T. gondii database for sequences related
to known plant chloroplast proteins and identified several
possible apicoplast proteins, including ribosomal proteins
S9 and L28, and ACP. BLAST analysis (http://
www.ncbi.nln.nih.gov/BLAST/) (Altschul et al., 1997) showed
that the T. gondii S9 and L28 sequences were most similar to
chloroplast and bacterial homologues. T. gondii ACP was most
similar to bacterial ACPs, and had lower but significant
similarity to ACP from algae and plants. Recently, Waller et
al. (Waller et al., 1998) used specific antisera to show that ACP
and S9 localize to the plastid and suggested that L28 was also
a plastid protein. All three predicted proteins include over 100
amino acids (aa) N-terminal to the region of interspecies
conservation, consistent with the presence of N-terminal
targeting domains (Fig. 1A). SignalP analysis (http://
www.cbs.dtu.dk/services/SignalP/) (Nielsen et al., 1997)
predicts that S9, L28, and ACP are all targeted to
the ER using a cleavable signal sequence. ChloroP (http://
www.cbs.dtu.dk/services/ChloroP/) (Emanuelsson et al., 1999)
predicts that the region between the signal sequence and
conserved core of S9, L28 and ACP each could function as
chloroplast transit peptides.
Unmodified GFP is cytoplasmic when expressed in T. gondii
(Striepen et al., 1998). In order to analyze plastid targeting in
T. gondii, GFP fusion constructs were prepared in a T. gondii
expression vector (Striepen et al., 1998) (Fig. 1B). The
encoded proteins contain full-length ACP, aa 1-159 of S9 or aa
1-143 of L28 fused to the N terminus of GFP. The S9 fusion
protein included the predicted signal and transit sequences plus
approximately ten downstream residues to maintain context.
As expected from the studies of Waller et al. (Waller et al.,
1998), ACP-GFP localized to a single, dot-like region of the
cell (Fig. 2, pseudocolored green). Fig. 2 also shows DAPI
staining (pseudocolored red), which detects the nuclear and
apicoplast DNA but not the uncharacterized mitochondrial
genome (Feagin, 2000). The merged red and green signals
yield a yellow dot-like structure, demonstrating that this
compartment is indeed the apicoplast. The first 159 aa of S9
and the first 143 aa of L28 also efficiently targeted GFP to the
apicoplast (Fig. 2). This observation confirms that the Nterminal extension of several apicoplast proteins is sufficient
to direct a reporter protein to the apicoplast.
Deletion analysis of the S9 transit sequence
A series of deletion constructs was prepared to assess the
importance of different parts of the S9 transit peptide domain
in targeting GFP to the apicoplast. This region of S9 is over
100 aa long. We examined this region for consensus cleavage
sites for processing of proteins imported into chloroplasts. A
green algal consensus cleavage site (V X A ↓ X) (Franzén et
al., 1990) occurs at aa 92, and a dinoflagellate consensus
cleavage site (A X A ↓ X) (Sharples et al., 1996) occurs at aa
129 (Fig. 1A). While it is uncertain if T. gondii recognizes these
sites, we prepared deletion constructs specifying fusion
proteins spanning each site: pS9(1-95)-GFP and pS9(1-132)GFP. The encoded proteins include three residues downstream
of the possible cleavage site to maintain the potential cleavage
context. An additional deletion construct, pS9(1-46, 79-159)GFP, eliminated the region coding for 32 aa that had the least
similarity to canonical transit peptides. S9(1-95)-GFP (Fig. 2),
S9(1-46, 79-159)-GFP (Fig. 2) and S9(1-132)-GFP (data not
shown) all localized to the apicoplast. However in the parasites
expressing S9(1-46, 79-159)-GFP, some green fluorescence
was observed outside the plastid as well, suggesting that this
fusion protein was not targeted as efficiently as the others. This
evidence argues that a large segment of the T. gondii S9 transit
peptide is dispensable for targeting to the organelle.
