Download The Arabidopsis Rab5 Homologs Rha1 and Ara7 Localize to the

Plant Cell Physiol. 45(9): 1211–1220 (2004)
JSPP © 2004
The Arabidopsis Rab5 Homologs Rha1 and Ara7 Localize to the Prevacuolar
Compartment
Gil-Je Lee 1, Eun Ju Sohn 1, Myong Hui Lee and Inhwan Hwang 2
Center for Plant Intracellular Trafficking and Division of Molecular and Life Sciences, Pohang University of Science and Technology, Pohang,
790-784 Korea
;
Rha1, an Arabidopsis Rab5 homolog, plays a critical
role in vacuolar trafficking in plant cells. In this study, we
investigated the localization of Rha1 and Ara7, two Arabidopsis proteins that have highly similar amino acid
sequence homology to Rab5 in animal cells. Both Ara7 and
Rha1 gave a punctate staining pattern and colocalized when
transiently expressed as GFP- (green fluorescent protein) or
small epitope-tagged forms in Arabidopsis protoplasts. In
protoplasts, transiently expressed Rha1 and Ara7 colocalized with AtPEP12p and VSRAt-1, two proteins that are
known to be present at the prevacuolar compartment
(PVC). Furthermore, endogenous Rha1 also gave a punctate staining pattern and colocalized with AtPEP12p to the
PVC. Mutations in the first and second GTP-binding motifs
alter the localizations of GFP: Rha1[S24N] in the cytosol
and Rha1[Q69L] in the tonoplast of the central vacuole.
Also, mutations in the effector domain and the prenylation
site inhibit membrane association of Rha1. Based on these
results, we propose that Rha1 and Ara7 localize to the PVC
and that GTP-binding motifs as well as the effector domain
are important for localization of Rha1 to the PVC.
Keywords: Arabidopsis — Localization of GFP fusion proteins — Prevacuolar compartment — Rab proteins — Small
GTP-binding proteins.
Introduction
Many small GTP-binding proteins in the ras superfamily
play important roles in various intracellular trafficking steps
(Chavrier et al. 1990, Morimoto et al. 1991, Horazdovsky et al.
1994, Pfeffer 1994, Singer-Kruger et al. 1994, Vadlamudi et al.
2000). These small GTP-binding proteins are divided into three
major subfamilies based on their amino acid sequence homology and biological functions. ADP-ribosylation factors (ARFs)
are involved in assembly of coat protein complexes I (COPI)
vesicles at the Golgi apparatus and recruitment of adaptor proteins at the trans-Golgi network (TGN) and endosomes (Balch
et al. 1992, Ooi et al. 1998, Wieland and Harter 1999, Lee et al.
2002). In contrast, Rab proteins found in various compartments are thought to be involved in the targeting/fusion of vesi1
2
cles to target compartments (Pfeffer 1994, Singer-Kruger et al.
1994, Rybin et al. 1996, Sonnichsen et al. 2000). Another
group of proteins in the Rho/Rac subfamily regulates actin filaments important in vesicle trafficking as well as other cellular
processes (Ridley 2001).
The Rab subfamily, the largest of these three subfamilies
(Pfeffer 1994, Stenmark et al. 1994, Novick and Zerial 1997),
includes more than 40 proteins that localize to different
organelles or are involved in different intracellular trafficking
steps in various organisms (Bucci et al. 1992, Chen et al. 1993,
Ullrich et al. 1993, Horazdovsky et al. 1994, Dugan et al. 1995,
Feng et al. 1995, Novick and Zerial 1997, Zuk and Elferink
1999, Allan et al. 2000, Batoko et al. 2000, Prekeris et al. 2000,
Sonnichsen et al. 2000). One proposed function of the Rab
family proteins is facilitation of the interaction between the
v- and t-SNAREs involved in the fusion of vesicles to target
membranes (Rybin et al. 1996, Novick and Zerial 1997, Waters
and Pfeffer 1999). In addition, Rab proteins may be involved in
generating vesicles at the donor membranes (Prekeris et al.
2000).
Many Rab proteins have been identified and characterized
at the molecular level in plant cells (Terryn et al. 1993, Borg
and Poulsen 1994, Haizel et al. 1995, Kim et al. 1996, Vernoud
et al. 2003). Rutherford and Moore (2002) recently reported
that the Arabidopsis genome encodes 57 different isoforms of
Rab proteins and that 48 of these are cDNAs or expressed
sequence tags (ESTs) or can be amplified from cDNA. However, in most cases, their specific roles have not been directly
demonstrated but inferred from their amino acid sequence
homology to homologs in animal and yeast cells (Terryn et al.
1993, Borg and Poulsen 1994), or by their ability to complement yeast Rab mutants (Kim et al. 1996). A few studies have
demonstrated that these proteins function during intracellular
trafficking in plant cells. Arabidopsis Rha1, a Rab5 homolog,
and a tobacco Rab1 play a critical role in vacuolar trafficking
(Sohn et al. 2003) and anterograde trafficking from the ER to
the Golgi apparatus (Batoko et al. 2000), respectively. In
tomato, Rab11 appears to be involved in the secretion of proteins involved in the softening of fruit (Lu et al. 2001). In order
to understand the biological role of Rab proteins in plant cells,
the localization of several Rab proteins has been investigated.
Arabidopsis Ara6 and Ara7 localize to endosomes involved in
endocytosis of FM4-64 (Ueda et al. 2001). In addition, Pra2, a
The first two authors contributed equally to this the work.
Corresponding author: E-mail, [email protected]; Fax, +82-54-279-8159.
1211
1212
Localization of Rha1 and Ara7
pea homolog of Ypt3/Rab11, localizes predominantly to Golgi
stacks and endosomes and Pra3, another pea homolog of Ypt3/
Rab11, localizes to the TGN and/or the prevacuolar compartment (PVC) (Inaba et al. 2002).
In this study we investigated the localization of the Arabidopsis Rha1 and Ara7 proteins, which have high amino acid
sequence homology to Rab5. Here, we present evidence that
both Rha1 and Ara7 localize to the PVC and that GTP-binding
motifs as well as the effector domain play critical roles in the
localization of Rha1 to the PVC.
Results
Transiently expressed Rha1 and Ara7 give a punctate staining
pattern in Arabidopsis protoplasts
Rha1 and Ara7 (Anuntalabhochai et al. 1991, Terryn et al.
1993, Ueda et al. 2001) have highly similar amino acid
sequences to each other and to the Rab5 protein found in animal cells. We recently demonstrated that they play a critical
role in vacuolar trafficking in plant cells (Sohn et al. 2003). To
advance our understanding of their role in vacuolar trafficking,
we examined their localization. We used in vivo targeting
approaches in protoplasts (Kim et al. 2001, Lee et al. 2002)
using green fluorescent protein (GFP)-tagged fusion proteins
(GFP:Rha1 and GFP:Ara7). Rab proteins have previously been
shown to localize correctly at their target membranes when
fused with GFP (Sonnichsen et al. 2000, Ueda et al. 2001). The
two constructs, GFP:Rha1 and GFP:Ara7, were introduced
into protoplasts obtained from Arabidopsis leaf tissues and the
localization of these proteins was examined at various time
points after transformation. As shown in Fig. 1A, GFP signals
from GFP:Rha1 and GFP:Ara7 in most of the transformed protoplasts appeared as punctate stains. The punctate staining pattern of GFP:Ara7 was also demonstrated previously (Ueda et
al. 2001). The nearly identical staining pattern of these two
proteins suggests that they localize to the same compartment.
