Download Gene Section MIR196B (microRNA 196b) Atlas of Genetics and Cytogenetics

Atlas of Genetics and Cytogenetics
in Oncology and Haematology
OPEN ACCESS JOURNAL AT INIST-CNRS
Gene Section
Review
MIR196B (microRNA 196b)
Deepak Kaul, Deepti Malik
Molecular Biology Unit, Department of Experimental Medicine and Biotechnology, Post Graduate Institute
of Medical Education and Research, Chandigarh, India (DK, DM)
Published in Atlas Database: December 2011
Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR196BID51736ch7p15.html
DOI: 10.4267/2042/47326
This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence.
© 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology
between HOXC10 and HOXC9 on chromosome 12
(12q13.13).
The gene for miR-196b is located in a highly
evolutionarily conserved region between HOXA9 and
HOXA10 genes, on chromosome 7 (7p15.2) in human
beings. miR-196a-1 and miR-196a-2 genes transcribe
the same functional mature miRNA sequence (3GGGUUGUUGUACUUUGAUGGAU-5),
whereas
miR-196b gene produces a small RNA (3GGGUUGUUGUCCUUUGAUGGAU-5),
which
differs from the sequence of miR-196a by one
nucleotide.
Pre-miRNA
The primary transcripts of microRNAs are processed
by enzymatic microprocessor Drosha (RNase III
enzyme) and DGCR8 (dsRNA binding protein) from
their 3' and 5' cleavage sites into an intermediate stemloop precursor or pre-miRNA in the nucleus. The
precursor of miR-196b is 84 bases long (pre-miR196b), forms a secondary structure, and contains the
mature miRNA sequence, stem and terminal loop
structures with 2-nt 3' overhang. The precursor is then
transferred from nucleus to cytoplasm by the enzyme
exportin 5. In cytoplasm, a second RNase III enzyme,
Dicer, removes terminal loop generating about 20-bp
RNA duplex.
Length: 84 bases.
Sequence:
ACUGGUCGGUGAUUUAGGUAGUUUCCUGUUG
UUGGGAUCCACCUUUCUCUCGACAGCACGAC
ACUGCCUUCAUUACUUCAGUUG
Identity
Other names: MIRN196B, miR-196b, miRNA196B
HGNC (Hugo): MIR196B
Location: 7p15.2
Stem-loop structure of miR-196b.
DNA/RNA
Description
miR-196 is non-coding vertebrate specific micro-RNA
(MI0000238, MI0000279) and has been experimentally
confirmed in a wide range of vertebrate species
(MIPF0000031). miR-196b is expressed from
intergenic regions in HOX gene clusters that are the
targets of miR-196b.
The hairpin precursors are predicted based on base
pairing and cross-species conservation - their extents
are not known.
In this case the mature sequence is excised from the 5'
arm of the hairpin.
Three miR-196 genes have been found.
The miR-196a-1 gene is located on chromosome 17
(17q21.32) at a site between HOXB9 and HOXB10
genes, and the miR-196a-2 gene is located at a region
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5)
357
MIR196B (microRNA 196b)
Kaul D, Malik D
hsA-miR-196 (chromosome 7).
HOXB8: target of miR-196b.
of mutations in target 3'-untranslated region (3'-UTR)
of the c-myc gene.
Expression of miR-196a and miR-196b is higher in
AML patients with NPM1 gene (nucleophosmin)
mutations as compared to NPM1-wildtype. In T-ALL
patients, miR-196a and miR-196b expression was
associated with an immature immunophenotype, and
expression of CD34 and CD33. Hence, these miRNAs
were identified as ERG regulators and implicate a
potential role in acute leukemia.
Comparison of AML patients with normal karyotype
(NK-AML) showed down-regulation of miR-196b in
AML patients with abnormal karyotypes.
Within the hematopoietic lineage, miR-196b is most
abundant in short-term hematopoietic stem cells and is
down-regulated in more differentiated hematopoietic
cells. Analysis of 55 primary leukemia samples
reported over-expression of miR-196b specifically in
patients with MLL associated leukemias and its
enhanced expression in bone marrow progenitor cells
leads to increased proliferative capacity and survival as
well as partial block in differentiation. This suggests a
mechanism that how increased expression of miR-196b
by MLL fusion proteins significantly contributes to
leukemia development.
Another report suggests that expression of miR-196b is
not exclusively MLL-driven but is linked to activation
of HOXA genes in pediatric acute lymphoblastic
leukemia and its over-expression is not unique to MLLrearranged acute lymphoblastic leukemia but also
occurs in patients with T-cell acute lymphoblastic
leukemia patients carrying CALM-AF10, SETNUP214 and inversion of chromosome 7. Like MLLrearrangements, these abnormalities are functionally
linked
with
up-regulation
of
HOXA.
