Download Daily Question - Mr. McCabe

Daily Question #19
1. Your parents “came together”  to create you. List 5
specific “traits” that people say have and specifically
who (parent/ grandparent) they say it comes from.
2. Define Genetics (in your own words).
3. What are the “gametes” (sex cells) that came
together to form the fertilized egg that become you?
4. What is a fertilized egg called?
5. Think of genetics, write down at least 5 words that
you think have anything to do with genetics…
6. Look back in your notebook, find either the 5
characteristics of life, or the 3 parts of the cell theory.
(or if you can remember them off the top of your
head) 
Genetics Standard 2
Mutation and sexual reproduction lead to
genetic variation in a population. As a
basis for understanding this concept:
E. Students know why approximately half of an
individuals DNA sequence comes from each parent.
F. Students know the role of chromosomes in
determining an individual’s sex.
(NEW open entry) Left hand side on the very top, label it
“46=23”
CHROMOSOMES
Open your notebook to the page
where you wrote 46=23
• DO NOT COPY YOUR HOMEWORK. If I see
anyone copying or “sharing” work, you and they
will receive a zero on the assignment. Do it on
your own. It is NOT a group assignment.
• If you are not done with the worksheet, finish it
now and turn it in. If you are done….
• Use the whole page (so draw big!) to draw the
chromosomes found in your body. Try to be
accurate with the colors.
DNA pairs –
please draw
and color on
left side of
notebook. This
is not a DQ.
Try to be
accurate with
coloring
Daily Question #20
1. DNA coils in the nucleus to form _______.
2. The shape of a DNA molecule is a ______
________.
3. 1 set of chromosomes is called a ________.
4. How many pairs of chromosomes do you have in
your body?
5. What are the two different sex chromosomes?
6. Nucleotides make up DNA. A typical human
chromosome contains _____ billion nucleotides.
7. How much DNA information do you get from each
parent?
6. A certain genetic condition occurs when a human
has 47 chromosomes instead of 46. It causes
problems in the way the body and brain develop and
is the most common birth defect. It is also known as
trisomy 21. What is this condition called?
Daily Question #20
Common physical signs include:
• Decreased muscle tone at birth
• Excess skin at the nape of the neck
• Flattened nose
• Separated joints between the bones of the skull
(sutures)
• Single crease in the palm of the hand
• Small ears
• Small mouth
• Upward slanting eyes
• Wide, short hands with short fingers
• White spots on the colored part of the eye (Brushfield
spots)
1.
2.
3.
4.
Daily Question #21
What is a gamete?
What is haploid?
What is a diploid?
If a trait from your father is “stronger” than the same
trait from your mother, what is the genetic term to
describe that?
5. What is on the inside of the chromosomes?
6. Where are the chromosomes located?
7. There are 3,000,000,000 nucleotides in your DNA
strand, write that number in scientific notation.
REMEMBER YOUR STEPS!
8. What is a 3D printer? How could it benefit
biotechnology?
Chromosomes
•Why do cells
need to
reproduce?
•You produce roughly 2 trillion cells per day.
2,000,000,000,000!
•Cells, like all things have a LIFE CYCLE.
•As you grow your body NEEDS more “stuff”
•To get bigger, more complex, provide
nutrients.
•Reproduction (mitosis) is needed for
•CELL GROWTH
•INJURY
•REPLACEMENT (DEATH) of other cells.
Chromosomes
•Why is
understanding cell
reproduction
important to
know?
•Biotechnology is an amazing field.
–Here are some things happening right now…
–Cell gun
–Printing body parts
•Because we know cells can replicate
themselves so quickly and efficiently we can
also learn more about our potential.
–Write down 5 WORDS you did not know the
meaning…
–Write down 5 CONCEPTS/IDEAS, you thought were
interesting.
•We know that life is amazing. Among all the
TRILLIONS of things that could go wrong, we
still end up with beautiful people despite
imperfections. Trisomy 13 and 18 are often fatal.
Trisomy 21 is the most common birth defect.
Here is 1 story of trisomy 13 (warning)
Mitosis with Allium (onion root tip)
• Cut out the 5 boxes (A,B,C,D,E). Grab one of
the papers on the little desk next to my desk.
• When I give you the command you will go
around the room, find a matching letter and
draw the ONE cell that the pointer is on. DO
NOT CHANGE ANYTHING ON THE
MICROSCOPE! (except perhaps the eyepiece)
• Draw the cell ACCURATELY in your box, then
move on. When you have them completed,
return to your seat.
• QUIZ TOMORROW ON MITOSIS PHASES!
Chromosomes
•Describe the
structure and
function of
chromosomes…
•Chromosomes are like Google…TONS of
information stored in one convenient place.
Google has ONE site to search for everything.
•There are 46 chromosomes (in pairs) in
almost every cell in your body.
•Each “pair” is almost identical,
containing the same genes in the same
order.
•Connected in the middle at the
“centromere”
SEX chromosome
XX=female
XY = Male
Chromosomes
•Describe the
structure and
function of
chromosomes…
•Chromosomes are like Google…TONS of
information stored in one convenient place.
Google has ONE site to search for everything.
•There are 46 chromosomes (in pairs) in almost
every cell in your body.
•Each “pair” is almost identical, containing
the same genes in the same order.
•Down syndrome (called trisomy 21) is where
you have an extra chromosome in the 21st “pair.
•Trisomy 18
•trisomy 13
•Homework Left hand side chapter 10.2 mitosis.
Words (include page numbers, do NOT use the
glossary!)– cell cycle, interphase, cytokinesis,
spindle, centrosome.
•Questions 1, 2, 3, 4 (include page numbers!
•Down Syndrome has 3 main characteristics
•Physical, medical, and cognitive (developmental).
· A flattened appearance to the face
· A high, broad forehead
· A smaller head, proportionately
· An upward slant to the eyes
· A narrow slit to the eyes
· Pronounced bags or folds under the eyes
· A small, depressed nose
· Small ears
· Ears set quite low to the face
· A small mouth
· A large or protruding tongue
· A short neck
· Short arms and legs
· Short fingers and toes
· Large space between the first and second toe
· A single, deep crease in the center of the palm
· Poor muscle tone (hypotonia)
· Loose joints (hyperflexability)
· Weak reflexes
Chromosomes 6.1
Just stop
think for are
a like Google…TONS of
•Describe
the and•Chromosomes
information stored in one convenient place.
structure
and
second…every
single
about
you
Google
has ONEthing
site to search
for everything.
function
wasofwrapped•There
up and
stored in(inside
1almost
are 46 chromosomes
pairs) in
chromosomes…
every cell in your body.
tiny little sperm and 1 tiny little egg that
•Each “pair” is almost identical, containing
became you: hair
color,
the same
geneseye
in the color,
same order.