To confirm that the GFP tag of GFP:Rha1 does not affect the
localization of Rha1, we assessed the localization of Rha1
tagged with the influenza virus hemagglutinin A (HA) epitope
(Chen et al. 1993) at its N-terminus. Protoplasts were cotransformed with GFP:Rha1 and HA:Rha1. The localization of HA:
Rha1 was examined by immunohistochemistry using anti-HA
antibody and GFP:Rha1 was directly observed using green
fluorescence from the fixed cell. As shown in Fig. 1B (panels
a–c), the green fluorescent signals of GFP:Rha1 closely overlapped the red fluorescent signals of HA:Rha1 detected by an
anti-HA antibody.
Next, we determined whether Rha1 colocalizes with Ara7.
Protoplasts were transformed with GFP:Ara7 and HA:Rha1
and localization of these proteins was examined. As shown in
Fig. 1B (panels e–g), the punctate staining patterns of HA:
Rha1 and GFP:Ara7 closely overlapped, indicating that both
proteins localize to the same compartment.
Fig. 1 Rha1 and Ara7 give punctate staining patterns. (A) GFP patterns of Rha1 and Ara7. Protoplasts were transformed with GFP:Rha1
and GFP:Ara7 and localization of these proteins was examined 24 h
later by a confocal laser scanning microscope. At least three independent transformation experiments were carried out and each time more
than 500 cells were examined. The pattern shown here is represenative
of the transformed protoplasts. GFP and CH indicate GFP and the
autofluorescent signals (red image) of chlorophyll, respectively. The
cells shown here are representative cells. Bar, 20 µm. (B) Colocalization of GFP:Rha1 and HA:Rha1. Protoplasts were transformed with
GFP:Rha1 plus HA:Rha1 or GFP:Ara7 plus HA:Rha1 and fixed with
2% paraformaldehyde 24 h later. The HA tag was detected by an antiHA antibody and goat anti-rat IgG antibody conjugated with TRITC.
GFP signals of GFP:Ara7 and GFP:Rha1 were observed directly from
the fixed protoplasts. Bar, 20 µm. (C) Western blot analysis of HAtagged Rha1. Protein extracts were prepared from protoplasts transformed with HA:Rha1 (HA:Rha1). The expression of HA:Rha1 was
detected with anti-HA antibody. Protein extracts obtained from
untransformed protoplasts were included as a control (Non). Standard
protein markers are indicated on the left (size in kDa).
To confirm the expression of HA:Rha1 in protoplasts as
well as the specificity of the anti-HA antibody, protein extracts
from protoplasts transformed with HA:Rha1 were analyzed by
Western blot. As shown in Fig. 1C, the antibody detected a specific band at 28 kDa, the expected position of HA:Rha1, in
transformed protoplasts but not in untransformed protoplasts,
confirming the expression of HA:Rha1 and the specificity of
the anti-HA antibody.
GFP-tagged Rha1 and Ara7 colocalize with proteins at the PVC
We then identified the organelles to which these proteins
localize. Since Rha1 is critical in vacuolar trafficking (Sohn et
al. 2003), we first determined whether the punctate staining
pattern represents the PVC by comparing the localization of
Localization of Rha1 and Ara7
Fig. 2 GFP:Rha1 and GFP:Ara7 colocalize with AtPEP12p:HA. (A)
Western blot analysis of AtPEP12p:HA expression. Protein extracts
were prepared from protoplasts transformed with AtPEP12p:HA and
used for Western blot analysis using anti-HA antibody (AtPEP12p:
HA). Protein extracts obtained from untransformed protoplasts were
included as a control (Non). (B) Colocalization of GFP:Rha1 and GFP:
Ara7 with AtPEP12p:HA. Protoplasts were transformed with GFP:
Rha1 plus AtPEP12p:HA or GFP:Ara7 plus AtPEP12p:HA.
AtPEP12p:HA was detected with anti-HA antibody. GFP signals were
observed directly from the fixed protoplasts. Bar,20 µm. (C) Quantification of colocalization of AtPEP12p:HA with GFP:Rha1 or GFP:
Ara7. The number of GFP:Rha1- or GFP:Ara7-positive punctate stains
that overlap with those of AtPEP12p:HA were counted to estimate the
degree of overlap. Three independent transformation experiments were
performed and more than 200 punctate stains of GFP:Rha1 or GFP:
Ara7 were counted to estimate the degree of overlap each time. The
error bars indicate standard deviations.
GFP:Rha1 with AtPEP12p, a marker of the PVC (da Silva
Conceicao et al. 1997, Bassham and Raikhel 1998). AtPEP12p
was tagged with the HA epitope to detect its expression with
the anti-HA antibody. First we examined expression of
AtPEP12p by Western blot analysis. As shown in Fig. 2A, a
35 kDa protein band, the expected position of AtPEP12p:HA,
was specifically detected from protein extracts obtained from
protoplasts transformed with AtPEP12p:HA but not from
untransformed protoplasts, confirming expression of
AtPEP12p:HA in protoplasts. Next we examined localization
of AtPEP12p:HA in protoplasts cotransformed with
1213
Fig. 3 GFP:Rha1 colocalizes with the majority of VSRAt-1-positive
organelles. (A) Western blot analysis of VSRAt-1. Protein extracts were
prepared from leaf tissues and used for Western blot analysis using
anti-VSRAt-1 antibody (Anti-VSR) or a control rabbit serum (Control
serum). (B) Localization of endogenous VSRAt-1. Protoplasts obtained
from leaf tissues were fixed and stained with anti-VSR antibody
(VSRAt-1) or control serum (Control) followed by Cy3-labeled antirabbit IgG as a secondary antibody. Bar, 20 µm. (C) Colocalization of
AtPEP12p:HA with VSRAt-1. Protoplasts were transformed with
AtPEP12p:HA, GFP:Rha1 or HA:AtTLG2a. AtPEP12p:HA and HA:
AtTLG2a were detected with anti-HA antibody and endogenous
VSRAt-1 was detected with anti-VSR antibody. Bar, 20 µm.
AtPEP12p:HA and GFP:Rha1. AtPEP12p:HA was detected by
immunohistochemistry using anti-HA antibody. AtPEP12p:HA
stained in a punctate pattern (Fig. 2B, panel b), as observed
previously with AtPEP12p (da Silva Conceicao et al. 1997, Li
et al. 2002). In addition, red fluorescent signals of AtPEP12p:
HA closely overlapped green fluorescent signals of GFP:Rha1
(Fig. 2B, panels a–c). Furthermore, the GFP signals of GFP:
Ara7 closely overlapped the red signals of AtPEP12p:HA at the
punctate stains in protoplasts cotransformed with GFP:Ara7
and AtPEP12p:HA (Fig. 2B, panels e–g). Next, we quantified
the degree of overlap between AtPEP12p:HA and GFP:Rha1
and between AtEPEP12p:HA and GFP:Ara7. As shown in Fig.
2C, over 85% of both GFP:Rah1- and GFP:Ara7-positive punctate stains overlapped with those of AtPEP12p:HA. Only a
minor fraction of Rha1 and Ara7 did not colocalize with
1214
Localization of Rha1 and Ara7
Fig. 4 GFP:Rha1 does not colocalize with any of BiP:
RFP, RFP:SKL, or F1-ATPase-γ:RFP. GFP:Rha1 was
cotransformed into protoplasts together with BiP:RFP (a
marker for the ER), RFP:SKL (a marker for the peroxisome) or F1-ATPase-γ:RFP (mitochondria) and localization of these proteins was examined. Bar, 20 µm.
AtPEP12p:HA. One possible explanation is that a minor portion of Rha1 may localize to other compartments. These results
strongly suggest that both GFP:Rha1 and GFP:Ara7 colocalize
to the PVC.
