Download Chromosomal Abnormalities

Genetics
Chromosomes
Centromere
↓
Chromatid
Chromatid
Karyotype – spread of human
chromosomes to look for chromosomal
abnormalities
OR
Chromosome Terminology

Homologous Chromosomes – paired
chromosomes – same size, same
banding pattern, same type of genes but
not necessarily the exact same forms of
each gene

Example – gene on one chromosome for
brown eyes and gene on its homologue
for blue eyes
GGGTCAGTCATTTTAAGAGATC
GGGAAAGTCATTTTAAGAGATC

Remember – Sister Chromatids are two
halves of the same double chromosome
and are exact copies of one another
Real Karyotype
Down’s Syndrome Karyotype
Cell Types






Diploid – cell with the normal # of
chromosomes (2n)
Haploid – cell with ½ the normal
number of chromosomes (n)
Somatic cell – normal body cell
Sex Cell, gamete – sperm and egg
– haploid cells
Germ cell – 2n cell that is the
precursor to the gametes
Meiosis – cell division process that
produces the sperm and egg (n)
Purpose of Meiosis

Egg
To make haploid sex cells so that
when they come together, the
zygote has the normal amount of
DNA (2n)
Sperm
n
n
Fertilization
→
Mitosis
Zygote
2n
Embryo
Steps of Meiosis
Germ Cell (2n) in G1 (46 single chromosomes)
S-Phase – copy all DNA so after have 46 double
chromosomes
When Chromosomes form in meiosis I – 46
doubles
Chromosomes
form and
homologous
pairs come
together
Crossing over in Prophase I
Homologous
Pairs line up
down center
Still 46
doubles or
23 double
pairs
Each daughter cell
has 23 double
chromosomes – no
longer have pairs –
just one of each
pair


Meiosis I is the reduction
division because the cell
went from 46
chromosomes or 23 pairs
to just 23 chromosomes
The daughter cells are now
haploid but they don’t yet
have ½ of the DNA of the
orginial germ cell, they
must undergo meiosis II
Chromosomes reform in
the two daughter cells
Each individual
chromosome lines
up down the
center and sister
chromatids split
Now that sister chromatids split – we
have 23 single chromosomes – ½ the
DNA of a normal cell – this is the finished
sex cell
Summary



Meiosis happens only in ovaries
and testes to make sperm and egg
Sperm and egg have only 1 of
each pair of chromosomes and are
haploid
Sex cells come together to make a
zygote that contains a pair of each
chromosomes again and is diploid
Mitosis vs. Meiosis
Egg vs. Sperm


Germ cell =
spermatogonium (undergo
mitosis and one daughter
cell goes thru meiosis)
Primary Spermatocyte –
Prophase I
↓ meiosis I

Secondary Spermatocyte –
haploid
↓ meiosis II


Spermatids
Sperm (grow tails and
head changes shape)


Germ cell = oogonium
(undergo mitosis and one
daughter cell goes thru
meiosis)
Primary oocyte (Prophase
I) (frozen in metaphase I)
↓ meiosis I (hormone stim.)
Secondary oocyte
(haploid) and 1 polar
body (frozen in met II)
↓ meiosis II (stimulated by fert.)
Oocyte + 2nd polar body
Sexual Reproduction
Brings about Variation by:
 Crossing Over
 Independent Assortment



Random Fertilization


Amount of variation due to IA – 2n
In humans = 2 23 = 8 million
8 million x 8 million = 64 trillion
combinations
Crossing Over makes this almost
infinite
Chromosomal Abnormalities




Trisomy or Monosomy due to
non-disjunction during meiosis
Chromosomal deletions (a
piece of a chromosome breaks
off)
Chromosomal Translocations
(whole or parts of
chromosomes)
Chromosomal Inversions
Non-disjunction causes
trisomy’s, monosomy’s, and
aneuploidy
Chromosomal Abnormalities
Translocation of chromosome 13 and 14 – normal
phenotype
Translocation Abnormality
Philadelphia Chromosome
A piece of chromosome 22 is translocated to chromosome
9 causing Chronic Myelogenous Leukemia
Chromosomal Deletions
Each chromosome 22 on the right of each
pair is missing a piece
Cri-du-chat – have a deletion from chromosome #5
and the babies sound like a cat crying – mental
retardation and heart disease
Mendelian Principles







Alleles – different forms of the
same gene
Dominant – gene that is seen
Recessive – only seen if with
another recessive allele
Homozygous – having 2 like alleles
Heterozygous – having 2 different
alleles
Genotypes – actual gene make-up
for a particular locus or trait
Phenotypes – visible trait
Mendelian Laws


