* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Jeopardy - TeacherWeb
Mitochondrial DNA wikipedia , lookup
DNA vaccination wikipedia , lookup
Frameshift mutation wikipedia , lookup
DNA paternity testing wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Genomic library wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Population genetics wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Genetic code wikipedia , lookup
Genetic drift wikipedia , lookup
DNA polymerase wikipedia , lookup
Molecular cloning wikipedia , lookup
Epigenomics wikipedia , lookup
Non-coding DNA wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Hardy–Weinberg principle wikipedia , lookup
Microsatellite wikipedia , lookup
Primary transcript wikipedia , lookup
SNP genotyping wikipedia , lookup
DNA supercoil wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genome editing wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
History of genetic engineering wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Point mutation wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Helitron (biology) wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genetics Jeopardy Mendelian Exceptions to Mendel Inheritance Genetic Disorders Gene Expression Diagrams $100 $100 $100 $100 $100 $200 $200 $200 $200 $200 $300 $300 $300 $300 $300 $400 $400 $400 $400 $400 $500 $500 $500 $500 $500 Final Jeopardy 1 - $100 The allele that is not expressed in a heterozygous individual. What is recessive? 1 - $200 The phenotypic ratio from a cross between two F1 (heterozygous) individuals. What is 3:1 (dominant:recessive) 1 - $300 Mendel’s law of inheritance that states that an individual has an equal chance of inheriting a dominant allele or a recessive allele from a heterozygous parent. What is the law of segregation? 1 - $400 The genotype of the unknown individual in a test cross if at least one the offspring from the cross displays the recessive phenotype. What is heterozygous? 1 - $500 The phenotypic ratio from a cross between a fruit fly with a grey body and red eyes (genotype BbPp) and a fly with a black body and purple eyes (genotype bbpp) if the genes are on different chromosomes (not linked). What is 25% grey/red, 25% grey/purple, 25% black/red, 25% back/purple? 2 - $100 A cross between a red snapdragon and a white snapdragon produces pink snapdragons. What is incomplete dominance? 2 - $200 A person with blood type A and person with blood type B have a child with blood type AB. What is codominance? 2 - $300 The reason why phenotypes for traits like height, skin color, and intelligence vary continuously. What is polygenic inheritance? 2 - $400 A cross between a red-eyed male fruit fly and a white-eyed female fruit fly produces half redeyed flies and half white-eyed flies. But all the red-eyed flies are female and all the white-eyed flies are male. What is sex (or X) linkage. 2 - $500 Females must inherit two copies of baldness allele to be bald while males only need to inherit one copy to be bald (baldness is not sex-linked). What is sex-influenced trait? 3 - $100 Any chromosomal syndrome caused by the inheritance of one extra chromosome. What is trisomy? 3 - $200 A heritable condition that results in mental retardation due to the build of the amino acid phenylalanine in the brain. Can be controlled by avoiding phenylalanine in the diet. What is phenylketonuria? 3 - $300 The allele of a disorder when the affected individual inherits it from unaffected parents. What is recessive? 3 - $400 The probability that a female carrier for hemophilia and a normal male will have a child with hemophilia. What is 25% 3 - $500 The genotype of individual II-2 on the red-green colorblindness pedigree below (colorblindness is sex linked recessive) What is XRXr (or heterozygous or a carrier)? 4 - $100 Used viruses made up of radioactive phosphorus and sulfur to determine that DNA, and not protein, is the genetic material. Who are Hershey and Chase? 4 - $200 The name of the group of enzymes responsible for adding free nucleotides to a DNA template strand during DNA replication or transcription. What are polymerases? 4 - $300 The mRNA sequence that transcription would produce from the DNA strand: GATTACA What is CUAAUGU? 4 - $400 The two types of mutations that produce frameshifts. What are insertions and deletions? 4 - $500 The recognition sequence of the restriction enzyme Eco R1 that produced the following restriction fragments: Original Strand: GAATTGGAGAATTCGATTGAATTC Treated Strand: GAATTGGAG AATTCGTTG AATTC What is GAATTC, cutting between G and A? 5 - $100 What is a Down Syndrome (or Trisomy 21) karyotype? 5 - $200 What is DNA replication? 5 - $300 What is nondisjunction (during meiosis I)? 5 - $400 What is the law of independent assortment? 5 - $500 What is an autosomal recessive pedigree? Final Jeopardy The amino acid sequence produced by the following DNA sequence with the additional information. GATCTATTATACCCCGGGGTGCATTGCA Promoter region is TTA Intron at GGGG What is MET – GLY – THR?