•These pairs
are called
diploid (di
means 2)
height, skin color,
nose
shape,
ear
because they contain both chromosomes in the
shape face shape….EVERYTHING.
pair.
•A haploid cell contains only 1 CHROMATID
of the chromosomes in order to be ½ of the
genes of an offspring.
•A gamete is a haploid cell that contains the
genetic info you got from your parents.
Sperm (haploid) + egg (haploid) = diploid..you!
Chromosomes
•Describe the
structure and
function of
chromosomes…
•Chromosomes are located in a cells
nucleus.
•Each chromosome contains one long thread
of DNA (if spread out would be about 5cm
long) that is wound around proteins
(hairdryer!)
•DNA has 2 strands wound together that
contains all the info necessary for that cell.
•Each DNA strand has its own order of
nucleotides bonded together. Its like having a
combination lock…hundreds of combinations.
•But DNA has 3,000,000,000 nucleotides so that
would be 4x10 3,000,000,000 combinations.
•Its like having a lock with 3,000,000,000
numbers on it.
• Turn in your worksheet from yesterday on
the table next to the desk (on the left, near
the sink). Have your homework ready for
me to check.
• You will have your mitosis quiz after daily
questions.
Daily Question #22
1.
** Which of the following BEST describes meiosis?
a.
b.
c.
d.
2.
3.
4.
5.
6.
It is carried out in all tissues that require cell replacement
It occurs only in cells in the reproductive structures of the
organism
It happens in all tissues except the brain and spinal cord
It is the first stage of mitosis.
Which element from the periodic table is essential for
building amino acids/proteins?
What is the difference between a scientific theory and a
hypothesis?
During which phase of mitosis does the cell split into 2
identical cells.
Which “phase” does a cell spend most of its lifetime in?
In order starting, with mitosis, what is the lifecycle of a
cell?
Mitosis 6.2
•Describe the
•In order to survive and
process of mitosis reproduce cells must divide.
•When cells get to be a
certain size it either stops
growing or divides.
•Eukaryotic cells divide to form
2 nuclei to make 2 identical
copies.
•This process is called
MITOSIS. (MI-TWO-SIS)
Animation
• (interphase)
• Prophase
• Metaphase
• Anaphase
• Telophase
• cytokinesis
Mitosis
Mitosis
•Describe the 5
stages of mitosis
•Cells spend most of their lives in
“interphase”. Interphase is the time
between each cell division.
•“inter” comes from latin meaning
“between” so interphase really means
the “between” phase. Interphase can
be minutes, days, or years for some
cells. Nerve cells and some muscle
cells never complete a cycle.
•Right before mitosis the DNA copies
itself so that each cell will be identical.
•“INTERPHASE” is sometimes
considered the first stage of mitosis…
Mitosis
•PROPHASE
•Prophase is the first phase of
mitosis.
•Chromosomes coil, the
nuclear env. Breaks apart, and
protein spindle fibers (called
microtubules) from the
centrosomes assemble across
the cell directing the
chromosomes where to go.
Mitosis
•METAPHASE
•Metaphase is the second
stage of Mitosis.
•(some call it the third stage only when they
count “interphase” as the 1st phase)
•Chromosomes line up in the
center of the cell and attach
themselves to the
microtubules.
Mitosis
•ANAPHASE
•Anaphase is the 3rd stage of
mitosis.
•Each chromosome separates
in half (into chromatids) and
they are “reeled” in like a fish
on a fishing pole towards the
opposite sides of the cell.
•Microtubules begin to break
down.
Mitosis
•TELOPHASE
•Telophase is the 4th stage of
Mitosis.
•In Telophase each cell now
has a complete set of
chromosomes, the nuclear
envelope forms around them
and they uncoil so proteins
can be built.
•Microtubules dissapear
Mitosis
•CYTOKINESIS
•Cytokinesis is the final stage
of Mitosis.
•Cytokinesis is where the
cytoplasm of the cell is
pinched creating 2 identical
cells.
•These 2 new cells are then
free to divide again on their
own etc…
Cell Cycle
•Describe the cell
cycle.
•Each cell goes through its own
cycle.
•Most of a cells life is spent in the 3
subphases of interphase.
•The M phase (mitosis phase), G1
(gap 1, growth) is the first phase of
interphase, S phase (2nd phase of
interphase) is where DNA is
synthesized (replicated), G2 (gap 2,
growth and preparation for mitosis).
CO- Students will learn the distinct parts of interphase.
LO- Students will produce a graphic organizer of interphase.
CO- Students will learn the distinct parts of interphase.
LO- Students will produce a graphic organizer of interphase.
No cell lives forever.
•Cell cycle vs
Cancer.
•Cell cycles can be triggered by genes or
other proteins.
•Faulty cells (cancer cells) never stop
replicating, spread throughout the body,
shutting it down, killing the organism.
•Cancer cells break away from main cell,
travel to other parts of the body and
replicate there as well. This is called
metastisizing.
CO- Students will
learn the distinct parts
of interphase.
LO- Students will
produce a graphic
organizer of
interphase.
•Most cancer cells have been found to have
defects in the gene that regulates cell
division.
•Mutations can cause cancer cells.
Factors can be environmental agents,
and chemical agents (like cigarette
Standard 2a
a. Students know meiosis is an early step in
sexual reproduction in which the pairs of
chromosomes separate and segregate
randomly during cell division to reproduce
gametes containing one chromosome of each
type.
b. Only certain cells in a multicellular organism
undergo meiosis.
c. How random chromosome segregation
explains the probability that a particular allele
will be in a gamete.
CO- Students will learn the distinct parts of interphase.
LO- Students will produce a graphic organizer of interphase.
Daily Question #38
After you finish DQ 38 you will need a
separate piece of paper (1/2 sheet)
to write some questions on.
Set the half sheet aside for now until
you need it (follow the directions on
DQ 38)
Daily Question #38
1. Name the five stages of mitosis.
2. What stage does a cell spend most of its life in?
3. What is the main difference between the process of
meiosis and mitosis?
4. What is the G1 phase of the cell cycle?
5. What happens during the S phase of a cell’s cycle?
6. What is the G2 phase of the cell cycle?
7. What is a fertilized egg called?
8. What are sperm and egg cells called?
9. Next, get a half sheet out and write down the
following questions…
Meiosis
1.
They ________ genetic information from ____ to ____
through the process of ____ and ____.
2. Every cell in our body has ____ chromosomes.
3. Homologous chromosomes are a pair of _____ chromosomes
found in a ____ cell.
