Download Protein synthesis

Name: ____________________________ Homework/class-work Unit#4 Protein synthesis, enzymes and mutations (25 points)
Think and try every question. There is no reason for a blank response or an I don’t know. Any blanks will receive a zero.
Every assignment must be done on a separate piece of paper. Each assignment must be complete, neat, in complete sentences
and done on time for full credit. Any assignment may be used as a take home or pop quiz at any time. One missing or late
assignment will lose 5 points, 2 will lose 15 points, 3 will be considered incomplete and given a zero.
1. Gene expression reading:
Date: __________________
Protein synthesis
During the 1950s and 1960s, it became apparent that DNA is essential in the synthesis of proteins. Proteins are used in enzymes and
as structural materials in cells. Many specialized proteins function in cellular activities. For example, in humans, the hormone insulin
and the muscle cell filaments are composed of protein. The hair, skin and nails of humans are composed of proteins, as are all the
hundreds of thousands of enzymes in the body.
The key to a protein molecule is how the amino acids are linked. The sequence of amino acids in a protein is a type of code that
specifies the protein and distinguishes one protein from another. A genetic code in the DNA determines the amino acid sequence.
The genetic code consists of the sequence of nitrogenous bases in the DNA. How the nitrogenous base code is translated to an
amino acid sequence in a protein is the basis for protein synthesis.
For protein synthesis to occur, several essential materials must be present, such as a supply of the 20 amino acids, which comprise
most proteins. Another essential element is a series of enzymes that will function in the process. DNA and another form of nucleic
acid called ribonucleic acid (RNA) are essential.
RNA is the nucleic acid that carries instructions from the nuclear DNA into the cytoplasm, where protein is synthesized. RNA is
similar to DNA, with three exceptions. First, the
carbohydrate in RNA is ribose rather than
deoxyribose, second, RNA nucleotides contain the
pyrimidine uracil rather than thymine and finally
DNA is double stranded and RNA is a single
strand.
Types of RNA
In the synthesis of protein, three types of RNA
function. The first type called ribosomal RNA
(rRNA). This form of RNA is used to manufacture
ribosomes. Ribosomes are ultramicroscopic particles
of rRNA and protein. They are the places (the
chemical “workbenches”) where amino acids are
linked to one another to synthesize proteins.
Ribosomes may exist along the membrane of the
endoplasmic reticulum of in the cytoplasm of the cell.
A second important type of RNA is transfer RNA
(tRNA). Transfer RNA exists in the cell cytoplasm
and carries amino acids to the ribosome for protein
synthesis. When protein synthesis is taking place,
enzymes link tRNA molecules to amino acids in a
highly specific manner. For example, tRNA
molecule X will link only to amino acid X; tRNA Y
will link only to amino acid Y.
The third form of RNA is messenger RNA (mRNA).
In the nucleus, messenger RNA receives the genetic
code in the DNA and carries the code into the
cytoplasm where protein synthesis takes place.
Messenger RNA is synthesized in the nucleus at the DNA molecule. During the synthesis, the genetic information is transferred from
the DNA molecule to the mRNA molecule. In this way, a genetic code can be used to synthesize a protein in a distant location.
Transcription
Transcription is one of the first processes in the mechanism of protein synthesis. In transcription, a complementary strand of mRNA
is synthesized according to the nitrogenous base code of DNA. To begin, the DNA double helix opens and the enzyme RNA
polymerase binds to an area of the DNA strand that serves as a template for making the mRNA strand. The enzyme selects
complementary bases from available nucleotides and positions them in an mRNA molecule according to the principle of
complementary base pairing. The chain of mRNA lengthens until a “stop” message is received and the mRNA is released.
The nucleotides of the DNA strand are read in groups of three. Each group is a codon. Thus, a codon may be CGA, or TTA, or GCT,
or any other combination of the four bases, depending on their sequence in the DNA strand. Each codon will later serve as a “code
word” for an amino acid. Thus, the mRNA molecule consists of nothing more than a series of codons received from the genetic
message in DNA.
Translation
The genetic code is transferred to an amino acid sequence in a protein through the translation process, which begins with the arrival
of the mRNA molecule at the ribosome (rRNA). When the mRNA molecule reaches the ribosome the tRNA molecules were
uniting with their specific amino acids. The tRNA molecules then began transporting their amino acids to the ribosomes to meet
the mRNA molecule.