We tested a further deletion of the transit sequence by
constructing pS9(1-42)-GFP, which encodes GFP fused to the
predicted signal sequence plus 10 aa of the transit peptide. If
the predicted signal sequence is functional, this protein would
be expected to be targeted for secretion. As a control, we used
P30-GFP (Fig. 3A,B), which is known to be secreted into the
3972 A. DeRocher and others
A
Ribosomal protein S9
MALERWCRGV
NLHSFTRNFR
RSLPGSVGQV
EPTALGADAT
RLPPGSGKLT
NEFDIIAEAH
RRAGFLTVDA
RCSLPSWAVM
VLPLVGKRWF
TAWSAVTEGC
LSSIPSELPE
INNRDAADYL
GGGLGGQSGA
RKVERKKFGL
CLAYFLCGPA
AGDAAVQHCK
PSFEDAVHET
PGTPRNSFSW
QDNPWWIHNC
IMLAVAREIV
RKARKKEQYS
VGTAFIVPQR
GWFQQTGLSP
SLPSDWVERS
GTRKRSYARV
IAPLMELQLE
RQRPELRPPL
KR 272
40
80
120
160
200
240
KTLLALALFM
GVCATPSTAS
SALFAADEAS
FIKDLDADSL
ALSYIEKAKS
ATSIASSYGF
LGTLGQPAGT
SDDRPLLERV
DSVELVMAFE
ATA 183
VSPGLIRFNY
VARRPGPFRS
KDVVADQLGV
EKFGVSIPDE
40
80
120
160
FRLSRWSASA
PSGCTNEFFW
STVRRHYGIK
GKMDNTKARN
RLRLSVKGIR
RMVSRLSLAG
KM 272
40
80
120
160
200
240
ACP
MEMHPRNAGR
RYGTCPNMSS
VSANVIGSPS
DRARINPESN
EASKIATVQD
Ribosomal protein L28
MQRPRSGRVC
LCPAQSPSCV
RRHGSQTALG
GRGGGKLRLG
RSHSRVATHK
TIKKYGLQRA
GTAGHINADE
VYLVTNVLLA
GTAHRLSTPL
ISSRRHLQVI
KHTGVPLQAM
VQRLNLHWKR
ADKFGLNLKK
IAGPLSGQRE
LSIWLSRASA
IAAGCELGSF
RRKKYRTKGT
ECPARRCMLL
LWWPEAGYYV
KKYYAGYSHR
TSTIARVDAA
B
Loc.
S9(1-159)-GFP
P
S9(1-132)-GFP
P
S9(1-95)-GFP
P
S9(1-46,79-159)-GFP
P
S9(1-42)-GFP
S
S9(33-159)-GFP
M
S9(33-272)-GFP
M
ACP(1-183)-GFP
P
L28(1-43)-GFP
P
P30-GFP
S
50 aa
Fig. 1. T. gondii apicoplast proteins and GFP fusions. (A) The
predicted aa sequences of S9, ACP and L28 are shown. The font
indicates the approximate region of the protein as predicted by
sequence analysis: signal sequence in bold; transit in italics; mature
protein in regular font. The latter was deduced by homology to the
corresponding mature proteins as follows: Arabidopsis thaliana S9,
Cryptomonas ACP and A. thaliana L28. The transit peptide cleavage
site predicted by ChloroP, which applies to land plants, is bold
underlined. The residues in each sequence in the –1 position of
putative green algal and dinoflagellate transit peptide cleavage
consensus sites are single and double underlined, respectively.
(B) GFP fusion proteins expressed in T. gondii. Regions
corresponding to the putative signal sequence of each protein are
diagonally striped, the putative transit peptide is stippled, and the
mature domain is solid. GFP is fused at the C terminus of the
depicted segments. Observed targeting of the proteins in T. gondii is
shown at the right: plastid (P), secretory system/parasitophorous
vacuole (S) and mitochondrion (M).
parasitophorous vacuole by dense granules (the GFP fusion
protein lacks the P30 glycophosphatidyl inositol anchor site;
Striepen et al., 1998). In cells expressing pS9(1-42)-GFP,
fluorescence was clearly observed in the parasitophorous
vacuole, indicating that some of the S9(1-42)-GFP had been
secreted. Additionally, fluorescence was seen within the
parasite itself (Fig. 3E,F). When these cells were treated with
10 µM cycloheximide for 1 hour, less intracellular fluorescence
was seen (Fig. 3G,H). This observation suggests that the
intracellular fluorescence seen in the pS9(1-42)-GFP cell line
may represent proteins en route to the parasitophorous vacuole.
Cycloheximide treatment had little effect on the fluorescence
pattern of cells expressing P30-GFP, since at steady state the
vast majority of that protein has already reached its destination
(Fig. 3C,D). Similarly, cycloheximide had no effect on the
fluorescence pattern of cells expressing apicoplast-targed GFP
fusions (not shown). Secretion of the S9(1-42)-GFP fusion
protein strongly argues that protein targeting to the apicoplast
utilizes the secretory system. The data also indicate that, in
addition to the signal sequence, information in the transit
peptide is required for S9 to reach its proper destination.
The S9 transit peptide targets to the mitochondrion
To further investigate the importance of the signal peptide in
apicoplast targeting, we prepared two constructs encoding S9GFP fusion proteins lacking the signal peptide: S9(33-272)GFP and S9(33-159)-GFP. Surprisingly, parasites expressing
these fusion proteins (Fig. 4C,D,I,J) did not produce the
cytoplasmic fluorescence seen with GFP alone (Fig. 4A,B).