4. Label all of the phases of meiosis.
5. n + n = ___ (haploid + haploid = ______)
6. What is “crossing over”?
7. What is non disjunction?
8. What is turners syndrome? Does it happen in men?
9. If you are 40 what is the ratio or probability that you will have a
chromosome disorder like downs syndrome.
10. What are some advantages in sexual reproduction?
11. What is a mutation?
Mitosis Worksheet
• Use your notebook (NO TEXTBOOKS YET!) to
help you solve as many questions as you can. If
you get stuck, use the book and the internet as
a resource. Due Friday.
• Have your notebook on your desk so I can
check your homework.
• Want extra credit? I will give you 15 points extra
credit in your test category if you go to the
following website http://tinyurl.com/cctdj35
follow the directions and complete the entire
process (print out the pages so you can write
on them, to turn in) due monday
Daily Questions # 39 (look in your notes!)
1. What is a gamete?
2. Are gametes haploid or diploid?
3. Meiosis is a two stage process. The first stage
reduces the number of chromosomes by
_____. The second stage separates identical
copies of _______.
4. What is crossing over?
5. Crossing over is important because it makes
sure the no two sets of chromosomes are
_______.
6. Crossing over produces a wide array of
genetic _______ in a population.
7. Mitosis produces how many identical cells?
8. Meiosis produces how many daughter cells?
Meiosis!
• Draw the following picture (on next slide) large
on an open left hand side of your notebook.
• Homework!
– Meiosis Worksheet due tomorrow! (you will get it
today)
– Meiosis Lab tomorrow
– Mitosis/Meiosis quiz on Wednesday (minimum day.)
• How fast we work will dictate how fast we get to IAL
CO- Students will compare the process of mitosis with meiosis
LO- Students will take practice quiz as refresher, and create
graphic organizer for Meiosis.
Phases of meiosis
draw LARGE on
left hand side
MEIOSIS 1
MEIOSIS 2
Meiosis 1
Prophase 1
Metaphase 1
Anaphase 1
Telophase 1
Cytokinesis
Meiosis 2
Prophase 2
Metaphase 2
Anaphase 2
Telophase 2
Cytokinesis 2
CO- Students will compare the process of mitosis with meiosis
LO- Students will take practice quiz as refresher, and create graphic organizer
for Meiosis.
Meiosis
•Describe Mieosis
•We learned a gamete is a
reproductive cell (sperm/egg).
Human cells have 46
chromosomes (2 pair of 23),
gametes are haploid and only
contain 23.
•Two gametes give half of DNA
to offspring totalling 46 chrom.
•Gametes are formed via
meiosis.
CO- Students will compare the process of mitosis with meiosis
LO- Students will take practice quiz as refresher, and create graphic organizer
for Meiosis.
Meiosis
•Describe Mieosis
•Meiosis is a type of nuclear
division that takes place in 2
stages (meiosis 1 and
meiosis2)
•The 2N (Diploid) Parent
chromosomes separate.
CO- Students will compare the process of mitosis with meiosis
LO- Students will take practice quiz as refresher, and create graphic organizer
for Meiosis.
Meiosis
•Describe Mieosis
•Parent chromosomes are
copied. (92 total)
CO- Students will compare the process of mitosis with meiosis
LO- Students will take practice quiz as refresher, and create graphic organizer
for Meiosis.
Meiosis
•Describe Mieosis
•Like Chromosomes
(homologous) pair up together.
CO- Students will compare the process of mitosis with meiosis
LO- Students will take practice quiz as refresher, and create graphic organizer
for Meiosis.
CO- Students will compare the process of mitosis with meiosis
LO- Students will take practice quiz as refresher, and create graphic organizer
for Meiosis.
•Describe Mieosis
•Chromosomes “swap”
sections of DNA (crossing
over).
•This creates a mix of new
genetic material in the
offspring's cells.
Meiosis
•Describe Mieosis
•That nucleus divides into 2
“daughter” cells. With a mix if
genetic info.
•Each now has 46
chromosomes (2n)
CO- Students will compare the process of mitosis with meiosis
LO- Students will take practice quiz as refresher, and create graphic organizer
for Meiosis.
Meiosis
•Describe Mieosis
•Daughter nuclei divide again
producing 4 haploid (n) cells
(contains “half” of the genetic info,
or 23 chromosomes)
•Chromosomes divide, daughter
nuclei end up with single
chromosome (chromotid) with new
genetic mix.
CO- Students will compare the process of mitosis with meiosis
LO- Students will take practice quiz as refresher, and create graphic organizer
for Meiosis.
• In males, the 4 1n
haploids develop
“heads” and “tails”.
• In females, out of
the 4, 1n haploids,
usually only 1
survives. The
others (polar
bodies) usually are
absorbed by the
body and do not
develop.
CO- Students will compare the process of mitosis with meiosis
LO- Students will take practice quiz as refresher, and create graphic organizer
for Meiosis.
Meiosis 1
•Why is crossing
over important?
•Crossing over is vital.
•When two haploid (n) cells
combine, the resulting cell is a
diploid (2n)
•It received 1 of each type of
chromosome from each “pair”.
•importance, it will help that person
have traits that may help it survive
better.
•People are getting taller, stronger
and faster because of crossing over.
Genetics!
• Shake what yo mama gave you!
Standard 2
d. students know combinations of alleles may be
generated in a zygote through the fusion of male and
female gametes (fertilization).
g. how to predict possible combinations of alleles in a
zygote from the genetic make up of parents.
STANDARD 3
Multicellular organism develops from a single zygote,
and its phenotype depends on its genotype which
happens at fertilization.
a. students know how to predict the probable outcome
of phenotypes in a genetic cross from the genotypes
from parents either dominant or recessive.
b. Students know the genetic basis for Mendel’s laws
of segregation and independent assortment.
Daily Question #23
2 test questions, Slide will change in 6 minutes.
Daily Question #23
1. ** In fruit flies, the gene for red eyes (R) is dominant
and the gene for sepia eyes (r) is recessive. What
are the possible combinations of genes in the
offspring of two red-eyed heterozygous flies (Rr)?
a. RR only
b. Rr and rr only
c. rr only
d. RR, Rr, and rr only
2. **Mendel hypothesized that reproductive cells have
only one factor for each inherited trait. This
hypothesis is supported by the observation that.
a.
b.
c.
d.
Haploid cells are produced by mitosis
Diploid cells are produced by mitosis
Haploid cells are produced by meiosis
Diploid cells are produced by meiosis
Daily Question #23
3. Put these in order from smallest to
largest: Chromosome, nucleotide,
chromatid, nucleic acid, nitrogen, Cell,
Nucleus.