In
correspondence, miR-196b expression in these patients
Mature miR-196b
The mature miRNA forms one strand of the RNA
duplex. One strand is degraded and other is
incorporated in to a protein complex, RNA induced
silencing complex (RISC), targeting a partially
complementary target mRNA. miR-196b is 22
nucleotide long.
Sequence:
UAGGUAGUUUCCUGUUGUUGGG
HOXB8: target of miR-196b
HOXB8 mRNA was shown to be a natural target for
miR-196b-directed cleavage through a perfectly
complementary miR-target site. Other HOX genes have
imperfect miR-196 complementary sites indicative of
regulation by translational repression.
Implicated in
Leukemia
Note
Significant down-regulation of miR-196b for the first
time was reported in EB-3, MOLT-4 cell lines as well
as in B and T-cell ALL patients as compared to their
corresponding controls. miR-196b restoration in EB-3
cells leads to significant down-regulation of c-myc
(over-amplified in B and T-cell ALL patients) and its
effector genes i.e., human telomerase reverse
transcriptase (hTERT), B-cell lymphoma/leukemia-2
(Bcl-2), apoptosis antagonizing transcription factor
(AATF), confirming miR-196b functions as tumor
suppressor miRNA in B-cell ALL (acute lymphoblastic
leukemia) however, transfection experiments in
MOLT-4 cell line revealed that miR-196b is not able to
knock down the expression of c-myc gene as it was
found that miR-196b loses its ability to down-regulate
c-myc gene expression in T-cell ALL as a consequence
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5)
358
MIR196B (microRNA 196b)
Kaul D, Malik D
correlated strongly with the levels of HOXA family
genes (Spearman's correlation coefficient ≥ 0,7; P≤
0,005). Since miR-196b is encoded on the HOXA
cluster, these data suggest co-activation of both miR196b and HOXA genes in acute lymphoblastic
leukemia. Up-regulation of miR-196b coincides with
reduced DNA methylation at CpG islands in the
promoter regions of miR-196b and the entire HOXA
cluster in MLL-rearranged cases compared to the cases
of non-MLL precursor B-cell acute lymphoblastic
leukemia and normal bone marrow (P< 0,05),
suggesting an epigenetic origin for miR-196b overexpression. miR-196b possess an oncogenic activity in
bone marrow progenitor cells, these findings imply a
potential role for miR-196b in the underlying biology
of all HOXA-activated leukemias.
migration and metastasis, and by ectopic expression of
HOXC8, which prevented the effects of miR-196 on
cell migration and metastasis.
RNAs from 25 breast cancer tumors (8 metastatic
tumor specimens and 17 metastasis-free tumor
samples) and 4 normal breast tissues were analyzed by
using qRT-PCR, which showed that the levels of
HOXC8 mRNA or miR-196s (miR-196a and miR-196b
together) were not correlated with the metastatic status
of these samples instead, the ratio of miR-196s to
HOXC8 mRNA was significantly lower in metastatic
tissues than that of metastasis-free specimens or normal
breast tissues.
These results suggest that the ratio of miR-196s to
HOXC8 mRNA may be specifically correlated with the
metastasis status of breast tumors.
Gastric cancer
Pancreatic cancer
Note
Hypomethylation status of miR-196b CpG islands and
overexpression of this miRNA was observed in primary
gastric tumors providing a link that DNA
hypomethylation induces overexpression of miR-196b
in gastric cancer.
Note
Reports in the literature reveal that miR-196a and miR196b levels were significantly increased in pancreatic
ductal adenocarcinoma (PDAC) compared with normal
tissue, as well as normal pancreatic lines and acute
pancreatitis specimens.
Glioblastoma
Myelopoiesis
Note
Expression profiles in glioblastomas and anaplastic
astrocytomas suggested that miR-196a and miR-196b
showed increased expression levels in glioblastomas
relative to both anaplastic astrocytomas and normal
brains. miR-196a showed the most significant
difference (P= 0,0038), with miR-196b also having a
high significance (P= 0,0371). Furthermore, patients
with high miR-196 expression levels showed
significantly poorer survival by the Kaplan-Meier
method (P= 0,0073). Analysis of expression of miR196b in a group of 38 patients with primary
glioblastoma multiforme (GBM) showed that miR196b (P= 0,0492; log-rank test) positively correlated
with overall survival further confirming that miR-196
may play a role in the malignant progression of gliomas
and may be a prognostic predictor in glioblastomas.
