* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Lecture 1 Human Genetics
Designer baby wikipedia , lookup
Pharmacogenomics wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Epigenetics of human development wikipedia , lookup
X-inactivation wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Group selection wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genomic imprinting wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Skewed X-inactivation wikipedia , lookup
Genome (book) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Koinophilia wikipedia , lookup
History of genetic engineering wikipedia , lookup
Human leukocyte antigen wikipedia , lookup
SNP genotyping wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Frameshift mutation wikipedia , lookup
Microsatellite wikipedia , lookup
Polymorphism (biology) wikipedia , lookup
Human genetic variation wikipedia , lookup
Point mutation wikipedia , lookup
Dominance (genetics) wikipedia , lookup
Hardy–Weinberg principle wikipedia , lookup
Genetic drift wikipedia , lookup
Great Dane x Mexican Chihuahua F1 Big (Great Danes) 3 Big : 1 Small The Genius of Mendel • Highly inbred strains of peas • Differed by single character Round x Wrinkled (WT x mutant) F1 All Round F2 5474 Round 1850 Wrinkled 2.96:1 (3:1) Needs Statistics Mapping in Drosophila Ly Sb br + + + Lots of variation in people There must be a genetic component How do we assign “traits” to genes? Ultimately want a molecular description Start with inherited diseases Pedigrees……Mendel’s First Law Autosomal Dominant Disorder Autosomal Recessive Disease is apparent because of consanguinity (III 5 &6) Population Genetics Science of Intraspecific Variation Phenotypic GENOTYPIC • Genotypic Variation: Alleles, Polymorphism – Ultimate Source of Variation: Mutation • Dynamics of Variation during Population History – Changes in Allele Frequencies due to • Drift • Selection – Persistence of Allele Combinations due to Linkage • Linkage Disequilibrium Some Basics 1 1. Only refer to one strand, and don’t confuse strands with alleles GATCACA Allele 1 = TGTAATC GATTACA TGTGATC GATTACA Allele 2 Allele 2 TGTGATC GATCACA Allele 1 TGTAATC 2. Context is unimportant (unless we have linkage…next) AGACAGAAAGGAAAAGAACCTTCCATTTTTGGCTGTGCCAAGAAGCTCAGAAAGG ATACATTGTG AGACAGAAAGGAAAAGAACCTTCCATTTTTGGCTGTGCCAAGAAGCTCAGAAAGG T C GATAATATAAAAAATATATAGTTAATTGGGAATTGAATTTACAAA GATAATATAAAAAATATATAGTTAATTGGGAATTGAATTTACAAA ATACATTGTG Allele 1: T Allele 2: C Some Basics 2 3. Because mutations are rare events, the vast majority of variation is BINARY, at the base pair level. Allele 1 T Allele 2 C CAAAGGAAAAGAATGCCTTCCATTTTTGGCTGTGCCAAGAAGCTCAGAAAGG CAAAGGAAAAGAATGCCTTCCATTTTTGGCTGTGCCAAGAAGCTCAGAAAGG GATAATATAAAAAATATATAGTTAATTGGGAATTGAATTTACAAAATACATT GATAATATAAAAAATATATAGTTAATTGGGAATTGAATTTACAAAATACATT 4. Linkage makes things more complicated but only if you actually care about linkage: Linkage equilibrium/disequilibrium. Haplotype 1 2 alleles 2 alleles 2 alleles C T A C A A C G CTTCC[1396bp]GAAGCTCAGAAAGG GAAAGGAAAAGAAGATTT G GATAATATAAAAAATAT[2502bp]TTGGGAATTTACA AATAC Haplotype 2 CTTCC[1396bp]GAAGCTCAGAAAGG GAAAGGAAAAGAAGATTT GATAATATAAAAAATAT[2502bp]TTGGGAATTTACA AATAC Haplotype 3 GAAAGGAAAAGAAGATTT CTTCC[1396bp]GAAGCTCAGAAAGG GATAATATAAAAAATAT[2502bp]TTGGGAATTTACA AATAC Some Basics 3 5. Alleles have frequencies in the population (which sum to 1) Frequency of Allele 1 (T) = 0.59 p = 0.59 Frequency of Allele 2 (C) = 0.41 frequency of major allele 6. We’ll be talking about diploids, and genotype