For additional confirmation, we compared the localization of GFP:Rha1 with that of the endogenous Arabidopsis vacuolar sorting receptor (VSRAt-1), an Arabidopsis BP-80
homolog (also known as AtELP) (Ahmed et al. 1997). VSR
proteins are predominantly concentrated on the PVCs in root
tip cells and tobacco BY-2 suspension culture cells (Li et al.
2002, Tse et al. 2004). Thus, the anti-VSR antibody raised
against VSRAt-1 (Li et al. 2002, Tse et al. 2004) serves as a
PVC marker. Previously this antibody had been used to detect
VSR homolog in BY-2 cells and shown to recognize specifically a protein band at 80 kDa (Li et al. 2002, Tse et al. 2004).
Furthermore, it had been shown to colocalize with PEP12p at
the PVC. When we performed Western blot analysis with protein extracts obtained from leaf tissues of Arabidopsis, it also
specifically recognized an 80 kDa band, an expected size of
Arabidopsis VSR (Fig. 3A). Next, we examined the staining
pattern of VSRAt-1 using the anti-VSR antibody. As shown in
Fig. 3B, endogenous VSRAt-1 stained in a punctate pattern in
leaf protoplasts, as observed in root tip and tobacco BY-2 cells
(Li et al. 2002, Tse et al. 2004). As a control for immunostaining, a control rabbit serum was used and did not give any staining (Fig. 3B, panel c), confirming the specificity of anti-VSR
antibody. To examine whether GFP:Rha1 colocalizes with
VSRAt-1, protoplasts transformed with GFP:Rha1 were stained
with the anti-VSR antibody. As shown in Fig. 3C (panels a–c),
the green punctate stains of GFP:Rha1 closely overlapped the
red punctate stains of VSRAt-1. However, a fraction (approxi-
mately 17%) of red punctate VSRAt-1 stains did not overlap
GFP:Rha1 speckles, indicating that GFP:Rha1 may colocalize
with most but not all of the VSR-positive compartments. Previously it has been shown that VSR also localizes to the TGN
(Paris et al. 1997, Ahmed et al. 2000, Li et al. 2002). Next, we
examined the degree of VSRAt-1 colocalization with AtPEP12p
to determine what portion of the VSR-positive speckles corresponds to the PVC in Arabidopsis leaf cells. Protoplasts were
transformed with AtPEP12p:HA and stained using anti-HA and
anti-VSR antibodies. As shown in Fig. 3C (panels e–g), the
majority of VSR-positive speckles overlapped the AtPEP12p:
HA speckles, confirming that majority of VSR localizes to the
PVC. When overlap of VSRAt-1 with AtPEP12p:HA was quantified, 85% (±10%, n = 500) of VSRAt-1-positive speckles colocalized with the PVC, indicating that 85% of VSRAt-1-positive
speckles represent the PVC. These results confirm that GFP:
Rha1 localizes mainly to the PVC. To rule out the possibility
that Rha1 localizes to the TGN, we compared the staining patterns of GFP:Rha1 with that of HA-tagged AtTLG2a, a protein
localized to the TGN (Bassham et al. 2000). Protoplasts were
cotransformed with GFP:Rha1 and HA:TLG2a and localization
of these two proteins was examined. GFP:Rha1 did not colocalize with HA:TLG2a (Fig. 3C, panels i–k), indicating that HA:
Rha1 does not localize to the TGN.
To further confirm the specific localization of Rha1 at the
PVC, we compared the localization of Rha1 with that of other
markers that characterize organelles such as the ER, mitochondria and the peroxisome. GFP:Rha1 was introduced into
protoplasts together with BiP:RFP, a marker of the ER, F1ATPase-γ:RFP, a marker of mitochondria, or RFP:SKL, a
marker of the peroxisome (Jin et al. 2003) and the localiza-
Localization of Rha1 and Ara7
1215
Fig. 5 Specificity of anti-Rha1 antibody. (A) Western blot analysis
using anti-Rha1 antibody. Protein extracts were prepared from leaf tissues of Arabidopsis and used for Western blot analysis using anti-Rha1
antibody (Anti-Rha1) or control serum (Control serum). (B) Specificity of anti-Rha1 antibody. Protein extracts were prepared from protoplasts transformed with the indicated constructs and used for Western
blot analysis using anti-GFP or anti-Rha1 antibodies.
tions of the different proteins were examined. As shown in
Fig. 4, BiP:RFP (panels a–c) gave a network pattern as
observed previously (Jin et al. 2001). Furthermore, F1-ATPaseγ:RFP (panels e–g) and RFP:SKL (panels i–k) gave punctate
staining patterns as expected. None of these markers overlapped with GFP:Rha1, thus excluding the possibility that Rha1
localizes to any of these organelles.
Endogenous Rha1 localizes to the PVC
To further confirm the localization of Rha1, we investigated the localization of endogenous Rha1 using a polyclonal
anti-Rha1 antibody. To address this question, we raised a rabbit polyclonal antibody against recombinant Rha1 expressed in
Escherichia coli. First, we examined the specificity of the antiRha1 antibody. As shown in Fig. 5A (lane Anti-Rha1), antiRha1 antibody specifically detected a protein band at 28 kDa
from total protein extracts obtained from leaf tissues whereas
the control serum did not detect any protein species from the
extracts (Fig. 5A, lane Control serum), indicating that the antibody may specifically detect Rha1 from plant extracts. Next we
examined whether anti-Rha1 antibody recognizes Rha1 only
and does not cross-react with other Rab proteins in Arabidopsis. Since the expression of Rab proteins has not been previously investigated in Arabidopsis leaf cells, protein extracts
were prepared from protoplasts transformed with various GFPtagged forms of Rab such as GFP:Rha1, GFP:Ara5, Ara6:
GFP, GFP:Ara7, GFP:Rab7 and GFP:Rab8. We evaluated the
expression of these proteins by Western blot analysis using an
anti-GFP antibody. As shown in Fig. 5B, a protein band around
52 kDa was detected in each lane, indicating that these proteins are expressed in protoplasts. To examine the cross-reactivity of the anti-Rha1 antibody with these proteins, Western blot
analysis was performed with these protein extracts using antiRha1 antibody. As shown in Fig. 5B (bottom panel), the antiRha1 antibody strongly detected a protein band at 52 kDa in
the protein extracts containing GFP:Rha1. Also, GFP:Ara7 was
weakly detected; the amino acid sequences of Ara7 and Rha1
are 92% homologous. These results clearly demonstrated that
Fig. 6 Endogenous Rha1 colocalizes with AtPEP12p to the PVC. (A)
Localization pattern of endogenous Rha1. Untransformed protoplasts
were fixed and stained with anti-Rha1 antibody (Endo Rha1) or control serum (Control serum) and the staining pattern was examined
under a fluorescent microscope. Bar, 20 µm. (B) Colocalization of
endogenous Rha1 with GFP:Rha1, HA:Rha1 and AtPEP12p:HA. Protoplasts transformed with GFP:Rha1 (panels a–d), HA:Rha1 (panels
e–h) or AtPEP12p:HA (panels i–l) were fixed and stained with antiRha1 antibody or anti-HA antibody. GFP signals of GFP:Rha1 were
observed directly. Endo Rha1, endogenous Rha1 detected with antiRha1 antibody. Bar, 20 µm.
the anti-Rha1 antibody is highly specific to Rha1 among Rab
proteins in Arabidopsis.
We examined the localization of endogenous Rha1 by
immunohistochemistry using the anti-Rha1 antibody. As shown
in Fig. 6A, endogenous Rha1 gave a punctate staining pattern,
as observed with transiently expressed GFP:Rha1 or HA:Rha1.
In contrast, the control serum did not give any staining pattern.