4. Describe how a DNA mutation could be
a GOOD thing.
5. Cell Division is a normal process, what
makes CANCER so bad/fatal.
6. What is a dominant trait?
7. What is a recessive trait?
Daily Question #23
1. ** In fruit flies, the gene for red eyes (R) is dominant
and the gene for sepia eyes (r) is recessive. What
are the possible combinations of genes in the
offspring of two red-eyed heterozygous flies (Rr)?
a. RR only
b. Rr and rr only
c. rr only
d. RR, Rr, and rr only
2. **Mendel hypothesized that reproductive cells have
only one factor for each inherited trait. This
hypothesis is supported by the observation that.
a.
b.
c.
d.
Haploid cells are produced by mitosis
Diploid cells are produced by mitosis
Haploid cells are produced by meiosis
Diploid cells are produced by meiosis
Daily Question #23
3. Put these in order from smallest to
largest: Chromosome, nucleotide,
chromatid, nucleic acid, nitrogen, Cell,
Nucleus.
4. Describe how a DNA mutation could be
a GOOD thing.
5. Cell Division is a normal process, what
makes CANCER so bad/fatal.
6. What is a dominant trait?
7. What is a recessive trait?
Genetics
•What is the
scientific study of
heredity.
•Who was Gregor
Mendel
•The scientific study of heredity is
called genetics.
•Gregor Mendel was monk who
studied the genetics of pea
plants.
•He applied math towards the
probability of traits of garden peas
to be certain colors/shapes.
•He used self fertilization (where
plants can fertilize themselves
b/c) or cross fertilization (where
plants pollinate other plants).
Daily Question #24
1. What type of plants did Mendel use to
conduct his experiments on genetics on?
2. List 3 reasons why he used them.
3. Describe his 3 step method for fertilizing his
pea plants.
4. Describe self fertilization.
5. Describe cross fertilization.
6. You have a blue shirt and a red shirt, jeans
and shorts. List all the possible combinations
you could wear. (draw a punnet square if you
dare... Bwahahahahahahahahaha)
Genetics
•Describe
Mendel’s 3 step
experiment.
1. Produced PURE breading strains.
These offspring produced only 1
kind of trait i.e. flower color, pea
shape, etc. He called these pure
plants the parental generation
(parents) or the P generation. He
had multiple pure pea plants for
different traits.
Genetics
•Describe
Mendel’s 3 step
experiment.
2. Crossed 2 different varieties
purple and white in the P
generation through cross
polination and collected the
seeds. These were called the
filial generation or F1.
Offspring were all “hybrid”.
What is a hybrid?
P1
Genetics
•Describe
Mendel’s 3 step
experiment.
3. Mendel allowed the F1 generation
to SELF fertilize to produce the F2
generation of plants. He noticed
that white flowers reappeared.
He added math to try and understand
the ratio of plants. In the F2
generation the ration was 3:1 or 75%
of the plants were purple, and 25%
of the plants were white.
IF you did this experiment, what
conclusions could you come up with
on why the plants would turn out this
color?
Genetics
With Mendels tests he came up with
a set of rules that could be used to
predict patterns of heredity.
In peas, there are different traits:
flower color, seed color, seed
shape, pod color, flower height
and flower position. In animals
obviously there are a lot more.
Genetics
•Describe
Mendel’s 5
heredity “rules”.
1. parents transfer info about traits to
offspring = “factors”
2. Each individual has 2 “factors”
for each trait. The factors may or
may not have same info.
• SAME factors are homozygous.
BB for brown hair and bb for
blonde.
• If they do NOT have the same
factors, they will by
heterozygous. For example Bb.
Genetics
•Describe
Mendel’s 5
heredity “rules”.
3. Alternative forms of a “factor” or
gene are called alleles. Many alleles
make up an organisms genotype.
This is the code for the genes.
Its like an xbox game. The disk you put
in contains all the (same) info for that
game in code. But each game is
expressed differently on screen
depending on the order of that code.
Genotype are the “codes”.
Phenotype is an organism’s physical
appearance. brown or blonde hair
etc... It’s the “physical” expression of
that gene.
Genetics
•Describe
Mendel’s 5
heredity “rules”.
4. An individual has 2 alleles for each
trait. One from each parent.
Blonde hair for example has the allele b
for blonde, and B for brown.
Alleles are passed on from parent to
offspring.
Genetics
•Describe
Mendel’s 5
heredity “rules”.
5. Just because one allele is present
does not mean it will be expressed.
Some genes are dominant. Like
arm wrestling. The dominant,
“stronger” allele will win over the
•Contrast between
recessive gene/allele.
dominant and
recessive alleles. Brown hair is a dominant gene so it is a
capital B, blonde is a recessive gene
so it is a lower case b.
Recessive genes are present but do not
get expressed. You have to have a
homozygous recessive gene (bb for
blonde) in order to have that gene
expressed. So that means you received
both recessive traits from your parents.
Daily Question #25
•
Slide will change automatically after 4
minutes, please write a complete sentences
for your answer…
CO- Students will compare the relationships between homozygous and
heterozygous and genotype and phenotype.
LO- Students will work on examples and actively take notes.
Daily Question #25
1.
2.
CO- Students will compare the relationships between homozygous and
heterozygous and genotype and phenotype.
LO- Students will work on examples and actively take notes.
Daily Question #25
3.
4. Draw a punnet square crossing a male dwarf
bearded dragon (dd) with a regular
(heterozygous) bearded dragon that carries
the gene for dwarfism. List Genotype and
phenotypes.
Genetics
•Mendels
conclusions
CO- Students will
compare the
relationships between
homozygous and
heterozygous and
genotype and phenotype.
LO- Students will work on
examples and actively
take notes.
• Because some attributes “disappear” for a
generation, he concluded there must be 2
factors for each genetic trait: Mendel’s first
law, the law of segregation
• The L of segregation states that the
members of each pair of alleles
separate when gametes are formed. A
gamete receives one allele or the other
• Genes for two different traits don’t always
stay together: Mendel’s second law, law of
independent assortment
• The L of Ind. Ass. States that 2 or more
pairs of alleles separate independently
of one another during gamete
formation.
• Mendel’s work showed that chromosomes
were the carriers of heredity.
Genetics
•Contrast between
heterozygous and
homozygous
•Contrast
genotype and
phenotype
CO- Students will compare the relationships between homozygous and
heterozygous and genotype and phenotype.
LO- Students will work on examples and actively take notes.
Genetics
A HETEROZYGOUS trait is a trait with two
different ALLELES.