Instead, fluorescence was confined to a thread-like structure,
which typically was located near the plasma membrane of the
parasite. This compartment is reminiscent of the T. gondii
mitochondrion (Seeber et al., 1998). In eukaryotes, the HSP60
proteins are restricted to plastids or mitochondria and are not
present in the secretory system or cytosol. Recently the
classical organelle marker HSP60 has been identified in T.
gondii (Yahiaoui et al., 1999) and has been shown to be
mitochondrial by microscopic analysis and subcellular
fractionation (Toursel et al., 2000). The pSORT plant matrix
(http://psort.nibb.ac.jp/) (Nakai and Kanehisa, 1992), which
predicts the compartments in a cell to which a given protein
are most likely to be targeted, predicts T. gondii HSP60 to
target to the mitochondrial matrix (0.50). We performed
colocalization studies of S9(33-272)-GFP and HSP60. GFP
was revealed with rabbit anti-GFP followed by Texas Red-goat
anti-rabbit IgG while HSP60 was revealed with mouse anti-T.
gondii HSP60 followed by FITC-goat anti-mouse IgG. S9(33272)-GFP (Fig. 4D) and HSP60 (Fig. 4E) colocalize within the
cell (Fig. 4F). In these experiments, the cells were fixed and
permeabilized prior to antibody treatment, which eliminated
intrinsic GFP fluorescence (Fig. 4G) while allowing staining
with anti-GFP (Fig. 4H). Recently, the mitochondrion of T.
gondii was shown to stain with Mitotracker (Melo et al., 2000).
In live cells intrinsic fluorescence of S9(33-159)-GFP (Fig. 4K)
colocalizes with Mitotracker staining (Fig. 4L, merged in Fig.
4M), confirming the identity of the compartment as the
mitochondrion. Similar colocalization was seen for S9(33272)-GFP and Mitotracker and for S9(33-159)-GFP and
HSP60 (not shown). Thus, the transit peptide of S9, when not
preceded by a signal sequence, efficiently targets GFP to the
mitochondrion.
Targeting to the T. gondii plastid 3973
Fig. 2. Subcellular localization of GFP
fusion proteins in T. gondii. The location of
the indicated GFP fusion protein in T. gondii
was examined by immunofluorescence
analysis using anti-GFP. Cells were
counterstained with DAPI. The images were
pseudocolored green for GFP and red for
DAPI; overlapping signals result in yellow
in the overlay. (Red pseudocoloring was
used for DAPI since it results in a more
obvious overlay than blue pseudocoloring).
The experiments used stable transfectants
expressing ACP-GFP, S9(1-159)-GFP and
S9(1-95)-GFP, and transient transfectants
expressing S9(1-46,79-159)-GFP and
L28(1-143)-GFP. All images are at the same
magnification; bar, 10 µm.
A positively charged, amphipathic
alpha helix is characteristic of
mitochondrial
targeting
sequences
(Rosie et al., 1988). Helical wheel
projection of the transit peptide domain
of S9 (Protean module, DNAStar
software) reveals such a helix between
aa 40 and 52 (data not shown). The
transit peptide domains of L28 and ACP
can also be modeled as amphipathic
alpha helices, albeit shorter helices than
that of S9. Protein sequences C-terminal
to the predicted signal sequence
cleavage sites of these proteins were
analyzed using the PSORT plant matrix.
These regions of T. gondii S9 and L28
were both predicted to have a strong
propensity to target to the mitochondrion
(0.64 and 0.73, respectively), while T.
gondii and P. falciparum ACP had a
lower (0.1) likelihood. GFP fused to the
transit peptide of the latter was recently
shown to be cytoplasmic in P.
falciparum (Waller et al., 2000). Similar
analysis of the sequences of proteins
targeted to other compartments in the secretory system (Gra1,
Gra2, Gra3, Gra4, Gra5, Gra6, Gra7, Gra8, Bip, apyrase,
NTPase II, Mic1, and Rop2) showed that they had a low (≤0.1)
likelihood of targeting to the mitochondrion.