Next, we examined whether endogenous Rha1 colocalizes with
transiently expressed GFP:Rha1 or HA:Rha1. Protoplasts transformed with GFP:Rha1 or HA:Rha1 were stained with the
anti-Rha1 antibody alone or with anti-Rha1 and anti-HA antibodies, respectively. Endogenous Rha1 closely overlapped
GFP:Rha1 and HA:Rha1 at punctate stains (Fig. 6B, panels a–g),
indicating that endogenous Rha1 colocalizes with GFP- or HAtagged Rha1 proteins at the same compartment. To confirm the
localization of endogenous Rha1 to the PVC, we investigated
the colocalization of endogenous Rha1 with AtPEP12p:HA.
Protoplasts were transformed with AtPEP12p:HA and localization of AtPEP12p:HA and endogenous Rha1 was examined. As
shown in Fig. 6B (panels i–k), both AtPEP12p:HA and endogenous Rha1 gave a punctate staining pattern. Furthermore,
1216
Localization of Rha1 and Ara7
Fig. 7 Subcellular fractionation of endogenous and transiently
expressed Rha1. (A) Membrane association of Rha1. Protein extracts
were prepared from protoplasts transformed with GFP:Rha1 or GFP
and fractionated into soluble and membrane fractions by ultracentrifugation. These fractions were then analyzed by Western blot analysis
using anti-GFP, anti-Rha1 and anti-aleurain antibodies to detect transiently expressed GFP:Rha1, endogenous Rha1 and endogenous
AALP, respectively. T, total extract; S, soluble fraction; M, membrane
fraction. (B) Colocalization of Rha1 with AtPEP12p by subcellular
fractionation. A microsomal fraction that was prepared from total leaf
extracts by ultracentrifugation was fractionated by ultracentrifugation
on a continuous (15–50%) sucrose gradient. Fractions were probed
with anti-BiP, anti-γ-COP, anti-AtPEP12p and anti-Rha1 antibodies for
BiP at the ER, γ-COP at the Golgi apparatus, AtPEP12p at the PVC
and Rha1, respectively.
endogenous Rha1 closely overlapped AtPEP12p:HA at punctate stains, confirming that endogenous Rha1 localizes to the
PVC as observed with GFP:Rha1 and HA:Rha1 expressed transiently in protoplasts.
To further elucidate the behavior of Rha1, we examined
the subcellular distribution pattern of endogenous and transiently expressed Rha1 by Western blot analysis. Protein
extracts were obtained from untransformed protoplasts or protoplasts transformed with GFP:Rha1 and fractionated into soluble and membrane fractions by ultracentrifugation. The
presence of endogenous Rha1 or transiently expressed GFP:
Rha1 was detected in these fractions by Western blot analysis.
As shown in Fig. 7A, the majority of endogenous Rha1 was
detected in the pellet fraction, indicating that Rha1 is associated with cellular membranes. Also, the majority of the transiently expressed GFP:Rha1 was also detected in the
membrane fraction. However, interestingly, more GFP:Rha1
than endogenous Rha1 was detected in the soluble fraction,
which is likely due to overexpression of GFP:Rha1 in the cell.
As a control, protein extracts prepared from protoplasts transformed with a GFP construct were fractionated and examined
by Western blot analysis using anti-GFP antibody. As shown in
Fig. 6A, GFP was detected mainly in the soluble fraction, indi-
cating that the presence of GFP:Rha1 in the membrane fraction is due to Rha1. Also we detected endogenous Arabidopsis
aleurain-like protein (AALP), a soluble vacuolar protein
(Ahmed et al. 2000, Sohn et al. 2003), using anti-aleurain antibody raised against barley aleurain. Endogenous AALP (antialeurain) was detected in the soluble fraction but not in the
membrane fraction. These results strongly suggest that endogenous Rha1 is associated with membranes. Furthermore, these
results strongly suggest that transiently expressed GFP:Rha1
behaves similarly to endogenous Rha1.
Next, to obtain independent evidence for the localization
of Rha1 at the PVC, we examined the sedimentation pattern of
Rha1 on a continuous sucrose gradient. First a microsomal
membrane fraction of leaf cell extracts was prepared by ultracentrifugation and loaded onto a continuous sucrose gradient
(15–50%). After centrifugation, fractions were analyzed by
Western blot analysis using various antibodies, such as antiBiP, anti-PEP12p, anti-γ-COP and anti-Rha1. Anti-BiP and
anti-γ-COP antibodies were used to detect the ER and Golgi
apparatus (Pimpl et al. 2000). As shown in Fig. 7B, anti-Rha1
and anti-PEP12p antibodies gave nearly identical distribution
patterns with a major peak between 34% and 38% sucrose.
However, the distribution pattern of Rha1 was different from
those of BiP and γ-COP at the ER and the Golgi apparatus.
These results further confirm that Rha1 localizes to the PVC.
Mutations at GTP-binding motifs and the effector domain affect
localization of Rha1 in protoplasts
Next, we examined the targeting mechanism of Rha1 to
the PVC. Rab proteins have multiple domains (Stenmark et al.
1994) such as GTP-binding and effector domains. Mutations at
these domains are known to affect protein targeting (Soldati et
al. 1993, Wilson and Maltese 1993, Stenmark et al. 1994, Li
and Liang 2001). Mutations were introduced at the highly conserved GTP-binding motifs, namely the first (Rha1[S24N]) and
second (Rha1[Q69L]) GTP-binding motifs. We fused these
mutants with GFP and then examined their localization in
transformed protoplasts. The GFP signals of GFP:Rha1[S24N]
were diffuse as observed with GFP alone (Fig. 8A), indicating
that this mutation inhibits the targeting of Rha1 to the PVC. In
contrast, GFP:Rha1[Q69L] showed strong GFP signals at the
tonoplast of the central vacuole and also at a few punctate
stains (indicated by arrows in Fig. 8A, panel i), suggesting that
the highly conserved GTP domains of Rha1 are critical for
proper localization of Rha1 to the PVC.
To further understand the targeting mechanism of Rha1 to
the PVC, mutations were introduced at the effector domain
(Rha1[T42A]) and the prenylation site (Rha1[C198S, C199S]).
These mutants were again fused with GFP and their localization was examined in transformed protoplasts. The GFP signals of GFP:Rha1[T42A] and GFP:Rha1[C198S, C199S] were
diffuse, as observed with GFP alone (Fig. 7A). Thus, the effector domain and prenylation site of Rha1 play critical roles in
the proper localization of Rha1 to the PVC.
Localization of Rha1 and Ara7
1217
Fig. 8 Localization of Rha1[S24N] and Rha1[Q69L]
in protoplasts. (A) Localization of various Rha1
mutants. Protoplasts were transformed with the indicated constructs and localization of these proteins was
examined 24 h later. Bar, 20 µm. Arrows in panels c, e
and i indicate the punctate stains. (B) Western blot analysis for the localization of various Rha1 mutants. Transformed protoplasts were lysed and fractionated into
soluble and membrane fractions by ultracentrifugation.
These fractions were then probed with anti-GFP antibody to detect GFP-tagged Rha1 proteins. S and M indicate the soluble and membrane fractions.
To confirm the behavior of the Rha1 mutants, protein
extracts were prepared from protoplasts transformed with the
mutant and wild-type GFP:Rha1 constructs. The protein
extracts were then fractionated into soluble and membrane
fractions by ultracentrifugation and probed with a monoclonal
anti-GFP antibody for the presence of Rha1. As shown in Fig.
