* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download CH. 12.3 : DNA, RNA, and Protein
Community fingerprinting wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Protein adsorption wikipedia , lookup
Molecular cloning wikipedia , lookup
RNA silencing wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Biochemistry wikipedia , lookup
List of types of proteins wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Polyadenylation wikipedia , lookup
Proteolysis wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Expanded genetic code wikipedia , lookup
Molecular evolution wikipedia , lookup
Non-coding DNA wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Point mutation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genetic code wikipedia , lookup
Non-coding RNA wikipedia , lookup
Messenger RNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
CH. 12.3 : DNA, RNA, and Protein Section Objectives: •Relate the concept of the gene to the sequence of nucleotides in DNA. •Sequence the steps involved in protein synthesis. •Explain the different types of RNA involved in protein synthesis Genes and Proteins • The sequence of nucleotides in DNA contain information. • This information is put to work through the production of proteins. • Proteins fold into complex, threedimensional shapes to become key cell structures and regulators of cell functions. • Thus, by encoding the instructions for making proteins, DNA controls cells. Genes and Proteins • You learned earlier that proteins are polymers of amino acids. • The sequence of nucleotides in each gene contains information for assembling the string of amino acids that make up a single protein. DNA Proteins Cells Bodies DNA has the information to build proteins genes proteins cells bodies DNA gets all the glory, Proteins do all the work Cell organization • DNA – DNA is in the nucleus • genes = instructions for making proteins – want to keep it there = protected • “locked in the vault” cytoplasm nucleus Cell organization aa aa • Proteins aa – chains of amino acids – made by a “protein factory” in cytoplasm – protein factory = ribosome cytoplasm aa aa aa aa aa aa aa build proteins nucleus ribosome Passing on DNA information: need RNA • RNA like DNA, is a nucleic acid • RNA structure differs from DNA structure in three ways. Phosphate group Nitrogenous base (A, G, C, or U) – 1. Has ribose sugar instead of deoxyribose (DNA) – 2. Replaces thymine (T) with uracil (U) – 3. Single stranded as opposed to double stranded DNA Uracil (U) Sugar (ribose) RNA • RNA has a different function than DNA • Whereas DNA provides the instructions for protein synthesis, RNA does the actual work of protein synthesis. • RNAs take from DNA the instructions on how the protein should be assembled, then—amino acid by amino acid—RNAs assemble the protein. RNA • 3 types of RNA – 1. Messenger RNA (mRNA), single, uncoiled strand which brings instructions from DNA in the nucleus to the site of protein synthesis. – 2. Ribosomal RNA (rRNA), globular form, makes up the ribosome –the construction site of proteins binds (site of protein synthesis); binds to the mRNA and uses the instructions to assemble the amino acids in the correct order. – 3. Transfer RNA (tRNA) single, folded strand that delivers the proper amino acid to the site at the right time aa Passing on DNA information • Need to get DNA gene information from nucleus to cytoplasm – need a copy of DNA – messenger RNA aa aa aa aa aa aa cytoplasm aa aa aa build proteins mRNA nucleus ribosome Protein Synthesis: 2 step process 1. Transcription 2. translation 1.Transcription: DNA -> mRNA • In the nucleus, enzymes make an RNA copy of a portion of a DNA strand The main difference between transcription and DNA replication is that transcription results in the formation of one single-stranded RNA molecule rather than a double-stranded DNA molecule. 