Example?
Brown hair – Allele = B (dominant)
Blonde hair – Allele = b (recessive)
HETEROZYGOUS would be Bb
CO- Students will compare
the relationships between
homozygous and
Example?
heterozygous and
genotype and phenotype.
Homozygous for Brown hair – Alleles = BB
LO- Students will work on
Homozygous for Blonde hair – Alleles = bb examples and actively take
notes.
A HOMOZYGOUS trait is a trait with the
SAME alleles.
SEE THE DIFFERENCE?
Here are a few traits…
Genetics
CO- Students will compare the
relationships between
homozygous and heterozygous
and genotype and phenotype.
LO- Students will work on
examples and actively take
notes.
Brown hair – B
Straight hair - S
Blonde hair – b
curly hair - s
Hitchhiker thumb – H
attached ear lobes – L
Non-hitchhiker thumb – h unattached ear lobes – l
Write down your answers!
1. What is the homozygous recessive for curly hair?
2. What is the homozygous dominant for Brown hair?
3. What is the heterozygous trait for attached/unattached ear
lobes?
4. What is the heterozygous trait for thumbs?
5. Homozygous dominant for thumbs.
6. Heterozygous for curly/straight hair.
Here are a few traits…
Genetics
CO- Students will compare the
relationships between
homozygous and heterozygous
and genotype and phenotype.
LO- Students will work on
examples and actively take
notes.
Brown hair – B
Straight hair - S
Blonde hair – b
curly hair - s
Hitchhiker thumb – H
attached ear lobes – L
Non-hitchhiker thumb – h unattached ear lobes – l
GENOTYPE vs. PHENOTYPE
A GENOTYPE are the alleles used to describe a gene. For example Bb
is the genotype (heterozygous) for which trait?
Genotypes can be any letters.
A PHENOTYPE is the physical expression of that gene, or what that
gene does to the organism.
So what is the phenotype for s?
What are the genotypes for thumbs?
What is the phenotype for L?
Genetics
You will have a quiz on your reading.
I will check your homework AFTER the quiz.
Everything cleared off (in 5 minutes) of your desk for the quiz.
If you brought colored pencils/crayons, have them out on your
desk.
CO- Students will compare the different nucleotides that create genetic diversity in the DNA strand
on the chromosome.
LO- Students will take a quiz on the functions then do active reading/coloring of DNA parts.
A. Bb
A. SS
A. homozygous
B. bb
B. ss
B. heterozygous
C. BB
C. Ff
C. genotype
D. Ss
D. ff
D. phenotype
E. Dominant
E. Recessive
E. allele
1. Alleles that produce a physical (detectable) trait of an
organism.
2. An allele that does not achieve expression but is still
present in an individual.
3. A specific combination of alleles in an individuals DNA.
4. This describes an organism that has 2 different alleles of a
particular gene.
5. One of the two or more of an alternative forms of a gene,
leading to a unique trait.
A. Bb
A. SS
A. homozygous
B. bb
B. ss
B. heterozygous
C. BB
C. Ff
C. genotype
D. Ss
D. ff
D. phenotype
E. Dominant
E. Recessive
E. allele
6. An allele that achieves expression when it is present in an
individual.
7. Describes a an organism that has 2 of the same alleles of a
particular gene.
8. Which of the above is homozygous dominant for the allele
for Brown fur (B)?
9. Which of the above would be heterozygous for spots (s)?
10. A male, no freckles (Ff) and a female, no freckles (Ff) have
children. (ff) is recessive for freckles. Which genotype
from above would be most common for their kids?
Mendel…taking a pea
Heterozygous
Homozygous
Genotype
phenotype
Daily Question #26
1. A killer whale with 3 spots (KK) mates
with a killer whale with 1 spot (kk) draw a
punnet square and list the possible
genotype and phenotypes for the
offspring. (Kk= 2 spots).
2. What do we call the gene that “controls”
a trait (stronger)?
3. Who was the scientist that made the
most notable contributions to genetics?
4. In a gene what does a capital letter stand
for?
5. A lower case letter?
Daily Question #26
6.
Construct a cross between a male heterozygous brown haired
hamster and a female heterozygous brown haired hamster.
B= black, b= white, Bb= brown
P1
Include all possible genotypes
And phenotypes.
Genotypes=
P2
Phenotypes=
Daily Question #27
1. A heterozygous tiger salamander with
yellow stripes, is crossed with a
heterozygous tiger salamander. Yellow is
dominant with a rare recessive trait of
making red stripes. Construct a punnet
square and list all possible geno and
pheno types.
2. Using the words: ribosome(s), protein(s),
DNA, Nucleus, Cytoplasm, mRNA, and
replication, describe the process of protein
synthesis (the making of) starting with the
instructions from the DNA molecule.
3. Get a separate piece of paper out and
your paragraph from your coloring packet.
Daily Question #28
1. How much genetic information do you get
from your parents?
2. What are the two sex cells (gametes)
called?
3. What is a cell called that contains all 46
chromosomes?
4. What is a cell called that contains 23
chromosomes?
5. Albinism is a rare recessive trait among turtles
(a). What is the probability of albinism in turtle
offspring if two heterozygous parents that
carry the albino gene mate? Create a punnet
square.
Daily Questions #29
1. Name the four nucleotide bases found on your
DNA strand.
2. What is the Base Pair Rule and how does it
work?
3. What are the 3 parts that make up a nucleotide?
4. Which organelle in the cell makes proteins?
5. A normal healthy cheetah (F) is crossed with a
heterozygous cheetah carrying a recessive (f)
allele that affects muscle tone, making the
cheetah slower. Draw a punnet square, list the
possible geno and phenotypes.
Genetics
•Patterns of
inheritance
• Mendel concluded that genes combing
according to probability.
• The probability of parents have an
offspring with a certain trait depends on
the traits THEY have to pass on.
• Punnet squares are an easy way to illustrate
this probability.
WW
ww
Patterns of Inheritance
•What is a punnett
square?
• Punnett squares help us visualize how often a
gene will be expressed in offspring. For
convenience, letters are used to represent
alleles for a specific trait. Lets go back to
Mendel’s peas.
• Mendel bred “true” or “pure” traits. A purple
pea flower is Dominant so it will be “W”. A
White pea flower is recessive so it will be “w”.
A homozygous purple=WW and white = ww.
(Hom, Purple)
W
WW
(hom, white)
w
ww
w
W
Genetics
•What is a punnett
square?
• So all of our offspring for F1 turned out to
be Ww.
• Is Ww heterozygous or homozygous?
• What gene will be “expressed”?
• What happens if we cross those two to
make F2 generation?