8B, in contrast to GFP:Rha1, the majority of GFP:Rha1[S24N]
was present in the soluble fraction, with a minor portion in the
membrane fraction, confirming the image pattern observed
under a fluorescent microscope. However, the distribution of
GFP:Rha1[Q69L] was exactly opposite to that of GFP:
Rha1[S24N]: the majority of the protein was present in the
membrane fraction and only a minor portion was in the soluble
fraction. When subcellular fractionation experiments were performed with Rha1[T42A] and Rha1[C198S, C199S], these
mutant proteins were detected in the soluble fraction, but not in
the membrane fraction, confirming the data obtained from
image analysis. These results suggest that Rha1 targeting to the
PVC is dependent on both the effector domain and the prenylation site. The prenyl group at the C-terminal cysteine residues
anchors the Rab protein to the membrane (Khosravi-Far et al.
1991, Alexandrov et al. 1994).
Discussion
Rha1 and Ara7 are closely related to each other and show
a high degree of amino acid sequence homology to Rab5, a
protein important in endocytosis and the fusion of endosomes
in animals (Li et al. 1994, Sonnichsen et al. 2000). We recently
showed that Rha1 plays a critical role in vacuolar trafficking in
leaf cells (Sohn et al. 2003). In the presence of the dominant-
negative Rha1 mutant, soluble vacuolar cargo proteins accumulate at the PVC or are secreted into the medium, strongly suggesting that Rha1 may localize to the PVC. Localization of
Rha1 and Ara7 was first investigated using GFP- or HA-tagged
forms transiently expressed in protoplasts. Both Rha1 and Ara7
gave a punctate staining pattern and colocalized with each other.
Interestingly both Ara7 and Rha1 colocalize with AtPEP12p,
and VSRAt-1 localized to the PVC (da Silva Conceicao et al.
1997, Paris et al. 1997, Ahmed et al. 2000, Li et al. 2002) when
expressed transiently in protoplasts. In addition, endogenous
Rha1 colocalized with transiently expressed GFP:Rha1, HA:
Rha1 and AtPEP12p:HA. Furthermore, the subcellular distribution patterns of endogenous Rha1 and AtPEP12p on a continuous sucrose gradient were nearly identical, thus supporting our
notion that Rha1 localizes to the PVC. The PVC is thought to
be an intermediate compartment involved in the trafficking of
cargo proteins from the TGN to the central vacuole in plant
cells (Jiang and Rogers 1998, Sanderfoot et al. 1998, Kim et al.
2001). Thus, the localization of Rha1 to the PVC supports the
proposed role of Rha1 in vacuolar trafficking (Sohn et al.
2003). Also, the punctate staining pattern of Ara7 reported here
is consistent with a previous report (Ueda et al. 2001).
A large number of Rab proteins are found in a single
organism (Novick and Zerial 1997, Rutherford and Moore
2002, Vernoud et al. 2003). Proper localization of Rab proteins
is necessary for their function in various trafficking pathways.
As demonstrated in other Rab proteins (Soldati et al. 1993,
Ullrich et al. 1993, Ullrich et al. 1994, Seabra 1998), a mutation at the prenylation site affects the localization of Rha1 at
the PVC, likely due to the lack of prenylation. The prenyl
group attached at the C-terminus of the Rab protein anchors it
1218
Localization of Rha1 and Ara7
to the target membrane (Khosravi-Far et al. 1991, Seabra
1998). In addition, the effector domain is necessary for the targeting of Rha1 to the PVC. The GDP dissociation inhibitor
(GDI) recognizes the effector domain together with the prenyl
group at the C-terminus for proper localization of Rab proteins
(Peter et al. 1994). Thus, mutation at the effector domain may
inhibit binding of GDI, which may prevent the localization of
Rha1 to the PVC. The GDI that interacts with Rha1 has not yet
been identified. Two GDI proteins, AtGDI1 and AtGDI2, have
been identified in Arabidopsis (Ueda et al. 1996, Ueda et al.
1998, Zarsky et al. 1997).
Localization of Rha1 was also affected by mutations at the
GTP-binding motifs: Rha1[S24N] in the cytosol and
Rha1[Q69L] in the tonoplast of the central vacuole. Thus,
GTPase activity appears to be critical for localization of Rha1
to the PVC. Rab proteins travel from the donor compartment to
the acceptor compartment and then recycle back to the donor
compartment through the cytosol (Chavrier et al. 1990, Bucci
et al. 1992, Feng et al. 1995). During the cycling between the
donor and acceptor compartments, hydrolysis of bound GTP to
GDP by GTPase is thought to be important for the release of
Rabs from the acceptor compartment because GDI extracts the
GDP Rab forms from membranes (Jones et al. 1998, Pfeffer
2001). Thus, localization of Rha1[Q69L] to the tonoplast may
have occurred because it was not released from the membrane
due to mutation. Furthermore, the localization of Rha1[Q69L]
to the tonoplast strongly suggests that the tonoplast is the
acceptor compartment for Rha1. Thus, Rha1 may normally
travel from the PVC to the tonoplast. However, Rha1 is not
usually detected at the tonoplast, possibly because Rha1 may
localize to the tonoplast transiently. In contrast, in the case of
Rha1[Q69L], extraction of Rha1[Q69L] from the tonoplast for
recycling may be inhibited due to the mutation, which results in
its accumulation at the tonoplast. However, the pathway Rha1
travels from the PVC to the tonoplast has not yet been identified. In the presence of Rha1[S24N], soluble vacuolar cargo
proteins accumulate at the PVC or are associated with the central vacuole as punctate stains (Sohn et al. 2003). Thus, the
PVC containing Rha1 may fuse to the tonoplast, which in turn
results in targeting of Rha1 to the tonoplast, as proposed in
animal and yeast cells (Darsow et al. 1997, Piper et al. 1997,
Mullock et al. 2000). However, we can not rule out the possibility that vesicles derived from the PVC may travel to and fuse
with the tonoplast together with bound Rha1.
In animal cells, Rab5 localizes to the early endosome and
plays a critical role during endocytosis (Li et al. 1994, Rybin et
al. 1996, Sonnichsen et al. 2000). In contrast, Rha1 and Ara7
localize to the PVC. The differential localization of Rab5
homologs between animal and plant cells is not clearly understood at the moment. Previously it has been shown that Ara6
and Ara7 localize to endosomal compartments in plant cells.
These endosomes have been stained by FM4-64 (Ueda et al.
2001). However, evidence suggests that the Ara6-positive compartment differs from the Ara7-positive compartment (Ueda et
al. 2001), and that Rha1 and Ara7 but not Ara6 are involved in
vacuolar trafficking (Sohn et al. 2003). Thus, Ara7 and Rha1
appear to differ functionally from Ara6. In animal cells, endocytic proteins are transported to the lysosome through the early
endosome and then the late endosome (Bucci et al. 1992, Feng
et al. 1995, Sonnichsen et al. 2000). In addition, newly synthesized lysosomal proteins are transported to the lysosome from
the TGN through the late endosome (Piper and Luzio 2001),
indicating that the late endosome is a compartment shared by
both the lysosomal and endocytic pathways in animal cells.
Likewise, the PVC may serve as a common compartment for
both the vacuolar and the endocytic pathways in plant cells,
which would explain the localization of FM4-64 and spo:GFP
at the Rha1 and Ara7-positive compartments during endocytosis (Ueda et al. 2001) and vacuolar trafficking (Sohn et al.
2003), respectively. In contrast, Ara6, a plant-specific Rab5
homolog, may localize to an endosome that corresponds to the
early endosome in animal cells and may function in endocytosis in plant cells.
In conclusion, we propose that Rha1 and Ara7 localize to
the PVC and that the PVC is a common compartment for both
vacuolar trafficking from the TGN and the endocytic pathway
from the plasma membrane.