In vivo processing
To assess whether the fusion proteins were proteolytically
processed, S9-GFP fusion proteins from transfected parasites
were analyzed by SDS-PAGE and immunoblotting with antiGFP. The migration of the in vivo expressed fusion proteins
(Fig. 5A) were then compared to the migration of in vitro
translated proteins (Fig. 5B). The in vivo expressed proteins
with an encoded signal sequence migrated similarly to in vitro
translation products lacking the signal sequence. For example,
S9(1-42)-GFP expressed in vivo migrated similarly to GFP
translated in vitro, and S9(1-95)-GFP and S9(1-159)-GFP
migrated similarly to in vitro translation products of S9(33-95)GFP and S9(33-159)-GFP, respectively. These data indicate
that the S9 signal sequence is removed in vivo. Since the
majority of S9(1-95)-GFP and S9(1-159)-GFP are not
processed to the size of GFP in vivo, it appears that much of
the transit peptide domain remained attached to GFP even
when the protein was localized to the apicoplast. Four
immunoreactive proteins were detected in parasites expressing
the mitochondrially targeted S9(33-159)-GFP (Fig. 5A), the
largest of which is slightly smaller than the in vitro translated
molecule, while the smallest comigrates with GFP. From the
gel profiles, it is clear that the fusion proteins, particularly
those with large segments of the S9 leader, migrated
anomalously slowly. The sequence does not show any obvious
clues as to why this should be. Cloning artifacts were ruled out
by DNA sequencing.
Chloroplast targeting
The bipartite targeting sequence model predicts that the transit
peptide domain of the targeting signal is derived from an
ancestral chloroplast transit peptide. We therefore tested the
ability of the transit peptide fusions S9(33-132)-GFP and
3974 A. DeRocher and others
Fig. 3. The S9 signal sequence directs secretion of GFP. T. gondii
were stably transformed with constructs encoding P30-GFP
(A-D) and S9(1-42)-GFP (E-H). Cells shown in (C,D,G,H) were
treated with cycloheximide for 1 hour prior to viewing. Green
fluorescence and transmitted light pictures of live cells are shown.
Bar, 10 µm.
S9(33-159)-GFP to be imported into pea chloroplasts in vitro
(Fig. 6). The nuclearly encoded chloroplast protein RSS and
GFP were used as positive and negative controls, respectively.
Proteins were synthesized by in vitro translation in the
presence of [35S]methionine and then incubated with purified
chloroplasts under import conditions. In each panel, the first
lane (T) shows the total in vitro translated protein profile. In
addition to the full-length product seen in the in vitro
translations, a few smaller species were also seen for the S9GFP fusions. Since the transcripts do not encode any
methionines between the start codon engineered for the transit
sequence and the in-frame methionine at the beginning of GFP,
we suggest that these species may represent premature
termination products. The next pair of lanes shows the
radiolabelled proteins that associated with chloroplasts (P lanes
contain the membrane proteins and S lanes contain the soluble
chloroplast proteins). The subsequent lanes show the
accessibility of the proteins to protease in the presence or
absence of detergent, used to test for translocation into a
membrane-bound compartment. Like RSS, S9(33-132)-GFP
and S9(33-159)-GFP associated with chloroplasts and were
Fig. 4. The S9 transit peptide directs proteins to the mitochondrion.
Parasites expressing GFP were viewed with transmitted light (A) and
for green fluorescence (B). T. gondii stably transfected with pS9(33-272)-GFP were fixed and viewed under visible light (C), or
stained with anti-GFP and Texas Red-anti-rabbit IgG (D); or with
anti-HSP60 and FITC anti-mouse IgG (E). Signals from D and E are
merged in (F). (G,H) Fixed cells stained with anti-GFP and Texas
Red secondary antibody, viewed in the green and red channels,
respectively. Live parasites transfected with S9(33-159)-GFP were
viewed under visible light (I) and green fluorescence (J), or stained
with Mitotracker then viewed under red (K) and green
(L) fluorescence and overlayed (M). Bars, 10 µm.
found in the soluble fraction. S9(33-132)-GFP and S9(33-159)GFP proteins were also protected from digestion with
thermolysin, but were sensitive to protease upon addition of
detergent. These data demonstrate that S9(33-132)-GFP and
S9(33-159)-GFP were imported and were not merely
associated with the chloroplasts. In contrast to the above
proteins, GFP was not imported into chloroplasts (Fig. 6) nor
Targeting to the T. gondii plastid 3975
Fig. 5. Processing of GFP fusion proteins in T. gondii. (A) GFP
fusion proteins in T. gondii. Lysates were prepared from parasites
stably transformed with the indicated clones and proteins were
separated by SDS-PAGE on a 10% acrylamide gel. The gel was
processed by immunoblotting with anti-GFP and bound antibodies
were revealed with 125I protein A and autoradiography. Numbers at
the left mark the migration of molecular mass markers (kDa). The
subcellular location of each GFP fusion protein is indicated at the
bottom: cytoplasm (C), secretory/parasitophorous vacuole (S),
plastid (P) and mitochondrion (M). (B) In vitro translation products.