• Which will yield purple flowers and which
white?
W
Ww
W
Ww
w
w
Genetics
•What is a punnett
square?
• A Dihybrid cross is a little trickier.
• Dihybrid crosses show 2 traits of interest.
• Dihybrid crosses contain 16 boxes.
• Lets cross 2 traits color and seed shape
YyRr= YR, Yr, yR, yr
GENO
TYPE =
Genetics
•What is a punnett
square?
• Parents (P) = Yellow, round seed (YyRr) and
Yellow round seed (YyRr).
• Y=yellow, y= green, R=round, r= wrinkle/dent
PHENO TYPE =
Yellow, round seed (YyRr)
Yellow, round
seed (YyRr)
YR
Yr
yR
yr
YR
YYRR
YYRr
YyRR
YyRr
Yr
YYRr
YYrr
YyRr
Yyrr
yR
YyRR
YyRr
yyRR
yyRr
yr
YyRr
Yyrr
yyRr
yyrr
Daily Questions # 30
1. When 2 traits BLEND together, like a red
flower and white flower making a pink flower,
what is it called?
2. When 2 traits or genes are BOTH expressed
together, it is called ______
Homework!
homework:
Ch. 12.4,
vocab: codominance, polygenic character,
incomplete dominance.
Questions: 1, 2, 3, 5.
Don’t forget your page numbers!
Daily Questions # 30
1. Which part of the cell is responsible for making
proteins?
2. Proteins are long chains of _____ _____.
3. DNA is coiled up into shapes called _____, they are
located in the _____ of almost every cell of your
body.
4. A nucleotide has 3 parts: a phosphorus, a ______
and 1 of 4 ______.
5. The 4 bases of a nucleotide are ______, ______,
______, ______.
6. The base pair rule says that _____ always bonds
with ______ and _____ always bonds with _____.
7. In mRNA, ______ is replaced by ______.
Genetics
•Other heredity
factors
• Two traits can blend creating an incomplete
dominance. (Like our example with black
and blonde hair = brown hair.)
• Or in the case of a red flower mixed with a
white flower making pink flowers. A blend of
both.
• Or straight hair from parent and curly hair
from parent producing “wavy” hair in children.
Genetics
•Other heredity
factors
• Two traits can blend creating an incomplete
dominance. (Like our example with black and
blonde hair = brown hair.)
• Or in the case of a red flower mixed with a
white flower making pink flowers. A blend of
both.
• In some cases both genes (heterozygote) are
expressed called codominance.
• A “roan” coat in horses is where both
traits are expressed so you have both
white hairs and black hairs and red hairs
showing up instead of one solid color.
Genetics
•Other heredity
factors
• Some traits are controlled by genes that have
more than 2 alleles.
• Blood type in humans is controlled by
multiple alleles.
• A,B,O = AA, AO, BB, BO, AB, O+/• Some traits are controlled by many genes =
polygenic.
• Polygenic genes control (in humans)
height, weight, body build, hair and skin
color.
• Gene expressions can be affected by
environment (temperature etc..)
• Some animals change colors, like arctic
fox, controlled by enzymes that stop
producing in summer.
Understanding DNA
•How did
scientists identify
DNA?
• Scientists did not know whether it was DNA
or the proteins that store and transmit genetic
traits.
• There were several studies with bacteria that
gave them answers.
Understanding DNA
•How did
scientists identify
DNA?
• 1928, London, Frederick Griffith used mice to
test virulent and non-virulent bacteria called
pneumococcus.
• Virulent bacteria formed “smooth” colonies in
petri dishes, and non-virulent formed “rough”
colonies in petri dishes.
• Virulent bacteria injected in mice killed
them.
• Nonvirulent injected did not harm mice
• Virulent bacteria killed with heat, did not
harm mice
• Mixture of non-virulent and heat-killed
virulent bacteria killed mice…why?
• The non-virulent bacteria went through
transformation and became virulent by
taking in parts of virulent bacteria.
Understanding DNA
•How did
scientists identify
DNA?
• Oswald Avery, 1944, New York, copied
experiment that Griffith did and noticed that
transformation did NOT occur when
destroying enzymes killed the DNA.
• Most scientists still held on to the idea that
the proteins held genetic material though.
So…
• Hershey and Chase confirmed this through
radiation marked bacteria.
• Here is how they work…
• So…what the heck, WHY is this important?!?!
• Vaccinations have saved billions of lives by
being able to blocking viruses from taking
over your body! You would be dead.
• Yeah pretty important.
Daily Questions # 31
1. From your DNA homework case study, do you think t
was right or wrong?
2. List 2 pieces of evidence
that support your conclusion.
3. Draw the image and complete
the following:
a)
b)
c)
Circle a nucleotide.
Label the sugar and phosphate.
Label the bases that are blank
You’ve got the cutest little babyface!
Bio technology has allowed us to determine or make an educated
guess (very accurately I might add) about which traits will most
likely get passed down to your children.
There’s even an app for that!
For example:
CO-Students will explore DNA and Chromosomes in terms of genes and their
instructions for passing traits from parents to offspring.
LO- Students will work in pairs to determine which traits their “offspring” will
have and then draw their baby’s face.
You’ve got the cutest little babyface!
CO-Students will explore DNA and Chromosomes in terms of genes and their
instructions for passing traits from parents to offspring.
LO- Students will work in pairs to determine which traits their “offspring” will
have and then draw their baby’s face.
You’ve got the cutest little babyface!
CO-Students will explore DNA and Chromosomes in terms of genes and their
instructions for passing traits from parents to offspring.
LO- Students will work in pairs to determine which traits their “offspring” will
have and then draw their baby’s face.
You’ve got the cutest little babyface!
CO-Students will explore DNA and Chromosomes in terms of genes and their
instructions for passing traits from parents to offspring.
LO- Students will work in pairs to determine which traits their “offspring” will
have and then draw their baby’s face.
You’ve got the cutest little babyface!
+
CO-Students will explore DNA and Chromosomes in terms of genes and their
instructions for passing traits from parents to offspring.
LO- Students will work in pairs to determine which traits their “offspring” will
have and then draw their baby’s face.
You’ve got the cutest little babyface!
CO-Students will explore DNA and Chromosomes in terms of genes and their
instructions for passing traits from parents to offspring.
LO- Students will work in pairs to determine which traits their “offspring” will
have and then draw their baby’s face.
You’ve got the cutest little babyface!
+
CO-Students will explore DNA and Chromosomes in terms of genes and their
instructions for passing traits from parents to offspring.
LO- Students will work in pairs to determine which traits their “offspring” will
have and then draw their baby’s face.
