Download emboj7601266-sup

Castilla-Llorente et al. “Spo0A is an inhibitor of DNA replication”
Supplementary information
Materials and methods
General Methods
DNA manipulations were carried out according to Sambrook et al. (1989). Standard
procedures were used for transformations. [32P]ATP (3000 Ci/mmol) was obtained from
Amersham International plc. Plasmid DNA was isolated using Wizard Plus DNA purification
kit (Promega, Madison, USA). DNA fragments were isolated from gels using the Qiaquick
Gel Extraction Kit (Qiagen Inc., Chatsworth, USA). PCR reactions were carried out using the
proofreading-proficient Vent DNA polymerase (New England Biolabs, Beverly, Ma, USA).
Template DNAs were denatured for 1 min at 94 ºC. Next, DNA fragments were amplified in
30 cycles of denaturation (30 sec; 94 ºC), primer annealing (1 min; 50 ºC), and DNA
synthesis (30 sec; 73 ºC).
Protein Purifications
29 proteins p6 (replication initiator protein) TP, SSB (p5) and DNA polymerase were
purified as described (Serna-Rico et al, 2000). Spo0A was purified essentially as described
(Muchová et al, 2004). Similar to published results (Ladds et al, 2003), 15-40% of the
purified Spo0A protein was in its dimeric active form as assessed by gel filtration.
B. subtilis DnaA protein was overproduced from the pBsdnaA1 plasmid [kindly provided
by Dr. W. Messer] in E. coli strain AQ3519 and purified as described essentially by Krause et
al. (1997) with the following modifications. Harvested B. subtilis cells were ground with
twice their weight of alumina powder (Merck) for 30 min. The slurry was resuspended in
buffer 6 (50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 5% (v/v) glycerol and 7 mM mercaptoethanol) containing 0.8 M NaCl using 4 ml per gram of cells. Alumina and intact
1
Castilla-Llorente et al. “Spo0A is an inhibitor of DNA replication”
cells, and insoluble proteins were removed by centrifugation (25 min at 3000 and 12000 rpm,
respectively). DNA was then removed by polyethyleneimine (PEI, Sigma) precipitation
(0.3% per 120 U A260). Next, the salt concentration was lowered to 0.1 M to precipitate
proteins. The protein pellet was resuspended in buffer 6 containing 1 M NaCl and
precipitated with ammonium sulphate at 50%. The precipitate was dissolved in buffer 6 at a
final salt concentration of 0.1 M. Then, the solution was applied to a phospho-cellulose P11
column (Whatman). The column was subsequently washed with 3 and 4 volumes of buffer 6
containing first 0.125 M NaCl, and then 0.15 M NaCl and eluted with buffer 6 containing 1
M NaCl. The DnaA-containing fractions were pooled, their salt concentration lowered to 0.1
M, and applied to a fresh phospho-cellulose column. After subsequent washing with 4
volumes of buffer 6 containing first 0.125 M and then 0.14 M NaCl, protein DnaA was eluted
with buffer 6 containing 1 M NaCl. Finally, the eluate was dialyzed against buffer 6
containing 250 mM NaCl and 50% glycerol and the protein was stored at -70 °C in aliquots.
B. subtilis HBsu was purified from B. subtilis 110NA essentially as described (Horcajadas,
2000). Harvested B. subtilis cells were ground with twice their weight of alumina powder
(Merck) for 15 min. The slurry was resuspended in buffer 6 containing 1 M NaCl using 4 ml
per gram of cells. Alumina and intact cells, and insoluble proteins were removed by
centrifugation (20 min at 3000 and 11000 rpm, respectively). The salt concentration was
lowered to 0.8 M after which the DNA was removed by PEI (Sigma) precipitation (0.3% per
120 U A260). Next, the PEI and salt concentrations were lowered to 0.04% and 0.4 M,
respectively, and the proteins were precipitated with ammonium sulphate at 70%. The
precipitate was dissolved in 420 ml buffer 6 to a final salt concentration of 0.25 M. Then, the
protein solution was applied to a phospho-cellulose P11 column (Whatman). The column was
washed with 10 volumes of buffer 6 containing 0.35 M NaCl and eluted with the same buffer
containing 0.6 M NaCl. The HBsu containing fractions were pooled, the salt concentration
2
Castilla-Llorente et al. “Spo0A is an inhibitor of DNA replication”
lowered to 0.3 M and then applied to a Heparine-column (Sigma). The column was washed
with buffer 6 containing increasing concentrations of salt up to 0.4 M and HBsu was then
eluted at 1 M NaCl. Finally, the eluate was dialyzed against buffer 6 containing 0.2 M NaCl
and 50% glycerol and the protein was stored at -70 °C in aliquots.
References
Horcajadas JA (2000) Transcriptional control of the Bacillus bacteriophage GA-1. 2000.
Doctoral thesis. Universidad Autónoma, Madrid.