The inserts of pGEM plasmids encoding GFP, S9(33-95)-GFP, and
S9(33-159)-GFP were transcribed, translated in vitro and separated
by SDS-PAGE. The gels were processed by immunoblotting with
anti-GFP antiserum as above.
was S9(33-46, 79-159)-GFP (not shown). Thus, the ability of
the transit peptide deletion constructs to direct GFP to
chloroplasts in vitro generally, but not perfectly, reflects the
ability of the same peptides to direct GFP to the T. gondii
apicoplast in vivo.
For the imported GFP fusion proteins, the major species
(marked by arrowheads) is approximately 10 kDa smaller than
the full-length in vitro translation product. A smaller imported
species (approximately the size of GFP) is also seen, as well
as some intermediately sized molecules. The ChloroP program
predicted that the transit peptide domain of S9 could direct
import into the chloroplast with a proposed processing protease
cleavage site at aa 89 using the land plant consensus. Our data
are consistent with the hypothesis that the S9-GFP fusions are
imported into pea chloroplasts with an initial cleavage site near
that predicted by ChloroP, followed by additional proteolysis
within the chloroplast.
DISCUSSION
Multiple factors make the study of the T. gondii plastid
particularly interesting. Protein targeting to the apicoplast is
probably essential for parasite viability, and as such may be
a useful target for novel pharmaceuticals. Additionally,
understanding protein targeting to plastids in evolutionarily
divergent organisms will help highlight the essential shared
features of this process in chloroplasts and apicomplexan
parasites. Since T. gondii tachyzoites are haploid and are
amenable to targeted gene replacement, T. gondii is a potential
Fig. 6. Chloroplast targeting. The indicated proteins were translated
in vitro in the presence of [35S]methionine and incubated with
chloroplasts. After import, chloroplasts were sedimented through a
Percoll cushion, and incubated with or without thermolysin and
Triton X-100 as indicated. The chloroplasts were hypotonically
lysed, and then separated into pellet (P) and supernatant (S)
fractions. The pellet fractions made in the absence of Triton X-100
contain the membranes. Protein samples were analyzed by SDSPAGE on a 7.5%-15% acrylamide gradient gel and viewed by
fluorography. Arrowheads indicate migration of the largest imported
protein. Total in vitro translation products are shown in lane T.
model system for understanding protein import into complex
plastids.
Two groups have demonstrated that chimeric proteins
expressed in T. gondii can target to the apicoplast (Waller et
al., 1998; Jomaa et al., 1999). Waller et al. demonstrated that
the N-terminal 104 aa of ACP is sufficient to target a reporter
protein to the apicoplast. They also proposed that, as seen in
other plastids with more than two membranes, a bipartite
targeting sequence directs targeting to the apicoplast. We have
extended this work by demonstrating the ability of the N
terminus of additional proteins, S9 and L28, to target GFP to
the apicoplast in vivo. More importantly, we have shown that
the targeting sequence can be functionally separated into
two domains that direct a reporter protein to different
compartments in vitro and in vivo.
The predicted signal sequence of S9, when fused to GFP,
directed secretion of the reporter protein. The signal sequence
was removed from GFP in parasites transfected with S9(1-42)GFP, consistent with import into the ER. Since the signal
sequence is both sufficient for ER targeting and necessary for
apicoplast targeting, transport to the apicoplast must proceed
through the endomembrane system. Shortly before submission
of this work, Waller et al. reported that the predicted signal
sequence of P. falciparum ACP targets GFP for secretion in
3976 A. DeRocher and others
that organism (Waller et al., 2000). Taken together, the data
indicate that trafficking through secretory system is likely to
be a general feature of apicoplast targeting.
Our data also show the necessity of a transit sequence to
direct the reporter to the plastid once it has entered the
secretory system. Like chloroplast transit peptides, the T.
gondii plastid transit peptides have no primary sequence
similarity, yet are rich in basic and, to a somewhat lesser extent,
hydroxylated amino acids. We found that substantial portions
of the T. gondii S9 transit peptide could be deleted with no
apparent effect on targeting to the apicoplast, raising the
possibility that some information may be redundant or
extraneous. It is also possible that these partial transit
sequences target GFP to one of the apicoplast membranes
or intermembrane spaces, as this would probably be
indistinguishable from lumenal targeting in our
immunofluorescence assays. The most abundant products
in parasites expressing S9(1-95)-GFP or S9(1-159)-GFP
comigrate with the corresponding in vitro translation products
lacking the signal sequence. Thus, these fusion proteins are
apparently not processed further upon localization to the
apicoplast. Whether this finding results from inefficient
processing, improper presentation of the cleavage site, or
intermediate localization as mentioned above remains unclear.
Interestingly, immunoblots of the endogenous protein using
anti-S9 show relatively high levels of precursor (Waller et
al., 1998), suggesting that plastid processing of S9 may be
inefficient.