Note
Gfi1 is a master regulator of miR expression in
hematopoietic cells and it directly regulates miR-21
and miR196b during myelopoiesis. Deregulation of
their expression distorts myelopoiesis. The miR-196b
expression specifically and significantly controls
granulocytic colony numbers and significantly (but not
completely) blocks G-CSF-stimulated granulopoiesis,
acting as a negative regulator of granulocytic
differentiation. Recently, it has been shown that
PRDM5 transcription factor regulates miR-21 and miR196b through its interaction with Gfi1. GFI1 function is
required for normal expression of miR-21 and miR196b in healthy individuals and Gfi1 loss of function
(GFI1N382S (mutant) SCN patient) and the higher
steady-state levels of miR-21 and miR-196b
overexpression propagate the dominant-negative effect
of the GFI1N382S protein and disrupts granulocytic
differentiation.
Breast cancer
Note
miR-196s function as potent metastasis suppressors and
the ratio of miR-196s to HOXC8 mRNA might be an
indicator of the metastatic capability of breast tumors.
Transfection studies in metastatic MDA-MB-231 breast
cancer cells identified members of the miRNA-196
family (miR-196a1, miR-196a2, and miR-196b)
suppresses in vitro invasion and in vivo spontaneous
metastasis of breast cancer cells. Further evidence
providing the association between miR-196b and the
transcription factor HOXC8 was that miR-196 inhibits
the expression of HOXC8. Functional linkage was
implied by small interfering RNA-mediated
knockdown of HOXC8, which suppressed cell
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5)
References
Duan Z, Person RE, Lee HH, Huang S, Donadieu J, Badolato
R, Grimes HL, Papayannopoulou T, Horwitz MS. Epigenetic
regulation of protein-coding and microRNA genes by the Gfi1interacting tumor suppressor PRDM5. Mol Cell Biol. 2007
Oct;27(19):6889-902
Paranjape T, Slack FJ, Weidhaas JB. MicroRNAs: tools for
cancer diagnostics. Gut. 2009 Nov;58(11):1546-54
Popovic R, Riesbeck LE, Velu CS, Chaubey A, Zhang J,
Achille NJ, Erfurth FE, Eaton K, Lu J, Grimes HL, Chen J,
Rowley JD, Zeleznik-Le NJ. Regulation of mir-196b by MLL
and its overexpression by MLL fusions contributes to
immortalization. Blood. 2009 Apr 2;113(14):3314-22
359
MIR196B (microRNA 196b)
Kaul D, Malik D
Velu CS, Baktula AM, Grimes HL. Gfi1 regulates miR-21 and
miR-196b to control myelopoiesis. Blood. 2009 May
7;113(19):4720-8
Tsai KW, Hu LY, Wu CW, Li SC, Lai CH, Kao HW, Fang WL,
Lin WC. Epigenetic regulation of miR-196b expression in
gastric cancer. Genes Chromosomes Cancer. 2010
Nov;49(11):969-80
Bhatia S, Kaul D, Varma N. Potential tumor suppressive
function of miR-196b in B-cell lineage acute lymphoblastic
leukemia. Mol Cell Biochem. 2010 Jul;340(1-2):97-106
Bhatia S, Kaul D, Varma N. Functional genomics of tumor
suppressor miR-196b in T-cell acute lymphoblastic leukemia.
Mol Cell Biochem. 2011 Jan;346(1-2):103-16
Guan Y, Mizoguchi M, Yoshimoto K, Hata N, Shono T, Suzuki
SO, Araki Y, Kuga D, Nakamizo A, Amano T, Ma X, Hayashi K,
Sasaki T. MiRNA-196 is upregulated in glioblastoma but not in
anaplastic astrocytoma and has prognostic significance. Clin
Cancer Res. 2010 Aug 15;16(16):4289-97
Chen C, Zhang Y, Zhang L, Weakley SM, Yao Q. MicroRNA196: critical roles and clinical applications in development and
cancer. J Cell Mol Med. 2011 Jan;15(1):14-23
Coskun E, von der Heide EK, Schlee C, Kühnl A, Gökbuget N,
Hoelzer D, Hofmann WK, Thiel E, Baldus CD. The role of
microRNA-196a and microRNA-196b as ERG regulators in
acute myeloid leukemia and acute T-lymphoblastic leukemia.
Leuk Res. 2011 Feb;35(2):208-13
Li Y, Zhang M, Chen H, Dong Z, Ganapathy V, Thangaraju M,
Huang S. Ratio of miR-196s to HOXC8 messenger RNA
correlates with breast cancer cell migration and metastasis.
Cancer Res. 2010 Oct 15;70(20):7894-904
Schotte D, Lange-Turenhout EA, Stumpel DJ, Stam RW, BuijsGladdines JG, Meijerink JP, Pieters R, Den Boer ML.
Expression of miR-196b is not exclusively MLL-driven but is
especially linked to activation of HOXA genes in pediatric acute
lymphoblastic
leukemia.
Haematologica.
2010
Oct;95(10):1675-82
Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5)
This article should be referenced as such:
Kaul D, Malik D. MIR196B (microRNA 196b). Atlas Genet
Cytogenet Oncol Haematol. 2012; 16(5):357-360.
360