You’ve got the cutest little babyface!
CO-Students will explore DNA and Chromosomes in terms of genes and their
instructions for passing traits from parents to offspring.
LO- Students will work in pairs to determine which traits their “offspring” will
have and then draw their baby’s face.
You’ve got the cutest little babyface!
Using the “class set” and your lab paper, FOLLOW THE
INSTRUCTIONS on how to choose the traits for your baby and
compose a portrait of that baby using the specified trait diagrams.
Good luck…
CO-Students will explore DNA and Chromosomes in terms of genes and their
instructions for passing traits from parents to offspring.
LO- Students will work in pairs to determine which traits their “offspring” will
have and then draw their baby’s face.
STANDARD 4
The genetic composition of cells can be
altered by incorporation of exogenous
DNA into the cells. As a basis for
understanding this concept:
a. Students know the general structures and
functions of DNA, RNA, and protein
b. Students know how to apply base-pairing
rules to explain precise copying of DNA during
semi-conservative replication and transcription
of information from DNA into mRNA.
c. Students know genetic engineering
(biotechnology) is used to produce novel
biomedical and agricultural products.
Daily Question #32LOOKIN NB!
The following are test questions, rewrite the question and
the answer. (you don’t have to draw the chart)
Slides will change automatically.
Daily Question #32LOOKIN NB!
*1. A strand of mRNA containing the repeating sequence
AAGAAGAAGUAA could code for which sequence?
a. lys-arg-glu-lys
b. ser-ser-glu-glu
c. lys-arg-lys-arg
c. lys-lys-lyse-stop
30 seconds!
Daily Question #32LOOKIN NB!
*2. The following sequence of DNA is part of a gene. How many
amino acids are coded for by this segment?
5’ ATCAGCGCTGGC 3’
a. 8
b. 4
c. 12
d. 20
*3. A scientist puts nucleotide chains of AAAAAA in a test tube
under conditions allowing protein synthesis. Soon the tube is
full of polypeptide chains of only the amino acid lysine. What
does this experiment show?
a. Amino Acid Lysine is composed of adenine.
30 seconds!
b. AAA codes for the amino acid lysine
c. Protein synthesis malfunctions in test tubes.
d. most proteins contain only one type of amino acid.
Daily Question #32LOOKIN NB!
*4. Which of these would MOST likely cause a mutation?
a. the placement of ribosomes on the endoplasmic reticulum
b. the insertion of a nucleotide into DNA
c. the movement of tRNA out of the nucleus
d. the release of mRNA from DNA
*5. the clear protein of an egg white becomes opaque and firm
when cooked because the heat
a. mutates the DNA
b. turns the protein into carbohydrates
30 seconds!
c. stops protein formation
d. changes the protein structure
Daily Question #32LOOKIN NB!
6. The following segment of DNA has undergone a mutation in
which three nucleotides have been deleted. A repair enzyme
would replace them with
5’ G T A _ _ _ A A 3’
3’ C A T GCA T T 5’
a. CGT
b. GCA
c. CTG
d. GTA
30 seconds!
Daily Question #32LOOKIN NB!
*1. A strand of mRNA containing the repeating sequence
AAGAAGAAGUAA could code for which sequence?
a. lys-arg-glu-lys
b. ser-ser-glu-glu
c. lys-arg-lys-arg
c. lys-lys-lyse-stop
Daily Question #32LOOKIN NB!
*2. The following sequence of DNA is part of a gene. How many
amino acids are coded for by this segment?
5’ ATCAGCGCTGGC 3’
a. 8
b. 4
c. 12
d. 20
*3. A scientist puts nucleotide chains of AAAAAA in a test tube
under conditions allowing protein synthesis. Soon the tube is
full of polypeptide chains of only the amino acid lysine. What
does this experiment show?
a. Amino Acid Lysine is composed of adenine.
b. AAA codes for the amino acid lysine
c. Protein synthesis malfunctions in test tubes.
d. most proteins contain only one type of amino acid.
Daily Question #32LOOKIN NB!
*4. Which of these would MOST likely cause a mutation?
a. the placement of ribosomes on the endoplasmic reticulum
b. the insertion of a nucleotide into DNA
c. the movement of tRNA out of the nucleus
d. the release of mRNA from DNA
*5. the clear protein of an egg white becomes opaque and firm
when cooked because the heat
a. mutates the DNA
b. turns the protein into carbohydrates
c. stops protein formation
d. changes the protein structure
Daily Question #32LOOKIN NB!
6. The following segment of DNA has undergone a mutation in
which three nucleotides have been deleted. A repair enzyme
would replace them with
5’ G T A _ _ _ A A 3’
3’ C A T GCA T T 5’
a. CGT
b. GCA
c. CTG
d. GTA
Baby Face
• You will have about 12 minutes to finish
your baby face! It must have color.
CO-Students will explore DNA and Chromosomes in terms of genes and their
instructions for passing traits from parents to offspring.
LO- Students will work in pairs to determine which traits their “offspring” will have and
then draw their baby’s face.
Understanding
DNA
• DNA is composed of nucleotides.
•Rosalind Franklin
discovers DNA
shape.
• A nucleotide is composed of 3 parts:
• A sugar (deoxyribose)
• A phosphate
• And a base.
• The base can be one of 4 kinds
• The 2 larger bases are called
PURINES
• Adenine
• Guanine
CO-Students will identify the different
parts of DNA, Nucleotides.
LO- Students will take active notes
and draw examples of DNA and
Nucleotides.
• The 2 smaller bases are called
PYRIMIDINES
• Thymine
• Cytosine
Understanding
DNA
• Scientists discovered that the amount of one
•Rosalind Franklin
discovers DNA
shape.
base always equaled the amount of another
base and they were always paired together.
• A & T (or T & A)
• G & C (or C & G)
• Known as Chargaff’s rule or the Base Pair
Rule (discovered by Erwin Chargaff).
• Rosalind Franklin then produced an image
using x-ray diffraction showing DNA’s “double
helix shape....like a tightly coiled spring.
CO-Students will identify the different parts of DNA, Nucleotides.
LO- Students will take active notes and draw examples of DNA and
Nucleotides.
Daily Question #33LOOKIN NB!
The following are test questions, write down the
question and your answer…
Your test is next week!!!
Daily Question #33LOOKIN NB!
*1. Although there are a limited number of amino
acids, many different types of proteins exist
because
a. size of a given amino acid can vary
b. chemical composition of a given amino acid can vary
c. sequence and number of amino acids is different
d. same amino acid can have many different properties.