After it arrives at the ribosome, the mRNA molecule exposes its
bases in sets of three, the codons. Each codon has a
complementary codon called an anticodon on the tRNA
molecule. When the codon of the mRNA molecule complements
the anticodon on the tRNA molecule, the tRNA places the
specific amino acid in that position. Then the next codon of the
mRNA is exposed, and the tRNA brings the next amino acid
(anticodon) and the ribosome links the two amino acids with a
peptide bond.
One by one, amino acids are added to the growing chain until the
ribosome has “read” the entire mRNA and tRNA has brought all of
the amino acids. After the protein has been synthesized
completely, it is removed form the ribosome for further processing
and to perform its function. For example, the protein may be
stored in the golgi body before being released by the cell, or it may
be stored in the lysosome as a digestive enzyme. After synthesis, the mRNA molecule breaks up and the nucleotides return to the
nucleus. The tRNA molecules return to the cytoplasm to unite with fresh molecules of amino acids, and the ribosome awaits the
arrival of a new mRNA molecule.
The entire process
Enzymes
An enzyme is a protein that catalyzes, or speeds up, a chemical reaction. Enzymes are essential to sustain life because most
chemical reactions in biological cells would occur too slowly, or would lead to different products without enzymes. Like all catalysts,
enzymes work by providing an alternate pathway of lower activation energy of a reaction, thus allowing the reaction to proceed much
faster. Enzymes may speed up reactions by a factor of many millions. An enzyme, like any catalyst, remains unaltered by the
completed reaction and can therefore continue to function.
Enzyme activity can be affected by other molecules. Inhibitors are naturally occurring or synthetic molecules that decrease or abolish
enzyme activity; activators are molecules that increase activity. Some irreversible inhibitors bind enzymes very tightly, effectively
inactivating them. Many drugs and poisons act by inhibiting enzymes. Aspirin inhibits the COX-1 and COX-2 enzymes that produce
the inflammation messenger prostaglandin, thus suppressing pain and inflammation. The poison cyanide inhibits cytochrome c
oxidase, which effectively blocks cellular respiration.
3D Structure
In enzymes, as with other proteins, function is determined by structure. As with any protein, each monomer is actually produced as a
long, linear chain of amino acids, which folds in a particular fashion to produce a three-dimensional product. Many enzymes can be
unfolded or inactivated by heating, which destroys the three-dimensional
structure of the protein.
Most enzymes are larger than the substrates they act on and only a very
small portion of the enzyme, around 10 amino acids, come into direct
contact with the substrate(s). This region, where binding of the substrate(s)
and then the reaction occurs, is known as the active site of the enzyme.
Some enzymes contain sites that bind cofactors, which are needed for
catalysis. Certain enzymes have binding sites for small molecules, which
are often direct or indirect products or substrates of the reaction catalyzed.
This binding can serve to increase or decrease the enzyme's activity
(depending on the molecule and enzyme), providing a means for feedback
regulation.
Specificity
Enzymes are usually specific as to the reactions they catalyze and the substrates that are involved in these reactions. Shape, charge
complementarity, and hydrophillic/hydrophobic character of enzyme and substrate are responsible for this specificity.
"Lock and key" model
Enzymes are very specific and it was suggested by Emil Fischer in
the 1890s that this was because the enzyme had a particular shape
into which the substrate(s) fit exactly. This is often referred to as "the
lock and key" model. An enzyme combines with its substrate(s) to
form a short-lived enzyme-substrate complex.
Induced fit model
In 1958 Daniel Koshland suggested a modification to the
"lock and key" model. Enzymes are rather flexible structures.
The active site of an enzyme can be modified as the substrate
interacts with the enzyme. The amino acids sidechains which
make up the active site are molded into a precise shape which
enables the enzyme to perform its catalytic function. In some
cases the substrate molecule changes shape slightly as it enters
the active site.
Factors Affecting Enzyme Activity
Knowledge of basic enzyme kinetic theory is important in enzyme analysis in
order both to understand the basic enzymatic mechanism and to select a method
for enzyme analysis. The conditions selected to measure the activity of an
enzyme would not be the same as those selected to measure the concentration of
its substrate. Several factors affect the rate at which enzymatic reactions proceed
- temperature, pH, enzyme concentration, substrate concentration, and the
presence of any inhibitors or activators.