The need for both signal sequence and transit peptide in
apicoplast targeting can be traced in an evolutionary flow
diagram incorporating a secondary endosymbiosis (Bhaya and
Grossman, 1991). The secondary endosymbiont theory posits
that the progenitor apicomplexan internalized a photosynthetic
alga already containing a plastid (Köhler et al., 1997). Plastid
proteins encoded in the algal nucleus already had a transit
peptide to direct them to the chloroplast. Captured within a
phagocytic vacuole of the parasite’s endomembrane system,
the endosymbiont transferred genes for plastid proteins to the
apicomplexan nucleus. At this point, they acquired sequences
specifying an N-terminal signal peptide to direct them into the
endomembrane system. From there, the proteins would be
targeted to the apicoplast using their transit peptide. Our
data show that the transit peptide of apicoplast S9 can direct
import of a reporter protein into isolated pea chloroplasts,
emphasizing the functional similarity of the transit peptides for
the two organelles.
Consistent with the model above, bipartite signal sequences
have also been described for other organisms whose plastids
are thought to have been acquired through secondary
endosymbioses (reviewed by Schwartzbach et al., 1998).
Examples include diatoms, which possess chloroplasts with four
membranes, and euglenoids, whose chloroplasts have three
membranes. In diatom bipartite targeting sequences, the ER
signal sequence function has been demonstrated by its ability to
mediate import into microsomes (Bhaya and Grossman, 1991;
Lang and Apt, 1998). The transit peptide portion of at least one
protein, the ATPase γ subunit, can direct translocation into pea
chloroplasts in vitro. In euglenoids, chloroplast proteins that are
encoded in the nucleus, such as light harvesting complex protein
II, have a bipartite targeting sequence with an N-terminal ER
signal sequence and a region resembling a typical chloroplast
transit peptide (Kishore et al., 1993). Transport of this protein
through the Golgi has been detected by immunoelectron
microscopy (Osafune et al., 1991) and by density gradient
sedimentation (Sulli and Schwartzbach, 1995). These data
suggest that proteins destined for euglenoid plastids are
transported through the Golgi to the plastid via vesicles that fuse
with the outer of the three chloroplast membranes, and then the
proteins are imported in a conventional manner. In T. gondii and
diatoms, however, a fourth membrane must be passed; how this
occurs is still unknown.
The transit peptide segment of the S9 targeting sequence
directed GFP to the T. gondii mitochondrion. This crosstargeting emphasizes the similarity of chloroplast and
mitochondrial targeting sequences: both are at the N terminus,
rich in serine and threonine, and poor in acidic residues (von
Heijne et al., 1989). However, the secondary structure of the
two types of targeting sequences differ, with mitochondrial
targeting sequences generally forming an amphipathic alpha
helix. The vast majority of targeting peptides direct proteins
exclusively to a single organelle, but there are a few examples
of transit peptides that direct proteins to both chloroplasts
and mitochondria in vivo. Arabidopsis thaliana has a single
methionyl-tRNA synthase, which is imported into both
chloroplasts and mitochondria both in vivo and in vitro
(Menand et al., 1998). Other examples of dual targeting include
the leader sequences of a yeast mitochondrial cytochrome
oxidase subunit Va and pea chloroplast glutathione reductase,
each of which can target to both chloroplasts and mitochondria
in transgenic tobacco in vivo (Huang et al., 1990; Creissen et
al., 1995). The rarity of dual targeting corroborates the
intuitively obvious importance of maintaining distinct targeting
mechanisms to the two organelles in higher plants. T. gondii
has achieved this in part by sequestering the plastid within the
secretory system.
The ability of the S9 transit peptide to direct a reporter
protein to the mitochondrion in vivo, the chloroplast in vitro,
and the apicoplast when preceded by a signal peptide is a
striking example of the similarity of certain organellar import
signals. Our data suggest that the characteristics recognized by
the apicoplast import apparatus and those recognized by the T.
gondii mitochondrial import apparatus are not mutually
exclusive. Linking the apicoplast targeting mechanisms to the
secretory system likely has reduced the selective pressure to
maintain distinct specificities for interactions between
targeting sequences and the plastid or mitochondrial import
receptors in Toxoplasma gondii.
We would like to thank Drs David Roos and Boris Streipen for the
T. gondii expression vector, Dr Jim Cregg for anti-GFP antiserum, Dr
Stanislas Tomavo for anti-HSP60 antiserum, Drs John Boothroyd and
Ian Manger for the Me49 tachyzoite cDNA library, the WashU-Merck
T. gondii EST project for clones, and Michelle Wurscher for help with
T. gondii tissue culture. This work was supported in part by NIH AI
42493 and by the Murdock Charitable Trust. J. Froehlich was
supported by the Cell Biology Program of the National Science
Foundation (MCB-9904524) to Kenneth Keegstra.