Materials and Methods
Growth of plants
Arabidopsis (ecotype Columbia) was grown on Murashige and
Skoog plates in a growth chamber. Leaf tissues were harvested from
the plants and immediately used for protoplast isolation.
Generation of various constructs
Ara5 (accession number P28188), Ara4 (accession number
P28187), Rab7 (accession number O04157) and Rab8 (accession
number AAB65088) were PCR amplified. The primer sets were as follows: 5′-AAGAAGAATGAATTTTAATCT-3′ and 5′-TCAAGTTGAGCAGCAGCC-3′ for Ara5, 5′-CCCGGGAAATGTCAGACGACGAG’3 and 5′-ATGTTACCTCGAACAGCAAGA-3′ for Ara4, 5′-ATGTCGACGCGAAGACGAAC-3′ and 5′-TCAGCAAGCACAACCTCCTCTT-3′ for Rab7 and 5′-ATGGCGGTTGCGCCGGCAAGA-3′ and 5′CTAAACGTAACTACAGCAAGC-3′ for Rab8. Point mutants of Rha1
were also generated by PCR. Rha1[Q69L] was generated by PCR
using two oligonucleotide primers, ATATGGGATACAGCTGGTCTGGAACGATACCACAGTTTG and CAAACTGTGGTATCGTTCCAGACCAGCTGTATCCCATAT. The nucleotide sequences of all the PCR
products were confirmed by nucleotide sequencing. TLG2a cDNA was
PCR amplified from a cDNA library using gene-specific primers
(GAATTCATGGCGACGAGGAATCGTACGTTGCTG, TCACAAGAATATTTCCTTGAGGATTAA).
Protein fractionation and protein gel blot analysis
To prepare cell extracts from protoplasts, transformed protoplasts were lysed in buffer (40 mM HEPES–KOH pH 8.0, 0.25 M
sucrose, 3 mM EDTA, 10 mM KCl, 1.0 mM dithiothreitol, 10 µg/ml
leupeptin, 1 µg/ml pepstatin and 10 µg/ml aprotinin) by repeated
freeze and thaw cycles and then centrifuged at 7,000×g at 4°C for
5 min in a microfuge to remove cell debris (Jin et al. 2001). For subcellular fractionation experiments, the total cell extracts were centrifuged at 14,000×g for 10 min and subsequently the resulting
Localization of Rha1 and Ara7
supernatant was fractionated into soluble and membrane fractions by
ultracentrifugation at 100,000×g for 2 h (Park et al. 1997, Bassham et
al. 2000). For fractionation of membrane proteins on a continuous
sucrose gradient (15–50%), the microsomal membrane fraction was
further fractionated on a 15–50% continuous sucrose gradient by ultracentrifugation at 4°C for 1 h. These fractions were then probed with
anti-BiP, anti-AtPEP12p (Rose Biotechnology, Winchendon, U.S.A.),
anti-γ-COP and anti-Rha1 antibodies as described previously (Jin et al.
2001).
Generation of antibodies
pRSET-Rha1, an E. coli expression vector for Rha1, was constructed by inserting the Rha1 cDNA into the multi-cloning site of
pRSET-B in-frame with the His tag. A recombinant protein His-tagged
Rha1 was expressed in E. coli and purified using an Ni+-NTA column
according to the manufacturer’s instructions (Qiagen, Valencia, U.S.A.).
Affinity-purified recombinant protein was then used to immunize two
rabbits. Antibody was affinity purified using recombinant protein as
described previously (Harlow and Lane 1988).
Transient expression and in vivo targeting of reporter cargo proteins
The plasmids were introduced by PEG-mediated transformation
(Jin et al. 2001) into Arabidopsis protoplasts prepared from leaf tissues. Expression of the fusion constructs was monitored at various
time points after transformation and images were captured with a cooled
CCD camera and a Zeiss (Jena, Germany) Axioplan fluorescence
microscope (Jin et al. 2001). Also images were obtained using a confocal laser scanning microscope (Zeiss meta system, Jena, Germany).
Immunohistochemistry
Protoplasts were analyzed immunohistochemically as described
previously (Sohn et al. 2003). Briefly, transformed protoplasts were
placed onto poly-L-lysine-coated slide glasses and fixed with 2% paraformaldehyde in a fixing buffer (10 mM HEPES pH 7.2, 154 mM
NaCl, 125 mM CaCl2, 2.5 mM maltose, 5 mM KCl) for 1 h at room
temperature. The fixed cells were incubated with rat monoclonal antiHA (Roche, Basel, Switzerland), rabbit anti-Rha1 or rabbit anti-VSR
antibodies at 4°C overnight and washed with TSW buffer three times.
Subsequently, the cells were incubated with Cy3-conjugated goat antirabbit IgG (Sigma) or TRITC-conjugated anti-rat IgG (Zymed) as the
secondary antibodies. The images were captured as described above.
Acknowledgments
The authors thank John Rogers (Washington State University,
Pullnam, WT, U.S.A.), Liwen Jiang (Hong Kong University of China,
Hong Kong, China) and David G. Robison (University of Göttingen,
Germany) for anti-aleurain, anti-VSRAt-1 and anti-γ-COP antibodies,
respectively. This work was supported by a grant (M10116000005–
02F0000-00310) from National Creative Research Initiatives from the
Ministry of Science and Technology (Korea).
References
Ahmed, S.U., Bar-Peled, M. and Raikhel, N.V. (1997) Cloning and subcellular
location of an Arabidopsis receptor-like protein that shares common features
with protein-sorting receptors of eukaryotic cells. Plant Physiol. 114: 325–
336.
Ahmed, S.U., Rojo, E., Kovaleva, V., Venkataraman, S., Dombrowski, J.E.,
Matsuoka, K. and Raikhel, N.V. (2000) The plant vacuolar sorting receptor
AtELP is involved in transport of NH2-terminal propeptide-containing vacuolar proteins in Arabidopsis thaliana. J. Cell Biol. 149: 1335–1344.
1219
Alexandrov, K., Horiuchi, H., Steele-Mortimer, O., Seabra, M.C. and Zerial, M.
(1994). Rab escort protein-1 is a multifunctional protein that accompanies
newly prenylated rab proteins to their target membranes. EMBO J. 13: 5262–
5273.
Allan, B.B., Moyer, B.D. and Balch, W.E. (2000) Rab1 recruitment of p115 into
a cis-SNARE complex: programming budding COPII vesicles for fusion. Science 289: 444–448.
Anuntalabhochai, S., Terryn, N., Van Montagu, M. and Inze, D. (1991) Molecular characterization of an Arabidopsis thaliana cDNA encoding a small GTPbinding protein, Rha1. Plant J. 1: 167–174.
Balch, W.E., Kahn, R.A. and Schwaninger, R. (1992). ADP-ribosylation factor
is required for vesicular trafficking between the endoplasmic reticulum and
the cis-Golgi compartment. J. Biol. Chem. 267: 13053–13061.
Bassham, D.C. and Raikhel, N.V. (1998) An Arabidopsis VPS45 homolog
implicated in protein transport to the vacuole. Plant Physiol. 117: 407–415.
Bassham, D.C., Sanderfoot, A.A., Kovaleva, V., Zheng, H. and Raikhel, N.V.
(2000) AtVPS45 complex formation at the trans-Golgi network. Mol. Biol.
Cell 11: 2251–2265.
Batoko, H., Zheng, H.Q., Hawes, C. and Moore, I. (2000) A rab1 GTPase is
required for transport between the endoplasmic reticulum and Golgi apparatus and for normal Golgi movement in plants. Plant Cell 12: 2201–2218.
Borg, S. and Poulsen, C. (1994) Molecular analysis of two Ypt/Rab-related
sequences isolated from soybean (Glycine max) DNA libraries. Plant Mol.