Temperature Effects
Like most chemical reactions, the rate of an enzyme-catalyzed reaction increases
as the temperature is raised. A ten degree Centigrade rise in temperature will
increase the activity of most enzymes by 50 to 100%. Variations in reaction
temperature as small as 1 or 2 degrees may introduce changes of 10 to 20% in
the results. In the case of enzymatic reactions, this is complicated by the fact that
many enzymes are adversely affected by high temperatures. As shown in Figure
13, the reaction rate increases with temperature to a maximum level, then abruptly declines with further increase of temperature.
Because most animal enzymes rapidly become denatured at temperatures above 40·C, most enzyme determinations are carried out
somewhat below that temperature.
Over a period of time, enzymes will be deactivated at even moderate temperatures. Storage of enzymes at 5·C or below is generally
the most suitable. Some enzymes lose their activity when frozen.
Effects of pH
Enzymes are affected by changes in pH. The
most favorable pH value - the point where the
enzyme is most active - is known as the
optimum pH. This is graphically illustrated in
Figure 14.
Extremely high or low pH values generally
result in complete loss of activity for most
enzymes. pH is also a factor in the stability of
enzymes. As with activity, for each enzyme
there is also a region of pH optimal stability.
The optimum pH value will vary greatly from
one enzyme to another, as Table II shows:
Inhibition
Enzymes reaction rates can be decreased by competitive inhibition.
Table II
pH for Optimum Activity
Enzyme
Lipase (pancreas)
Lipase (stomach)
Lipase (castor oil)
Pepsin
Trypsin
Urease
Invertase
Maltase
Amylase (pancreas)
Amylase (malt)
Catalase
Competitive inhibition
In competitive inhibition, the inhibitor binds to the substrate binding site
as shown (right part b), thus preventing substrate binding. Malonate is a
competitive inhibitor of the enzyme succinate dehydrogenase, which
catalyzes the oxidation of succinate to fumarate.
Answer the following based on your reading:
1. What specifies the type of protein produced?
2. List the different types of RNA and describe their role in protein synthesis.
3. Who is responsible for finding the structure of DNA?
4. What structure is responsible for linking together amino acids?
5. Briefly describe the entire process of protein synthesis. Include all important molecules and locations.
6. What is a codon?
7. What is DNA, RNA and a protein? Be as specific as possible.
8. Describe and explain the central dogma of molecular genetics.
9. Are transfer RNA molecules, amino acid specific?
10. What class of macromolecules do enzymes belong to?
11. What do enzymes do in the human body?
12. How does pH affect enzymes?
13. What is inhibition?
14. How does temperature affect enzyme activity?
15. What is the active site?
16. What is the lock and key model?
17. What type of monomer makes up enzymes?
18. Enzymes work by lowering ______________________.
19. What is the induced fit model?
20. What is optimum pH?
pH
Optimum
8.0
4.0 - 5.0
4.7
1.5 - 1.6
7.8 - 8.7
7.0
4.5
6.1 - 6.8
6.7 - 7.0
4.6 - 5.2
7.0
2. Nucleic acids and protein synthesis
1.
Do you understand how mRNA codes for amino acids? Use the chart below to decode the following strand of mRNA into amino
acids of a protein.
A
2.
3.
4.
Date: ________________________
U
G
A
A
U
U
U
U
G
A
A
G
C
U
G
A
U
The triplets that code for the amino acids on the mRNA
are codons. The complementary triplet(s) on tRNA are
known as anticodons. Fill in the proper triplets in the
table.
Amino acid
codon
Proline
Threonine
Tryptophan
Leucine
Arginine
Histidine
Glycine
Serine
Now use any of the codons to make up your own sequence for
five or more amino acids. Don’t forget to start and stop your message.
A
A
A
C
A
ATA
2
TAG
3
CTT
4
TTG
5
ACG
6
GGG
7
AAC
8
CCC
9
Amino Acid
U
A
A
mRNA
Codon
Alanine
GCU
Arginine
CGU
Asparagine
AAU
Aspartic acid
GAU
Cysteine
UGU
Glutamic acid
GAA
Glutamine
CAA
Glycine
GGU
Histidine
CAU
Isoleucine
AUU
Leucine
UUA
Lysine
AAA
Methionine
AUG
Phenylalanine
UUU
Proline
CCC
Serine
UCU
Threonine
ACU
Tryptophan
UGG
Tyrosine
UAU
Valine
GUU
Protein synthesis
Stop codon
UAA
Protein synthesis begins with DNA in the nucleus. Below is a DNA sequence that could code for part of a molecule of oxytocin.