REFERENCES
Altschul, S. F., Madden, T. L., Schaffer, A. S., Zhang, J., Zhang, Z., Miller,
W. and Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new
Targeting to the T. gondii plastid 3977
generation of protein database search programs. Nucleic Acids Res. 25,
3389-3402.
Beckers, C. J. M., Roos, D. S., Donald, R. G. K., Luft, B. J., Schwab, J.
C., Cao, Y. and Joiner, K. A. (1995). Inhibition of cytoplasmic and
organellar protein synthesis in Toxoplasma gondii. Implications for the
target of macrolide antibiotics. J. Clin. Invest. 95, 367-376.
Bhaya, D. and Grossman, A. (1991). Targeting proteins to diatom plastids
involves transport through an endoplasmic reticulum. Mol. Gen. Genet. 229,
400-404.
Bruce, B., Perry, S., Froehlich, J. and Keegstra, K. (1994). In vitro import
of protein into chloroplasts. In Plant Molecular Biology Manual (ed. S. B.
Gelvin and R. B. Schilperoort), pp.1-15. Kluwer Academic Publishers,
Boston.
Cline, K., Werner-Washburne, M., Andrews, J. and Keegstra, K. (1984).
Thermolysin is a suitable protease for probing the surface of intact pea
chloroplasts. Plant Physiol. 75, 675-678.
Creissen, G., Reynolds, H., Xue, Y. and Mulineaux, P. (1995). Simultaneous
targeting of pea glutathione reductase and of a bacterial fusion protein to
chloroplasts and mitochondria in transgenic tobacco. Plant J. 8, 167-175.
Das, A., Park, J.-H., Hagen, C. B. and Parsons, M. (1998). Distinct domains
of a nucleolar protein mediate protein kinase binding, interaction with
nucleic acids and nucleolar localization. J. Cell Sci. 111, 2615-2623.
Emanuelsson, O., Nielsen, H. and von Heijne, G. (1999). ChloroP, a neural
network-based method for predicting chloroplast transit peptides and their
cleavage sites. Protein Sci. 8, 978-984.
Feagin, J. E. (2000). Mitochondrial genome diversity in parasites. Int. J.
Parasitol. 30, 371-390.
Fichera, M. E. and Roos, D. S. (1997). A plastid organelle as a drug target
in apicomplexan parasites. Nature 390, 407-409.
Franzén, L.-G., Rochaix, J.-D. and von Heijne, G. (1990). Chloroplast
transit peptides from the green alga Chlamydomonas reinhardtii share
features with both mitochondrial and higher plant chloroplast preseqeunces.
FEBS Lett. 260, 165-168.
Huang, J., Hack, E., Thornburg, R. W. and Myers, A. M. (1990). A yeast
mitochondrial leader peptide functions in vivo as a dual targeting signal for
both chloroplasts and mitochondria. Plant Cell 2, 1249-1260.
Jomaa, H., Wiesner, J., Sanderbrand, S., Altincicek, B., Weidemeyer, C.,
Hintz, M., Türbachova, I., Eberl, M., Zeidler, J., Lichtenthaler, H. K.,
Soldati, D. and Beck, E. (1999). Inhibitors of the nonmevalonate pathway
of isoprenoid biosynthesis as antimalerial drugs. Science 285, 1573-1576.
Keegstra, K. and Cline, K. (1999). Protein import and routing systems of
chloroplasts. Plant Cell 11, 557-570.
Kishore, R., Muchhal, U. S. and Schwartzbach, S. D. (1993). The
presequence of Euglena LHCPII, a cytoplasmically synthesized chloroplast
protein, contains a functional endoplasmic reticulum-targeting domain.
Proc. Natl. Acad. Sci. USA 90, 11845-11849.
Köhler, S., Delwiche, C. F., Denny, P. W., Tilney, L. G., Webster, P., Wilson,
R. J. M., Palmer, J. D. and Roos, D. S. (1997). A plastid of probable green
algal origin in apicomplexan parasites. Science 275, 1485-1489.
Lang, M. and Apt, K. E. K. P. G. (1998). Protein import into ‘complex’
diatom plastids utilizes two different targeting signals. J. Biol. Chem. 273,
30973-30978.
Lüder, C. G. K. and Gross, U. (1998). Toxoplasmosis: from clinics to basic
science. Parasitol. Today 14, 43-45.
McFadden, G. and Gilson, P. (1995). Something borrowed, something green:
lateral transfer of chloroplasts by secondary endosymbiosis. Trends Ecol.
Evol. 10, 12-17.
Melo, E. J., Attias, M. and De Souza, W. (2000). The single mitochondrion
of tachyzoites of Toxoplasma gondii. J. Struct. Biol. 130, 27-33.