Biol. 26: 175–187.
Bucci, C., Parton, R.G., Mather, I.H., Stunnenberg, H., Simons, K., Hoflack, B.
and Zerial, M. (1992) The small GTPase rab5 functions as a regulatory factor
in the early endocytic pathway. Cell 70: 715–728.
Chavrier, P., Parton, R.G., Hauri, H.P., Simons, K. and Zerial, M. (1990) Localization of low molecular weight GTP binding proteins to exocytic and endocytic compartments. Cell 62: 317–329.
Chen, Y.T., Holcomb, C. and Moore, H.P. (1993) Expression and localization of
two low molecular weight GTP-binding proteins, Rab8 and Rab10, by
epitope tag. Proc. Natl Acad. Sci. USA 90: 6508–6512.
da Silva Conceicao, A., Marty-Mazars, D., Bassham, D.C., Sanderfoot, A.A.,
Marty, F. and Raikhel, N.V. (1997) The syntaxin homolog AtPEP12p resides
on a late post-Golgi compartment in plants. Plant Cell 9: 571–582.
Darsow, T., Rieder, S.E. and Emr, S.D. (1997). A multispecificity syntaxin
homologue, Vam3p, essential for autophagic and biosynthetic protein transport to the vacuole. J. Cell Biol. 138: 517–529
Dugan, J.M., de Wit, C., McConlogue, L. and Maltese, W.A. (1995) The Rasrelated GTP-binding protein, Rab1B, regulates early steps in exocytic transport and processing of beta-amyloid precursor protein. J. Biol. Chem. 270:
10982–10989.
Feng, Y., Press, B. and Wandinger-Ness, A. (1995) Rab 7: an important regulator of late endocytic membrane traffic. J. Cell Biol. 131: 1435–1452.
Haizel, T., Merkle, T., Turck, F. and Nagy, F. (1995) Characterization of membrane-bound small GTP-binding proteins from Nicotiana tabacum. Plant
Physiol. 108: 59–67.
Harlow, E. and Lane, D. (1988) Antibodies: A Laboratory Manual. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY.
Horazdovsky, B.F., Busch, G.R. and Emr, S.D. (1994) VPS21 encodes a rab5like GTP binding protein that is required for the sorting of yeast vacuolar proteins. EMBO J. 13: 1297–1309.
Inaba, T., Nagano, Y., Nagasaki, T. and Sasaki, Y. (2002). Distinct localization
of two closely related Ypt3/Rab11 proteins on the trafficking pathway in
higher plants. J. Biol. Chem. 277: 9183–9188.
Jiang, L. and Rogers, J.C. (1998) Integral membrane proteins sorting to vacuoles
in plant cells: evidence for two pathways. J. Cell Biol. 143: 1183–1199.
Jin, J.B., Bae, H., Kim, S.J., Jin, Y.H., Goh, C.H., Kim, D.H., Lee, Y.J., Tse,
Y.C., Jiang, L. and Hwang, I. (2003) The Arabidopsis dynamin-like proteins
ADL1C and ADL1E play a critical role in mitochondrial morphogenesis.
Plant Cell 15: 2357–2369.
Jin, J.B., Kim, Y.A., Kim, S.J., Lee, S.H., Kim, D.H., Cheong, G.W. and Hwang,
I. (2001) A new dynamin-like protein, ADL6, is involved in trafficking from
the trans-Golgi network to the central vacuole in Arabidopsis. Plant Cell 13:
1511–1526.
Jones, S., Richardson, C.J., Litt, R.J. and Segev, N. (1998) Identification of regulators for Ypt1 GTPase nucleotide cycling. Mol. Biol. Cell 9: 2819–2837.
Khosravi-Far, R., Lutz, R.J., Cox, A.D., Conroy, L., Bourne, J.R., Sinensky, M.,
Balch, W.E., Buss, J.E. and Der, C.J. (1991). Isoprenoid modification of rab
proteins terminating in CC or CXC motifs. Proc. Natl Acad. Sci. USA 88:
6264–6268.
1220
Localization of Rha1 and Ara7
Kim, D.H., Eu, Y.-J., Yoo, C.M., Kim, Y.W., Pih, K.T., Jin, J.B., Kim, S.J.,
Stenmark, H. and Hwang, I. (2001) Trafficking of phosphatidylinositol 3phosphate from the trans-Golgi network to the lumen of the central vacuole
in plant cells. Plant Cell 13: 287–301.
Kim, W.Y., Cheong, N.E., Lee, D.C., Lee, K.O., Je, D.Y., Bahk, J.D., Cho, M.J.
and Lee, S.Y. (1996) Isolation of an additional soybean cDNA encoding Ypt/
Rab-related small GTP-binding protein and its functional comparison to Sypt
using a yeast ypt1-1 mutant. Plant Mol. Biol. 31: 783–792.
Lee, M.H., Min, M.K., Lee, Y.J., Jin, J.B., Shin, D.H., Kim, D.H., Lee, K.H. and
Hwang, I. (2002) ADP-ribosylation factor 1 of Arabidopsis plays a critical
role in intracellular trafficking and maintenance of endoplasmic reticulum
morphology in Arabidopsis. Plant Physiol. 129: 1507–1520.
Li, G., Barbieri, M.A., Colombo, M.I. and Stahl, P.D. (1994) Structural features
of the GTP-binding defective Rab5 mutants required for their inhibitory
activity on endocytosis. J. Biol. Chem. 269: 14631–14635.
Li, G. and Liang, Z. (2001) Phosphate-binding loop and Rab GTPase function:
mutations at Ser29 and Ala30 of Rab5 lead to loss-of-function as well as
gain-of-function phenotype. Biochem. J. 355: 681–689.
Li, Y.B., Rogers, S.W., Tse, Y.C., Lo, S.W., Sun, S.S., Jauh, G.Y. and Jiang, L.
(2002) BP-80 and homologs are concentrated on post-Golgi, probable lytic
prevacuolar compartments. Plant Cell Physiol. 43: 726–742.
Lu, C., Zainal, Z., Tucker, G.A. and Lycett, G.W. (2001). Developmental abnormalities and reduced fruit softening in tomato plants expressing an antisense
Rab11 GTPase gene. Plant Cell. 13: 1819–1833.
Morimoto, B.H., Chuang, C.C. and Koshland, D.E. Jr. (1991) Molecular cloning of a member of a new class of low-molecular-weight GTP-binding proteins. Genes Dev. 5: 2386–2391.
Mullock, B.M., Smith, C.W., Ihrke, G., Bright, N.A., Lindsay, M., Parkinson,
E.J., Brooks, D.A., Parton, R.G., James, D.E., Luzio, J.P. and Piper, R.C.
(2000). Syntaxin 7 is localized to late endosome compartments, associates
with Vamp 8 and is required for late endosome–lysosome fusion. Mol. Biol.
Cell 11: 3137–3153.
Ooi, C.E., Dell’Angelica, E.C. and Bonifacino, J.S. (1998). ADP-Ribosylation
Factor 1 (ARF1) regulates recruitment of the AP-3 adaptor complex to membranes. J. Cell Biol. 142: 391–402.
Novick, P. and Zerial, M. (1997). The diversity of Rab proteins in vesicle transport. Curr. Opin. Cell Biol. 9: 496–504.
Paris, N., Rogers, S.W., Jiang, L., Kirsch, T., Beevers, L., Phillips, T.E. and
Rogers, J.C. (1997) Molecular cloning and further characterization of a probable plant vacuolar sorting receptor. Plant Physiol. 115: 29–39.