Law of Segregation - When the
gametes form – each gamete
receives only 1 of each pair of
alleles.
Law of Independent Assortment
– If genes aren’t on the same
chromosome (linked) they will not
have to remain together in the
gamete - if they are linked, they
will sometimes assort
independently due to crossing over
Punett Squares – Mono
and Di-Hybrid Crosses
Used to calculate the probability of
having certain traits in offspring
 Figure out all possible gametes for
male and females
 Place them on the outside of the
square
 Cross the gametes to come up
with the possible genotypes and
phenotypes of the offspring
Using Probability to Calculate
Offspring Outcomes Rather than
Punnett Squares
Multiply – when 2 things must happen
independently in order to get the
outcome (and)
Add – when either of two things can
happen to get an outcome. (or)
Examples: RrYy x RrYy
Chance of getting an rryy offspring?
Chance of getting an RrYr offspring?
Beyond Mendel



Incomplete Dominance – the phenotype
in the heterozygous condition is a mix of
the two (white and red snapdragons
make pink)
Co-dominance – both alleles are
expressed in heterozygous condition
(A,B blood types, Roan cattle)
This can become a “gray” area in
diseases – Tay Sachs – make ½ normal
protein and ½ misshapen – do not
exhibit disease so recessive but
molecularly have both expressed so is it
co-dominance or even incomplete if has
a slight effect ????
Multiple Alleles

More than two allele choices
although always only have 2
alleles at each gene locus

Example: Human Blood Types
Alleles = A, B, & O (also an
example of co-dominance)

Paternity Testing?
Sex-Linked



Located on a sex chromosome
Usually is X-linked (few known
genes on the Y)
X-linked usually show more in
males since only have 1 allele –
only need 1 recessive allele to
show
Pedigrees



Used to figure out genotypes of
family members to see if someone
is carrying a disease gene
Used to determine the mode of
inheritance
Practice
Pedigree for Hemophilia
Genetics Plays a Role in History
Queen Victoria’s daughter, Alice, married a German prince, Louis, and converted to Lutheranism. Their daughter, Queen Victoria’s granddaughter, Alexandra was,
thus, a German princess, grew up in Germany, and was raised in the Lutheran church. Alexandra, married Tsar Nicholas, the last tsar of Russia, and they had four
daughters: Olga, Tatiana, Marie, and Anastasia. Many people in Russia didn’t like Tsarina Alexandra because she was German, not Russian, and Lutheran, not Russian
Orthodox. Her mannerisms, speech, and dress were not what many people in Russia thought of as appropriate for the Tsar’s wife. Also, in Russia at that time, only a
male could be tsar, so unless Alexandra and Nicholas had a son, the leadership would pass to another of Nicholas’ relatives when he died. Finally, however, they had a
son who they named Alexei. Unfortunately, however, they soon discovered that he had inherited the hemophilia allele from Alexandra, from Alice, and from Queen
Victoria. Realizing that chances were very slim that Alexei would survive to adulthood, Tsar Nicholas and his family became very withdrawn to try to keep that a secret
(Alexandra was not very outgoing, anyway, which the people didn’t like). However, at that time, there was much social unrest in Russia, and the general public mistook
the royal family’s withdrawl for aloofness and as a sign that they didn’t care about the poor living conditions of their people. Thus, Alexei’s hemophilia was probably a
major contributing factor in the Russian revolution. On several occasions, Alexei had severe internal bleeding, and a rather disreputable man named Rasputin was
somehow able to stop the bleeding. Because of his inexplicable ability to help Alexei, Rasputin became part of the “inner circle” and close confidant of the royal family,
which also angered many people who did not trust him.
Thus, when the Russian Revolution began, Rasputin was among the first to be executed. Eventually, Tsar Nicholas and his family were put under house arrest in
Siberia. On 18 June 1918, Anastasia, the youngest of the daughters, turned 17 while the family was still under house arrest, and about a month later, just after midnight
on 16 July, the royal family and several of their servants were all ordered down into the basement of the house, and the soldiers who had been guarding them shot and
killed them all. Then, their remains were taken out of town, burned in a bonfire, then buried, together, in an unmarked grave. For years, no one knew where that grave
was until, when Communist rule ended, records became available. In 1991, what was thought to, perhaps, be that grave was found, the bones were carefully removed,
and as much as possible, the skeletons were reconstructed. Through the use of modern DNA technology, DNA samples from the bones were compared to DNA from
the Tsar’s brother’s body (buried in a crypt in a church in St. Petersburg) and to DNA from someone in the English royal family. On that basis, one adult male skeleton
was identified as the Tsar, several young adult female skeletons were identified as several of the daughters, and the DNA of several of the other skeletons didn’t match,
showing that they were unrelated, family servants. The skeletons of Alexei and one of the four daughters were not with the rest, and are still unaccounted for. After the
bones were studied and identified, a few years ago, the remains of the last Tsar of Russia and his family were given a proper funeral and burial.
In 1919, a young woman jumped off a bridge in Berlin, Germany and was rescued and hospitalized. While in the hospital, on one occasion she showed a magazine
article with a photo of the Russian royal family to a nurse, pointing out to the nurse how much she thought she looked like Anastasia. After that, she claimed to be
Anastasia and claimed to have escaped and survived. She later moved to the U. S. and went by the name of Anna Anderson. The rest of her life, she stuck to her story
that she was Anastasia, but people were dubious and tried everything they could think of (including things like comparing pictures of ear lobes) to figure out whether
she was Anastasia, or not. When she died and was cremated in 1984, no one still knew if she was really Anastasia or not. At some point before her death, she had had
surgery, and the hospital had kept the removed tissue preserved in formaldehyde. Again in the 1990s, with the advent of modern DNA technology, scientists were also
able to test DNA samples from her preserved tissue and compare those to the other DNA samples, with the result that there were no similarities – she was not related.
Another possible use for DNA technology has been suggested. The big question in all of this is, “From where did Victoria get the hemophilia allele?” Neither her
mother, Victoria, nor her father, King Edward showed any signs of having that allele. The “standard” explanation which, for many years, has been offered to freshman
biology students is that there was a chance, random mutation in that allele on one of Queen Victoria’s X chromosomes. More recently, however, I have heard
suggestions that, at that time, if the royal couple was having trouble conceiving a child, it would not have been out of the question to quietly, unobtrusively “loan” the
Queen out. People have raised the suggestion that maybe King Edward is not Victoria’s biological father. It has been suggested that perhaps there was not a chance
mutation in one of Queen Victoria’s X chromosomes, but that, perhaps, that was inherited from another man. Since the bodies of deceased members of the royal family
are in crypts in Westminster Abbey, it would be fairly easy to lift the lids on a couple of crypts to get DNA samples for comparison, but needless to say, the British
royal family probably isn’t very enthused about that idea.
Warm up
First 3 correct answers = bonus