2. Translation: mRNA -> Protein process of converting the information in a sequence of nitrogenous bases in mRNA into a sequence of amino acids in protein aa aa From nucleus to cytoplasm aa aa aa aa aa transcription DNA mRNA aa aa protein aa translation trait nucleus cytoplasm Transcription • Making mRNA from DNA • DNA strand is the template (pattern) – match bases • U:A • G:C • Enzyme – RNA polymerase Matching bases of DNA & RNA • Double stranded DNA unzips T G G T A C A G C T A G T C A T CG T A C CG T Matching bases of DNA & RNA • Double stranded DNA unzips T G G T A C A G C T A G T C A T CG T A C CG T Matching bases of DNA & RNA • Match RNA bases to DNA bases on one of the DNA strands A G C A G G U U C A AG U C G A U A C A C C RNA polymerase A U G T G G T A C A G C T A G T C A T CG T A C CG T U C Matching bases of DNA & RNA aa • U instead of T is matched to A aa aa DNA TACGCACATTTACGTACGCGG aa aa aa mRNA AUGCGUGUAAAUGCAUGCGCC aa aa aa aa ribosome A C C A U G U C G A U C A G U A G C A U G G C A RNA Processing • Not all the nucleotides in the DNA of eukaryotic cells carry instructions—or code—for making proteins. • Genes usually contain many long noncoding nucleotide sequences, called introns, that are scattered among the coding sequences. • Regions that contain information are called exons because they are expressed. • When mRNA is transcribed from DNA, both introns and exons are copied. • The introns must be removed from the mRNA before it can function to make a protein. • Enzymes in the nucleus cut out the intron segments and paste the mRNA back together. • The mRNA then leaves the nucleus and travels to the ribosome. RNA Processing:simplified • Noncoding segments called introns are spliced out ( coding segment = exons) Genetic information written in codons is translated into amino acid sequences • Transfer of DNA to mRNA uses “language” of nucleotides – Letters: nitrogen bases of nucleotides (A,T,G,C) – Words: codons ~triplets of bases ( ex. AGC) – Sentences: polypeptide chain – The codons in a gene specify the amino acid sequence of a polypeptide The Genetic Code • The nucleotide sequence transcribed from DNA to a strand of messenger RNA acts as a genetic message, the complete information for the building of a protein.. • Virtually all organisms share the same genetic code Translation: From mRNA to Protein • takes place at the ribosomes in the cytoplasm. Involves 3 types of RNA 1. Messenger RNA (mRNA) =carries the blueprint for construction of a protein 2. Ribosomal RNA (rRNA) = the construction site where the protein is made 3. Transfer RNA (tRNA) = the truck delivering the proper amino acid to the site at the right time Transfer RNA molecules serve as interpreters during translation • In the cytoplasm, a ribosome attaches to the mRNA and translates its message into a polypeptide • The process is aided by transfer RNAs • Each tRNA molecule has a triplet anticodon on one end and an amino acid attachment site on the other • Anticodon base pairs with codon of mRNA cytoplasm aa aa aa aa aa aa proteinaa aa aa aa nucleus ribosome A C C A U G U C G A U C A G U A G C A U G G C A trait How does mRNA code for proteins • mRNA leaves nucleus • mRNA goes to ribosomes in cytoplasm • Proteins built from instructions on mRNA How? mRNA A C C A U G U C G A U C A GU A GC A U G GC A aa aa aa aa aa aa aa aa DNA How does mRNA code for proteins? TACGCACATTTACGTACGCGG ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein aa aa aa aa aa aa How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)? aa aa mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon mRNA ribosome AUGCGUGUAAAUGCAUGCGCC ? protein Met Arg Val Asn Ala Cys Ala Codon = block of 3 mRNA bases The Genetic code • For ALL life! – strongest support for a common origin for all life • Code has duplicates – several codons for each amino acid – mutation insurance! Start codon AUG methionine Stop codons UGA, UAA, UAG How are the codons matched to amino acids? DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC codon UAC tRNA amino acid Met GCA Arg CAU anti-codon Val Anti-codon = block of 3 tRNA bases mRNA to protein = Translation • The working instructions mRNA • The reader ribosome • The transporter transfer RNA (tRNA) ribosome mRNA A C C A U G U C G A U C A GU A GC A U G GC A U GG tRNA aa aa aa U A C tRNA aa A G tRNA aa C U AG tRNA aa From gene to protein aa aa transcription DNA aa translation protein aa mRNA aa aa aa ribosome A C CA U GU C G A U C A GU A GC A U GGC A nucleus tRNA cytoplasm aa trait aa cytoplasm aa protein aa aa aa transcription translation aa aa aa aa aa aa nucleus trait From gene to protein protein transcription translation