*2. How would a base sequence (ACAGTGC) be
coded on mRNA?
a. TGTCACG
c. UGUCACG
b. GUGACAU
d. CACUGUA
Daily Question #33LOOKIN NB!
*3. The bacterium agrobacterium tumefaciens
infects plants, and a portion of its DNA is
inserted into the plants chromosomes. This
causes the plant to produce gall cells which
manufacture amino acids that the bacterium
uses as food. This process is a natural
example of
a. poyploidy
b. genetic manipulation
c. grafting
d. hybridization
Daily Question #33LOOKIN NB!
*4. In carrier pigeons there is a rare inherited
condition that causes the death of the chicks
before hatching. In order for this disease to be
passed from generation to generation there
must be parent birds that
a. are heterozygous for the disease
b. have the disease themselves
c. produce new mutations for this disease
d. are closely interbred
Daily Question #33LOOKIN NB!
*5. Mutations within a DNA sequence
are
a. natural processes that produce genetic diversity
b. natural processes that always affect the phenotype
c. unnatural processes that always affect the
phenotype
d. unnatural processes that are harmful to genetic
diversity.
6. Put the following in order going from DNA
to protein synthesis
Protein, DNA, translation, transcription, RNA
This is DNA to amino Acids (protein). Draw this in your
notebook and complete what you think each strand
would be, based off the given RNA strand.
You will need the amino acid chart for this one! So leave
blank for now…
Daily Question #33LOOKIN NB!
*1. Although there are a limited number of amino
acids, many different types of proteins exist
because
a. size of a given amino acid can vary
b. chemical composition of a given amino acid can vary
c. sequence and number of amino acids is different
d. same amino acid can have many different properties.
*2. How would a base sequence (ACAGTGC) be
coded on mRNA?
a. TGTCACG
c. UGUCACG
b. GUGACAU
d. CACUGUA
Daily Question #33LOOKIN NB!
*3. The bacterium agrobacterium tumefaciens
infects plants, and a portion of its DNA is
inserted into the plants chromosomes. This
causes the plant to produce gall cells which
manufacture amino acids that the bacterium
uses as food. This process is a natural
example of
a. poyploidy
b. genetic manipulation
c. grafting
d. hybridization
Daily Question #33LOOKIN NB!
*4. In carrier pigeons there is a rare inherited
condition that causes the death of the chicks
before hatching. In order for this disease to be
passed from generation to generation there
must be parent birds that
a. are heterozygous for the disease
b. have the disease themselves
c. produce new mutations for this disease
d. are closely interbred
Daily Question #33LOOKIN NB!
*5. Mutations within a DNA sequence
are
a. natural processes that produce genetic diversity
b. natural processes that always affect the phenotype
c. unnatural processes that always affect the
phenotype
d. unnatural processes that are harmful to genetic
diversity.
6. Put the following in order going from DNA to protein
synthesis
Protein, DNA, translation, transcription, RNA
Copy this
chart in
your
notebook!
• Color!
Daily Questions #34
1. What is mRNA?
2. What is tRNA?
3. Put the following in order: transcription,
translation, DNA, mRNA, tRNA, protein,
amino acid.
4. Proteins are just long chains of what?
5. What are the four nucleotides used in a DNA
strand?
6. What letters represent those nucleotides?
7. Name all the possible pairings that are
possible between nucleotides?
8. What letter replaces T in mRNA and tRNA?
Understanding
DNA
• DNA contains nucleotides that only bond with
•Watson and Crick
build DNA model
certain pairs. AT, TA or GC, CG
• The bases face each other and form together
by a weak hydrogen bond.
CO-Students will identify the different parts of DNA, Nucleotides.
LO- Students will take active notes and draw examples of DNA and
Nucleotides.
Understanding
DNA
• IF we are to pass on genetic info, that genetic
•DNA unzips to
get copied…
info needs to be copied like in a zerox
machine. So how does it work?
• EASY!
• Since A and T always go together (in DNA),
and G and C always go together…the DNA
unzips, matches the bases with its opposite
pair and shabam…copied!
• This process is called REPLICATION.
• DNA unzips, exposing the nucleotide
sequence, DNA polymerase (enzyme) moves
down the line pairing the bases together, a
complimentary strand is formed and then they
join back up making 2 identical copies.
• Think about the Kinex
CO-Students will identify the different parts of DNA, Nucleotides.
LO- Students will take active notes and draw examples of DNA and
Nucleotides.
Understanding DNA
•How proteins are
made.
• FIRST, DNA uncoils in nucleus
• mRNA is made by an enzyme RNA
polymerase. Here, T is substituted by the
amino acid U.
• mRNA leaves nucleus and enters the
cytoplasm
• tRNA (transfer RNA) interprets code
written on mRNA
• tRNA brings code to ribosome to make
the protein.
• Once completed tRNA detaches and is
free to go do its job all over again.
Lets look at it here.
CO-Students will identify the different parts of DNA, Nucleotides.
LO- Students will take active notes and draw examples of DNA and
Nucleotides.
So what the heck?
• Proteins are made in 3 steps:
– DNA gets copied. (each nucleotide)
– mRNA transcribes
– tRNA transposes to ribosomes
• Practice
Start with DNA, transcribe to mRNA, transpose to tRNA =
amino acids
• ATC CGC GGG CTA AGT TTA AAA
– DNA
- mRNA
- tRNA
Amino Acids
EVERY THREE NUCLEOTIDES CODES FOR AA.
Understanding
DNA
• DNA strands are described by their position.
•DNA unzips to
get copied…
5’
3’
• 5’ (prime) to 3’ is usually the top strand
• 3’ to 5’ is the bottom strand (exactly opposite)
3’
• Each sequence forms a “code” that is
5’
translated by the tRNA (transfer RNA) and
the mRNA (messenger RNA) to create the
amino acids for the proteins.
• Proteins then make up everything in your
body!
So what the heck?
• Practice DNA, mRNA, tRNA, Amino Acids
• Remember every 3 nucleotides is an amino
acid so……. How many AA are here?
• ATTGTACGCCCCGGGAAATATGAT
STANDARD 5
Genes are a set of instructions encoded in the DNA sequence of each organism
that specify the sequence of amino acids in proteins characteristic of that
organism. As a basis for understanding this concept:
c. Students know how mutations in the DNA sequence
of a gene may or may not affect the expression of
the gene or the sequence of amino acids in an
encoded protein.
d. Students know specialization of cells in multicellular
organisms is usually due to different patterns of
gene expression rather than to differences of the
genes themselves.
e. Students know proteins can differ from one another
in the number and sequence of amino acids.
The(spc)cali(spc)game(spc)is(spc)a(spc)trippy(spc)mind(spc)state