probabilities (which sum to 1) can be calculated from allele frequencies. (And vice versa; and under certain assumptions) Prob. of having: T,T T,C C,C 0.35 0.48 0.17 p2 2pq q2 What about two different genes? Consider two genes A and B that each have two alleles Aa Bb Allelic frequencies are 0.5 (At the “A” locus A=0.5, a= 0.5) (At the “B” locus B=0.5 and b=0.5) For A and a genotype frequencies = p2 +2pq +q2 AA , Aa and aa individuals = 0.25 + 0.5 + 0.25 The same for BB, Bb and bb How many AA BB individuals are (0.25 x 0.25) aa Bb individuals are (0.25 x 0.50) Both genes are in “equilibrium”. (Hardy and Weinberg) Hardy Weinberg is the Population Equivalent of the Punnett Square A a A AA Aa a Aa aa (p + q)2 = p2 +2pq + q2 Mutation Rate per Generation How often per generation does this happen? 1 generation Average Mutation Rates in Mammals Point substitution (nuc) 0.5 x 10-8 per base pair Microdeletion (1-10bp) ~10-9 per base pair Microinsertion (1-10bp) ~0.5 x 10-9 per base pair Mobile element ins’n Inversion ~10-11 ?? much rarer Exceptions Hypermutable sites (CpGs) C->T = 10x avg point rate Simple Sequence Repeats 10-1000x indel rate (some 10-4!) mitochondrial DNA 10-100x nuclear point rate Haploid Human Genome is ~2 x 109 base pairs Most of the DNA is non-coding Introns, Intragenic regions, LINES, SINES etc AT the DNA level, can have tremendous variation ath no phenotypic consequenses Remember the LacI gene (the repressor) Nonsense mutations at every codon Substitute every AA at every position White means no phenotype Lesson….most mutations in coding regions are silent Drift vs. Selection The two forces that determine the fate of alleles in a population • Drift – Change in allele frequencies due to sampling • Selection – Change in allele frequencies due to function Genetic Drift This is like 107 independent populations Gen 0 For every bottle: after eggs hatch pick 8 male larvae and 8 female larvae, stick in a new bottle. Repeat for 19 generations. Gen 19 Genetic Drift: Size Matters 4 populations 2 at N=25 2 at N=250 From Li (1997) Molecular Evolution, Sinauer Press Selection & Fitness “Absolute Fitness” = “Viability” = # of survivors / total # progeny produced = P(survival until mean reproductive age) If Fitness depends on Genotype, then we have (natural) Selection Selection vs Drift Recap From the perspective of disease severity: Given a particular selection coefficient (picture severity of disease), selection is only effective in a population whose size is large enough to overcome the effect of drift. From the perspective of population size: Given a particular population size, only alleles that bear a large enough selection coefficient (picture severity of disease) will be strongly selected against. Linkage disequilibrium: the big (and oversimplified) picture A new mutation! (on the "red" chromosome) Eager geneticist obtains samples from multiple affected individuals • Small number (maybe one) of ancestral disease-causing mutations • Isolation of chromosome bearing disease-causing mutation • "Reasonable" opportunity for recombination during population history • (Think Finland: 1000 founders 2000 years ago; consistent expansion) • Few (maybe none) reoccurrences of disease-causing mutation LD and time: history at work Do we care about: The age of the mutation or the age of the founding population? Two common types of DNA variants DNA haplotype • Haplotype = a series of marker alleles on a chromosome (DNA molecule) • E.g.: DNA sequence, a series of SNPs or microsatellites along a chromosome.