Park, J.M., Kang, S.G., Pih, K.T., Jang, H.J., Piao, H.L., Yoon, H.W., Cho, M.J.
and Hwang, I. (1997) A dynamin-like protein, ADL1, is present in membranes as a high-molecular-mass complex in Arabidopsis thaliana. Plant
Physiol. 115: 763–771.
Peter, F., Nuoffer, C., Pind, S.N. and Balch, W.E. (1994). Guanine nucleotide
dissociation inhibitor is essential for Rab1 function in budding from the endoplasmic reticulum and transport through the Golgi stack. J. Cell Biol. 126:
1393–1406.
Pfeffer, S.R. (1994) Rab GTPases: master regulators of membrane trafficking.
Curr. Opin. Cell Biol. 6: 522–526.
Pfeffer, S.R. (2001). Rab GTPases: specifying and deciphering organelle identity and function. Trends Cell Biol. 11: 487–491.
Pimpl, P., Movafeghi, A., Coughlan, S., Denecke, J., Hillmer, S. and Robinson,
D.G. (2000) In situ localization and in vitro induction of plant COPI-coated
vesicles. Plant Cell 12: 2219–2236.
Piper, R.C. and Luzio, J.P. (2001) Late endosomes: sorting and partitioning in
multivesicular bodies. Traffic 2: 612–621.
Piper, R.C., Bryant, N.J. and Stevens, T.H. (1997). The membrane protein alkaline phosphatase is delivered to the vacuole via a route that is distinct from
the VPS-dependent pathway. J. Cell Biol. 138: 531–545
Prekeris, R., Klumperman, J. and Scheller, R.H. (2000) A Rab11/Rip11 protein
complex regulates apical membrane trafficking via recycling endosomes.
Mol. Cell 6: 1437–1448.
Ridley, A.J. (2001). Rho proteins: linking signaling with membrane trafficking.
Traffic 2: 303–310.
Rutherford, S. and Moore, I. (2002). The Arabidopsis Rab GTPase family:
another enigma variation. Curr. Opin. Plant Biol. 5: 518–528.
Rybin, V., Ullrich, O., Rubino, M., Alexandrov, K., Simon, I., Seabra, M.C.,
Goody, R. and Zerial, M. (1996) GTPase activity of Rab5 acts as a timer for
endocytic membrane fusion. Nature 383: 266–269.
Sanderfoot, A.A., Ahmed, S.U., Marty-Mazars, D., Rapoport, I., Kirchhausen,
T., Marty, F. and Raikhel, N.V. (1998) A putative vacuolar cargo receptor partially colocalizes with AtPEP12p on a prevacuolar compartment in Arabidopsis roots. Proc. Natl Acad. Sci. USA 95: 9920–9925.
Seabra, M.C. (1998) Membrane association and targeting of prenylated Ras-like
GTPases. Cell Signal. 10: 167–172.
Singer-Kruger, B., Stenmark, H., Dusterhoft, A., Philippsen, P., Yoo, J.S., Gallwitz, D. and Zerial, M. (1994) Role of three rab5-like GTPases, Ypt51p,
Ypt52p and Ypt53p, in the endocytic and vacuolar protein sorting pathways
of yeast. J. Cell Biol. 125: 283–298.
Sohn, E.J., Kim, E.S, Zhao, M., Kim, S.J., Kim, H., Kim, Y.W., Lee, Y.J.,
Hillmer, S., Sohn, U., Jiang, L. and Hwang, I. (2003). Rha1, an Arabidopsis
Rab5 homolog, plays a critical role in the vacuolar trafficking of soluble
cargo proteins. Plant Cell 15: 1057–1070.
Soldati, T., Riederer, M.A. and Pfeffer, S.R. (1993) Rab GDI: a solubilizing and
recycling factor for rab9 protein. Mol. Biol. Cell 4: 425–434.
Sonnichsen, B., De Renzis, S., Nielsen, E., Rietdorf, J. and Zerial, M. (2000)
Distinct membrane domains on endosomes in the recycling pathway visualized by multicolor imaging of Rab4, Rab5 and Rab11. J. Cell Biol. 149: 901–
914.
Stenmark, H., Valencia, A., Martinez, O., Ullrich, O., Goud, B. and Zerial, M.
(1994) Distinct structural elements of rab5 define its functional specificity.
EMBO J. 13: 575–583.
Terryn, N., Arias, M.B., Engler, G., Tire, C., Villarroel, R., Van Montagu, M.
and Inze, D. (1993) rha1, a gene encoding a small GTP binding protein from
Arabidopsis, is expressed primarily in developing guard cells. Plant Cell 5:
1761–1769.
Tse, Y.C., Mo, B., Hillmer, S., Zhao, M., Lo, S.W., Robinson, D.G. and Jiang, L.
(2004). Identification of multivesicular bodies as prevacuolar compartments
in Nicotiana tabacum BY-2 cells. Plant Cell 16: 672–693.
Ueda, T., Matsuda, N., Anai, T., Tsukaya, H., Uchimiya, H. and Nakano, A.
(1996). An Arabidopsis gene isolated by a novel method for detecting genetic
interaction in yeast encodes the GDP dissociation inhibitor of Ara4 GTPase.
Plant Cell 8: 2079–2091.
Ueda, T., Yoshizumi, T., Anai, T., Matsui, M., Uchimiya, H. and Nakano, A.
(1998). AtGDI2, a novel Arabidopsis gene encoding a Rab GDP dissociation
inhibitor. Gene 206: 137–143.
Ueda, T., Yamaguchi, M., Uchimiya, H. and Nakano, A. (2001). Ara6, a plantunique novel type Rab GTPase, functions in the endocytic pathway of Arabidopsis thaliana. EMBO J. 20: 4730–4741.
Ullrich, O., Horiuchi, H., Bucci, C. and Zerial, M. (1994) Membrane association of Rab5 mediated by GDP-dissociation inhibitor and accompanied by
GDP/GTP exchange. Nature 368: 157–160.
Ullrich, O., Stenmark, H., Alexandrov, K., Huber, L.A., Kaibuchi, K., Sasaki, T.,
Takai, Y. and Zerial, M. (1993) Rab GDP dissociation inhibitor as a general
regulator for the membrane association of rab proteins. J. Biol. Chem. 268:
18143–18150.
Vadlamudi, R.K., Wang, R.A., Talukder, A.H., Adam, L., Johnson, R. and
Kumar, R. (2000) Evidence of Rab3A expression, regulation of vesicle trafficking and cellular secretion in response to heregulin in mammary epithelial
cells. Mol. Cell. Biol. 20: 9092–9101.
Vernoud, V., Horton, A.C., Yang, Z. and Nielsen, E. (2003). Analysis of the
small GTPase gene superfamily of Arabidopsis. Plant Physiol. 131: 1191–
1208.
Waters, M.G. and Pfeffer, S.R. (1999) Membrane tethering in intracellular transport. Curr. Opin. Cell Biol. 11: 453–459.
Wieland, F. and Harter, C. (1999). Mechanisms of vesicle formation: insights
from the COP system. Curr. Opin. Cell Biol. 11: 440–446.
Wilson, A.L. and Maltese, W.A. (1993). Isoprenylation of Rab1B is impaired by
mutations in its effector domain. J. Biol. Chem. 268: 14561–14564.
Zarsky, V., Cvrckova, F., Bischoff, F. and Palme, K. (1997). At-GDI1 from Arabidopsis thaliana encodes a rab-specific GDP dissociation inhibitor that complements the sec19 mutation of Saccharomyces cerevisiae. FEBS Lett. 403:
303–308.
Zuk, P.A. and Elferink, L.A. (1999) Rab15 mediates an early endocytic event in
Chinese hamster ovary cells. J. Biol. Chem. 274: 22303–22312.
(Received January 11, 2004; Accepted June 8, 2004)