Krause M, Rückert B, Lurz R, Messer W (1997) Complexes at the replication origin of
Bacillus subtilis with homologous and heterologous DnaA protein. J Mol Biol 274: 365380
Ladds JC, Muchová K, Blaškovic D, Lewis RJ, Brannigan JA, Wilkinson AJ, Barák I (2003)
The response regulator Spo0A from Bacillus subtilis is efficiently phosphorylated in
Escherichia coli. FEMS Microbiol Lett 223: 153-157
Muchová K, Lewis RJ, Perecko D, Brannigan JA, Ladds JC, Leech A, Wilkinson AJ, Barák I
(2004) Dimer-induced signal propagation in Spo0A. Mol Microbiol 53: 829-842
Sambrook J, Fritsch EF & Maniatis T (1989) Molecular cloning: a laboratory manual. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, New York
Serna-Rico A, Illana B, Salas M, Meijer WJJ (2000) The putative coiled coil domain of the
29 terminal protein is a major determinant involved in recognition of the origin of
replication. J Biol Chem 275: 40529-40538
3
Castilla-Llorente et al. “Spo0A is an inhibitor of DNA replication”
Table SI. Bacterial strains and plasmids used
Strain
Relevant genotype
B. subtilis
168
trpC2
WM90
168, spo0A::Km
110NA
trpC2, spo0A3
sad67::Tc trpC2, amyE::(Pspac-sad67 Tet)
E. coli

BL21(DE3) Lon, ompT, DE3 lysogen
AQ3519
DH5α
argH, deo, dnaA850::Tn10, his-29, metB, metD88, pro,
rnh::cat, thyA, trpA9605
F-/endA1, hsdR17, (rK-mK+), supE44, thi-1, recA1, gyrA,
(Nalr), relA1, (lacIZYA-argF)U169, deoR,
(80dlac(lacZ)M15)
Source or reference
BGSCa
(Meijer et al, 2005)
(Moreno et al, 1974)
(Veening et al, 2005)
(Studier and Moffat,
1986)
(Kline et al, 1986)
(Woodcock et al, 1989)
Plasmids
pET0A
pBsdnaA1
pBsoriC4
pET26b(+) based Spo0A overexpression vector
(Muchová et al, 2004)
B. subtilis DnaA overexpression vector
(Krause et al, 1997)
pLEX5BA derivative carrying the entire B. subtilis oriC (Krause et al, 1997)
region with flanking sequences (positions -221 to 2314)
a
Bacillus Genetic Stock Center, Department of Biochemistry, The Ohio State University,
Columbus, OH, USA.
References
Kline BC, Kogoma T, Tam JE, Shields MS (1986) Requirement of the Escherichia coli dnaA
gene product for plasmid F maintenance. J Bacteriol 168: 440-443
Krause M, Rückert B, Lurz R, Messer W (1997) Complexes at the replication origin of
Bacillus subtilis with homologous and heterologous DnaA protein. J Mol Biol 274: 365380
Moreno F, Camacho A, Viñuela E, Salas M (1974) Suppressor-sensitive mutants and genetic
map of Bacillus subtilis bacteriophage 29. Virology 62: 1-16
Muchová K, Lewis RJ, Perecko D, Brannigan JA, Ladds JC, Leech A, Wilkinson AJ, Barák I
(2004) Dimer-induced signal propagation in Spo0A. Mol Microbiol 53: 829-842
Studier FW, Moffat BA (1986) Use of T7 RNA polymerase to direct selective high-level
expression of cloned genes. J Mol Biol 189: 113-130
Veening JW, Hamoen LW, Kuipers OP (2005) Phosphatases modulate the bistable
sporulation gene expression pattern in Bacillus subtilis. Mol Microbiol 56: 1481-1494
Woodcock DM, Crowther PJ, Doherty J, Jefferson S, DeCruz E, Noyer-Weidner M, Smith
SS, Michael MZ, Graham MW (1989) Quantitative evaluation of Escherichia coli host
strains for tolerance to cytosine methylation in plasmid and phage recombinants. Nucleic
Acids Res 17: 3469-3478
4
Castilla-Llorente et al. “Spo0A is an inhibitor of DNA replication”
Table SII. Oligonucleotides used
Sequence (5’-3’)a
Position*
Name
29
AACCGGATCCATGCGACACAGACGAAGCGCTAAAACGTGGG
Phi_LL
193-162
GTGTGGATCCTCCTATGATTGGTTGTCTTATTACCTTACTTC
Phi_LR
19091-19125
AAAGTAAGCCCCCACCCTCACATGATACCATTCTCC
Phi_left
1-36
AAAGTAGGGTACAGCGACAACATACACCATTTCCCC
Phi_right
19285-19250
oriC
GCAACCATAATAGGATCCCATACCTTTTCAACTTTCGAAACC
AaUp_U
103-127
AATAGAATTCCCATCTTCCGGCACGTCCCTCCTTTTCTTAGAAAATGGCGTC
AaUP_L
615-574
AAAAGGATCCCTGCTGGCAGATGATGAACAGCTTCAGCAGCATGT
AaDOWN_U
1890-1924
CTTTTTGAATTCGTGAATTTCATTTTTATCCTCCTAACGGATAATGT
AaDOWN_L
2153-2117
TGTGGGATCCATTGCAAGCTCTCGTTTATTTTGGTATTATATTTGTG
AaUP_U2
321-359
GGTAGAATTCGTAATCAAGAGTTAAAACACAAATATAATACCAAAATAAACGAGAGC
AaUP_L2
376-336
CTTTTCGGAAGTCATACACAGTCTGTCC
OriC_ATrr
1988-1015
_Up
GAATGGGAATCGTGGTTCTGGATGAAAC
OriC_ATrr_
2228-2201
Down
*: positions referring to 29 are according its linear 19.285 bp genome and those referring to B. subtilis
oriC are according Moriya et al. (1992)
Reference
Moriya S, Atlung T, Hansen FG, Yoshikawa H, Ogasawara N (1992) Cloning of an
autonomously replicating sequence (ars) from the Bacillus subtilis chromosome. Mol
Microbiol 6: 309-315
5