Menand, B., Marechal-Drouard, L., Sakamoto, W., Detroit, A. and
Whitness, H. (1998). A single gene of chloroplast origin codes for
mitochondrial and chloroplastic methionyl-tRNA synthetase in Arabidopsis
thaliana. Proc. Natl. Acad. Sci. USA 95, 11014-11019.
Nakai, K. and Kanehisa, M. (1992). A knowledge base for predicting protein
localization sites in eukaryotic cells. Genomics 14, 897-911.
Nielsen, H., Engelbrecht, J., Brunak, S. and von Heijne, G. (1997).
Identification of prokaryotic and eukaryotic signal peptides and prediction
of their cleavage sites. Protein Eng. 10, 1-6.
Osafune, T., Schiff, J. A. and Hase, E. (1991). Stage-dependent localization
of LHCP II apoprotein in the Golgi of synchronized cells of Euglena gracilis
by immunogold electron microscopy. Exp. Cell Res. 193, 320-330.
Palmer, J. D. and Delwiche, C. F. (1996). Second-hand chloroplasts and the
case of the disappearing nucleus. Proc. Natl. Acad. Sci. USA 93, 7432-7435.
Roos, D. S., Donald, R. G., Morrisette, N. S. and Moulton, A. L. (1994).
Molecular tools for genetic dissection of the protozoan parasite Toxoplasma
gondii. Meth. Cell Biol. 45, 27-63.
Rosie, D., Theiler, F., Horvath, S., Tomich, J. M., Richards, J. H., Allison,
D. S. and Schatz, G. (1988). Amphiphilicity is essential for mitochondrial
presequence function. EMBO J. 7, 649-653.
Schwartzbach, S. D., Osafune, T. and Löffelhardt, W. (1998). Protein
import into cyanelles and complex chloroplasts. Plant Mol. Biol. 8, 247-263.
Seeber, F., Ferguson, D. J. and Gross, U. (1998). Toxoplasma gondii: a
paraformaldehyde-insensitive diaphorase activity acts as a specific
histochemical marker for the single mitochondrion. Exp. Parasitol. 89, 137139.
Sharples, F. P., Wrench, P. M., Ou, K. and Hiller, R. G. (1996). Two distinct
forms of the peridinin-chlorophyll a-protein from Amphidinum carterae.
Biochim. Biophys. Acta 1276, 117-123.
Sinai, A. P., Webster, P. and Joiner, K. A. (1997). Association of host cell
endoplasmic reticulum and mitochondria with the Toxoplasma gondii
parasitophorous vacuole membrane: a high affinity interaction. J. Cell Sci.
110, 2117-2128.
Striepen, B., He, C. Y., Matrajt, D., Soldati, D. and Roos, D. S. (1998).
Expression, secretion, and organellar targeting of the green fluorescent
protein in Toxoplasma gondii. Mol. Biochem. Parasitol. 92, 325-338.
Sulli, C. and Schwartzbach, S. D. (1995). The polyprotein precursor to the
Euglena light-harvesting chlorophyl a/b-binding protein is transported to the
Golgi apparatus prior to chloroplast import and polyprotein processing. J.
Biol. Chem. 270, 13084-13090.
Toursel, C., Dzierszinski, F., Bernigaud, A., Mortuaire, M. and Tomauo,
S. (2000). Molecular cloning, organellar targeting, and developmental
expression of mitochondrial chaperone HSP60 in Toxoplasma gondii. Mol.
Biochem. Parasitol. (in press).
von Heijne, G., Steppuhn, J. and Herrmann, R. G. (1989). Domain structure
of mitochondrial and chloroplast targeting peptides. Eur. J Biochem. 180,
535-545.
Waller, R. F., Keeling, P. J., Donald, R. G. K., Striepen, B., Handman, E.,
Lang-Unnasch, N., Cowman, A. F., Besra, G. S., Roos, D. S. and
McFadden, G. (1998). Nuclear-encoded proteins target to the plastid in
Toxoplasma gondii and Plasmodium falciparum. Proc. Natl. Acad. Sci. USA
95, 12352-12357.
Waller, R. F., Reed, M. B., Cowman, A. F. and McFadden, G. I. (2000).
Protein trafficking to the plastid of Plasmodium falciparum is via the
secretory pathway. EMBO J. 19, 1794-1802.
Yahiaoui, B., Dzierszinski, F., Bernigaud, A., Slomianny, C., Camus, D.
and Tomavo, S. (1999). Isolation and characterization of a subtractive
library enriched for developmentally regulated transcripts expressed during
encystation of Toxoplasma gondii. Mol. Biochem. Parasitol. 99, 223-235.