You are a genetic counselor and couple wanting to
start a family comes to you for information
Charles was married once before, and he and his
first wife had a child with cystic fibrosis. The
brother of his current wife, Elaine, died of cystic
fibrosis.
Neither Charles or Elaine have CF.
What is the probability of Charles and Elaine
having a baby with CF?
Higher Genetics




Pleiotropy – one gene effects many traits
 Albinism – 1 mutation in 1 gene affects skin color, eye color,
hair color, and eyesight
 In mice – coat color affects how they react to light
Epistasis – one gene effects the expression of another
 bb – brown coat color
 Bb, BB – black coat color
 C gene – dominant causes color to be deposited in coat so if no
C gene then white coat color (in case of lab retrievers – yellow)
Polygenic – one trait determined by many genes – continuous
pattern
Multifactorial – may be multiple genes and the environment
Linkage
Linkage Mapping – determining where
genes are on a chromosome relative to other genes




If 2 genes are on the same chromosome, they
will remain together in the gamete – if they don’t
stay together it is due to crossing over
The closer two genes are on the same
chromosome - the more likely they will stay
together and not separate due to crossing over
If you calculate % of the time crossing over
occurs and separates the genes, you can tell
relatively how far apart they are on the
chromosome. (low % close, high % far)
Distance isn’t a real # - it’s just relative – called a
map unit or Centimorgan.
Example of Linkage Mapping



Blonde hair
Brown Hair
Blue Eyes
Brown Eyes
If no crossing over – Blonde Hair and Blue Eyed
genes will always end up in the gamete together
or Brown Hair and Brown Eyes.
If crossing over occurs you can get Blonde Hair
and Brown eyes in the same gamete etc.
However, the gamete from this parent will
combine with another parent so how do you
calculate the % of time crossing over happens?
Linkage Mapping
continued


Take one parent that is heterozygous for
both genes that you want to map and
cross them with another parent that is
homozygous recessive – any offspring
that aren’t like either parent are due to
crossing over
Take the # of offspring due to crossing
over/# of total offspring = % crossing
over = relative distance those gene are
from each other
Problem Practice;
Offspring: HhEe – 400 hhee – 400
Hhee – 100 hhEe – 100
How many map units are the genes H and E apart?
Example:
Brown Hair – H
Blonde Hair – h
Brown Eyes – E
Blue Eyes – e
HhEe x hhee
All offspring will
be: HhEe and
hhee so will look
like parents
(blonde hair and
blue eyes tog. And
browns together)
If crossing over:
Hhee and hhEe
Linkage Mapping
Problem

Problem – if they are really far
apart, it may be >50% and cannot
be distinguished from being on
separate chromosomes
Example of Calculating %
BbTt x bbtt
Recombination and map
units If the genes are on separate chromosomes:
BT
BbTt
Bt
Bbtt
X
bt
bT
=
bbTt
bt
bbtt
If on the same chromosome:
BbTt
BT
But got:
965 BbTt – 5
944 bbtt – 5
206 Bbtt – 1 (these 2 due to
185 bbTt – 1 crossing over)
bt
X
bt
=
bbtt
391/2300 = 17%
recomb.
17 map units
(just like parents)
Practice Linkage Mapping



