Download Biology- Semester 2 Final Exam Review 2012

Biology- Semester 2 Final Exam Review 2012—Make note cards of this, or just answer the
question, or make posters of each topic—whatever helps you to REMEMBER and UNDERSTAND each
topic.
Meiosis pg. 161-164
1. What is the purpose of meiosis?
2. Draw the phases of meiosis
3. Summarize the events of meiosis I and II
4. Compare the meiosis phases and end products with the mitosis phases and end products.
How would you know from a picture which is which?
5. Explain crossing-over and how it contributes to the production of unique individuals.
6. How many chromosomes are in a human somatic cell? In a gamete?
7. The diploid number of chromosomes for humans is ____. The haploid number is____.
8. What is the difference between autosomes and sex chromosomes?
Meiosis and Nondisjunction pg. 239-240
1. Describe nondisjunction and how it causes an embryo to have too many or to few
chromosomes.
2. Describe a karyotype. What can one determine by analyzing a karyotype?
Structure of DNA pg. 193-199
1. Draw the structure of the DNA double helix and label the sugar (deoxyribose), phosphate
group and the 4 nitrogen bases. Be sure to correctly pair the nitrogen bases. (Draw a 6
rung DNA ladder)
2. What are the two types of nucleic acids?What are the functions of the two types of
nucleic acids?
3. What are the building blocks of nucleic acids?
4. Name the purines. Name the pyrimidines.
5. Rosalind Franklin? Watson and Crick?
6. Explain how and why DNA replicates prior to cell division. Include the enzymes DNA
polymerase, DNA helicase and DNA ligase.
7. How does spontaneous mutation relate to replication?
Protein Synthesis pg. 204-210
1.
2.
3.
4.
5.
6.
Outline the flow of genetic information in cells from DNA to protein.
List three ways in which the structure of RNA differs from that of DNA.
Summarize the process of transcription. Where does it occur?
What is a codon?
Describe the importance of the genetic code.
Compare the structure and role of mRNA, rRNA, and tRNA in translation. Where does
translation occur?
Transcribe and translate the following DNA code into the correct sequence of amino
acids (protein). TACTTAGGCAATGGCAATTTAGGGATT (Use your amino acid
chart)
7. What amino acids would translation of the mRNA with the sequence
AUGCAAGGAGCAUAG produce? (Use your amino acid chart)
8. Describe three types of gene mutations. (substitution, deletion, insertion)
Genetics pg. 172-189
1.
2.
3.
4.
5.
Distinguish between dominant and recessive traits.
State two laws of heredity that were developed from Mendel’s work.
Differentiate genes from alleles.
How did Mendel’s F1 generation plants differ from his F2 generation plants?
Many inherited disorders of humans appear in children of parents who do not have the
disorder. How can you explain this?
6. Explain why a phenotype might not always indicate genotype.
7. In rabbits, the allele for black coat color is dominant over the allele for brown coat color.
Predict the results of a cross between a rabbit homozygous for black coat color and a
rabbit homozygous for brown coat color.
8. Differentiate between incomplete dominance and codominance.
9. Illustrate in the form of a Punnett square the results of crossing a pink-flowering four
o’clock with a white-flowering four o’clock.
10. A red horse is crossed with a roan horse. What are the possible genotypes and phenotypes
of the offspring?
11. A female Labrador retriever has a litter containing nine black puppies with black noses,
three black puppies with pink noses, three white puppies with black noses, and one white
puppy that has a pink nose. What type of cross is this an example of? Write down the
genotypes and genotypic ratio for the puppies.
12. Summarize how a gardener who has a pea plant that produces round seeds can determine
whether the plant is homozygous or heterozygous for the allele that determines seed
texture. (In pea plants, round seed texture is dominant over wrinkled seed texture.)
13. Using the rules of probability, what are the chances of getting an offspring with the
genotype AaBBCcDD from a cross between parents that are AaBbCcDd.
14. What is a polygenic trait?
15. Colorblindness is a recessive, sex-linked trait. A woman and a man, both with normal
vision, have three daughters with normal vision. One of the daughters marries a man
with normal vision, and they have a son who is colorblind.
Part A - Which parent of the son is the carrier of the trait? Explain your answer.
Part B - What is the likelihood that the children of a woman heterozygous for
colorblindness and a colorblind man will express the trait? Explain your answer.
15. A man with blood type B marries a woman with blood type A. They have a child with
blood type O. Is this possible?
16. Fill in the genotypes for the individuals in the pedigrees below.
a. autosomal recessive disorder/trait
b. X-linked recessive disorder/trait
Evolution pg. 287-333
1. What can one determine from looking at the geologic time scale?
2. Where did Darwin make many observations and collect data?
3. Describe the five parts of reasoning in Darwin’s theory of evolution by natural selection.
Use an example in your answer.
4. What evidence supports the hypothesis that whales evolved from land-dwelling
mammals?
5. Compare the concepts of homologous structures, analogous structures, and vestigial
structures.
6. What do scientists look at to determine evidence of evolution? (Name 3)
7. Explain why antibiotics are not consistently effective against infection of bacteria.
8. Define microevolution.
9. Describe 4 conditions that can disrupt genetic equilibrium (change gene frequencies) and
cause evolution to occur.
10. Explain why genetic drift is more significant in smaller populations.
11. Contrast stabilizing selection, disruptive selection and directional selection.
12. Explain how the isolation of populations can lead to speciation.
Ecology pg.359-413
1. Assuming wolves eat deer, how could a disease that kills a large portion of the wolf
population affect the deer population in an area of the eastern United States?
2. Compare biotic with abiotic factors.
3. Summarize the role of producers in an ecosystem.
4. Identify several kinds of consumers in an ecosystem.
5. Explain the importance of decomposers.
6. Explain what a food web is and what it tells someone about an ecosystem.
7. Explain why ecosystems usually contain only a few trophic levels.
8. Describe the Carbon and Nitrogen (biogeochemical) cycles.
9. Compare the exponential model (J shaped curve) and the logistic model (S shaped curve)
of population growth.
10. Compare parasitism, commensalism, and mutualism, and give one example of each.
11. Distinguish between primary and secondary succession.
12. Explain biological magnification
13. Explain the 10% rule.
Pig Dissection/Anatomy
1. Name all structures found in the pig—include the function of each structure
2. How can you tell if a fetal pig is female or male
3. How do you determine how old a fetal pig is?
4. Be able to identify structures from a picture of the pig.