Write the sequence of messenger RNA (mRNA) codons that would result from the transcription of this portion of DNA. The
arrow marks the starting point.
ACA
1
ATT
10
After transcription, mRNA attaches to a
ribosome (rRNA), where translation takes
place. Each codon of mRNA bonds with
an anticodon of a transfer RNA (tRNA)
and each tRNA molecule bonds with a
specific amino acid. The table below
shows the mRNA codons and the amino
acid for which they code. For example, if
you were given the codon AGA, you can
see from the table that these bases code
for the amino acid arginine.
5.
A
Use you mRNA sequence form #4 to
write the sequence of amino acids in
this part of the oxytocin molecule.
6. How many amino acids make up this portion of the oxytocin molecule?
7. What is the purpose of the UAA codon?
8. Below is a section of a DNA molecule. Transcribe the DNA and translate it into its amino acids.
ATGAAGATACGCTTTGATCGAAAAGCTACAAGAATATAA
9. Is this a complete protein, the middle, start or end?
10. How many amino acids are there?
3. Protein synthesis questions:
Date: ________________________
1. What type of monomer is linked together to assemble proteins?
2. How are proteins synthesized within a cell?
3. During translation, what is the mRNA codon paired with?
4. Myosin is a fiber found in muscle that helps muscles function. Keratin is a protein found in the skin to help give the skin its
flexibility. List all the similarities and differences between those two proteins
5. In one sentence describe the role of ribosomes in protein synthesis.
6. If you were to compare the genes and proteins of a heart cell and a hair cell of the same person, what would you find?
7. What two processes involving DNA occur in the nucleus? Briefly describe what happens in each and explain why they occur
in the nucleus.
8. Is the information in DNA used directly? Explain.
9. Why do we need mRNA if DNA holds the genetic information and therefore the instructions to make all the proteins the cell
needs?
10. What is a synonym for Amino acid, and mRNA?
11. Which enzyme opens up the DNA double helix (unzip and unwind) during transcription?
12. Compare and contrast transcription and translation. Use a Venn diagram to assist you.
13. What process is occurring in this diagram? Explain. Where in the
cell is this process occurring?
14. What is the name of the molecule being produced in the picture
used in question 13? Where is the molecule going?
Key
15. Look at the picture above. What process is taking place? What organelle is it taking place at? Where in the cell is it taking
place?
16. Using the same picture from #15 look at the key and describe what each piece represents.
17. Look at the diagram to the left. What are the names
of the amino acids in the protein chain? How many
codons will there be when finished? Give the name for the
molecule at A, B, C and D. Look at the area circled in
black, what bases would fit there?
C.
A.
B.
D.
4. Enzymes
Date: _____________________
Enzymes belong to which class of macromolecules?
1. How do enzymes work?
2. Are enzymes used up in a chemical reaction?
3. What is a substrate?
4. What is induced fit?
5. Are enzymes substrate specific?
6. Explain how enzymes lower activation energy.
7. Name two conditions that can change how an enzyme works.
8. What does it mean to be an acid a base or neutral?
9. What is a metabolic pathway and how does it relate to enzymes?
10. Look at the picture on this page. What is it and explain how it works?
11. How does hunger and eating relate to feedback inhibition?
12. Compare and contrast competitive and non-competitive inhibition. Make a
drawing to show the difference.
5. Mutation questions:
Date: ______________________________
1. Name the different types of mutations and describe how they affect protein synthesis.
2. Give the amino acids from this piece of DNA: GTTGCCTATGGCAAAGCGTTT
3. Using the piece of DNA in #2 as a reference look at this mutated piece: ATTGCCTATGGCAAAGCGTTT. Find the mutation, take
the mutated piece of DNA through protein synthesis and describe the type of mutation.
4. Using the piece of DNA in #2 as a reference look at this mutated piece: GTTGCCTATGGCAAAGCCTTT. Find the mutation, take
the mutated piece of DNA through protein synthesis and describe the type of mutation.
5. Using the piece of DNA in #2 as a reference look at this mutated piece: TTGCCTATGGCAAAGCGTTT. Find the mutation, take
the mutated piece of DNA through protein synthesis and describe the type of mutation.
6. Using the piece of DNA in #2 as a reference look at this mutated piece: ATTGCCTATGGCGAAGCGTTT. Find the mutation, take
the mutated piece of DNA through protein synthesis and describe the type of mutation.