TA = 12 % recombination
AS = 5 % recombination
TS = 18 % recombination
Pick smallest distance and lay them
out
5%
A ------ S
Is T closer to A or S?
T is closer to A so it goes to the left of A

12%
5%
T ------- A ------ S
18%
--------------------
Practice Problems - # 4, 5, 9
Chapter 15
4. A Wild type fruit fly (heterozygous for gray body
and normal wings) is mated with a black fly with
vestigial wings.
Offspring:
Answer: 320/1883 = 17% =
17 map units
Wild type 778
Black vestigial 785
Black normal 158
Gray vestigial 162
What is the recombination frequency between these
genes for body color and wing size?
A wild-type fly (heterozygous for gray body
and red eyes) is mated with a black fruit fly
with purple eyes.
The offspring:
Answer: 94/1566=6%
721 wt
Mate heterozygous wing size and
751 black-purple
eye color (gray,red) and homo rec
49 gray-purple
for wing and eye (vest,purple)
45 black-red
What is the recombination frequency?
What would you mate if you wanted to determin
the sequence of body-color, wing-size, and eye
color?
5.
Mapping Problem - #9






Determine the sequence of genes along the
chromosome based on the following
recombination frequencies.
A-B = 8 map units
A-C = 28
Answer: start with smallest distance
A-D = 25
and work your way out:
25---- A --8-- B ---20---C
D
---B-C = 20
B-D = 33
Chromosomal Inheritance


Aneuploidy – abnormal
chromosome # (ex. Trisomy)
Polyploidy – 3n, 4n (nondisjunction of all chromosomes)
More normal than aneuploid –
some plants live fine but can only
reproduce with other polyploid
plants
 2n egg and 1n sperm = 3n

Or

Zygote replicates DNA but doesn’t
divide = 4n
Sex Chromosomes and
Chromosomal Inheritance

Non-disjuction of sex chromosomes

XXY – Klinefelter’s (small testes, sterile, breasts)

XYY – taller, more aggressive?? Males

XXX – normal female

XO – Turner’s Syndrome (no secondary
sex characteristics, sterile, short)
Normal Sex Linked Stuff


X-Inactivation – only in females
 One x is randomly condensed and inactivated
in each cell forming a Barr Body
 Methylation causes the condensation and
turning off of the genes on the X
 Get a mixture of expression in different cells
 Why does it happen? Need just one active
copy once born (males only have one so if
needed both then all males would be
abnormal for those traits)
Imprinting – the exact same alleles are
expressed as different traits when inherited from
the mother vs. father (sperm vs. egg)
 A female person is a mix of both maternal
and paternal chromosomes but get recoded
when form egg – so all imprinted genes in the
egg have the maternal coding even if the
mother got it from her father
Imprinting Continued



The coding is based on methylation
pattern
Many times the methylation turns off the
reading of a gene so only the other
parent’s allele gets read in the offspring
Example: Deletion of a gene from
chromosome 15


If inherited from the father:
Prader-Willi (retardation, short, obese, small
hands and feet, insatiable appetite)


If inherited from the mother:
Angelman’s (uncontrollable laughter, jerky
motions, loss of coordination)
X-Chromosome Related
Stuff Continued





Fragile X – piece of X is hanging on by a
thread of DNA
Normally have 50 CGG repeats at end of
X
Fragile X – 200 CGG repeats – most
common cause of mental retardation
CGG repeats increase over time in the
egg making it worse
Much worse also when inherited from the
egg (methylated)
More Sex Chromosome Stuff



Huntington’s – CAG triplet repeat
Elongation more likely to happen if
inherited from the father
Note:- mitochondrial DNA is only
inherited from the mother
Diseases
Diseases Specific to Groups
 Cystic Fibrosis – caucasians (lifespan
27) 1/25 carriers, 1/2500 have it




Tay Sachs – Ashkenazi Jews


Siezures, blindness, loss of coordination,
mental retardation
Sickle Cell – African decent 1/10 carrier


Messed up Cl- channel protein
Thicker, stickier mucous
Increased infections
Abnormal hemoglobin, resistance to
malaria
In-breeding – more likely to have the
same recessive genes
Dominant Diseases


Achondroplasia – dwarfism 1/10,000
 Homozygous is lethal
 Must be a dwarf to have a dwarf
offspring
 Two dwarfs can have a normal child
Huntington’s – nervous degeneration
X-Linked
Hemophilia, Color-Blindness
Multifactorial –
Heart disease
Diabetes
Cancer
Mental illness