* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download lecture05_09
Transcription factor wikipedia , lookup
Designer baby wikipedia , lookup
Gene expression profiling wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Microevolution wikipedia , lookup
Transposable element wikipedia , lookup
Genome evolution wikipedia , lookup
Primary transcript wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Pathogenomics wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Non-coding DNA wikipedia , lookup
Human genome wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Point mutation wikipedia , lookup
Microsatellite wikipedia , lookup
Metagenomics wikipedia , lookup
Genome editing wikipedia , lookup
Computational phylogenetics wikipedia , lookup
Helitron (biology) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Smith–Waterman algorithm wikipedia , lookup
From Pairwise to Multiple Alignment WHATS TODAY? • Multiple Sequence Alignment- CLUSTAL • MOTIF search Multiple Sequence Alignment MSA VTISCTGSSSNIGAG-NHVKWYQQLPG VTISCTGTSSNIGS--ITVNWYQQLPG LRLSCSSSGFIFSS--YAMYWVRQAPG LSLTCTVSGTSFDD--YYSTWVRQPPG PEVTCVVVDVSHEDPQVKFNWYVDG-ATLVCLISDFYPGA--VTVAWKADS-AALGCLVKDYFPEP--VTVSWNSG--VSLTCLVKGFYPSD--IAVEWWSNG-- Like pairwise alignment BUT compare n sequences instead of 2 Rows represent individual sequences Columns represent ‘same’ position Gaps allowed in all sequences How to find the best MSA GTCGTAGTCGGCTCGAC GTCTAGCGAGCGTGAT GCGAAGAGGCGAGC GCCGTCGCGTCGTAAC GTCGTAGTCG-GC-TCGAC GTC-TAG-CGAGCGT-GAT GC-GAAG-AG-GCG-AG-C GCCGTCG-CG-TCGTA-AC Score : 4/4 =1 , 3/4 =0.75 , 2/4=0.5 , 1/4= 0 1*1 2*0.75 11*0.5 Score=8 4*1 11*0.75 2*0.5 Score=13.25 Alignment of 3 sequences: Complexity: length A length B length C Aligning 100 proteins, 1000 amino acids each Complexity: 10300 table cells Calculation time: beyond the big bang! Feasible Approach Progressive alignment (Feng & Doolittle). • Based on pairwise alignment scores – Build n by n table of pairwise scores • Align similar sequences first – After alignment, consider as single sequence – Continue aligning with further sequences – For n sequences, there are n(n-1)/2 pairs GTCGTAGTCG-GC-TCGAC GTC-TAG-CGAGCGT-GAT GC-GAAG-AG-GCG-AG-C GCCGTCG-CG-TCGTA-AC 1 2 3 4 GTCGTAGTCG-GC-TCGAC GTC-TAG-CGAGCGT-GAT GC-GAAGAGGCG-AGC GCCGTCGCGTCGTAAC 1 2 3 4 GTCGTA-GTCG-GC-TCGAC GTC-TA-G-CGAGCGT-GAT G-C-GAAGA-G-GCG-AG-C G-CCGTCGC-G-TCGTAA-C CLUSTAL method Applies Progressive Sequence Alignment • Higgins and Sharp 1988 – ref: CLUSTAL: a package for performing multiple sequence alignment on a microcomputer. Gene, 73, 237–244. [Medline] An approximation strategy (heuristic algorithm) yields a possible alignment, but not necessarily the best one Treating Gaps in CLUSTAL • Penalty for opening gaps and additional penalty for extending the gap • Gaps found in initial alignment remain fixed • New gaps are introduced as more sequences are added (decreased penalty if gap exists) Other MSA Approaches • Progressive approach CLUSTALW (CLUSTALX) PILEUP T-COFFEE • Iterative approach: Repeatedly realign subsets of sequences. MultAlin, DiAlign. • Statistical Methods: Hidden Markov Models (only for proteins) SAM2K, MUSCLE • Genetic algorithm SAGA Links to commonly used MSA tools CLUSTALW http://www.ebi.ac.uk/Tools/clustalw2/ T-COFFEE http://www.ebi.ac.uk/t-coffee/ MUSCLE http://www.ebi.ac.uk/muscle/ MAFFT http://www.ebi.ac.uk/mafft/ Kalign http://www.ebi.ac.uk/kalign/ CAUTION !!! Different tools may give different results Example : 7 different alignment tools produced 6 different Estimated evolution trees Wong et al., Science 319, January 2008 Motifs • Motifs represent a short common sequence – Regulatory motifs (TF binding sites) – Functional site in proteins (DNA binding motif) DNA Regulatory Motifs • Transcription Factors bind to regulatory motifs – TF binding motifs are usually 6 – 20 nucleotides long – Usually located near target gene, mostly upstream the transcription start site Transcription Start Site MCM1 SBF MCM1 motif SBF motif Gene X Why are motifs interesting? • A motif is evidence of binding • A motif can help in developing hypotheses regarding which protein is regulating the expression of a specific genes • Mutations at particular regulatory sites can lead to disease Challenges • How to recognize a regulatory motif? • Can we identify new occurrences of known motifs in genome sequences? • Can we discover new motifs within upstream sequences of genes? E. Coli promoter sequences 1. Motif Representation • Exact motif: CGGATATA • Consensus: represent only deterministic nucleotides. – Example: HAP1 binding sites in 5 sequences. • consensus motif: CGGNNNTANCGG • N stands for any nucleotide. • Representing only consensus loses information. How can this be avoided? CGGATATACCGG CGGTGATAGCGG CGGTACTAACGG CGGCGGTAACGG CGGCCCTAACGG -----------CGGNNNTANCGG Representing the motif as a profile Transcription start site -35 -10 TTGACA 3 4 5 6 0.1 0.1 0.7 0.7 0.1 0.2 0.5 0.2 0.2 0.5 0.2 0.2 0.1 0.1 0.5 0.1 0.1 0.2 0.1 0.1 0.2 0.2 0.5 1 A T G C 2 TATAAT -35 0.1 A T G C 1 2 3 4 0.1 0.7 0.2 0.6 0.5 0.1 0.7 0.1 0.5 0.2 0.2 0.8 0.1 0.1 0.1 0.1 0.1 0.0 0.1 0.1 0.2 0.1 0.1 0.1 -10 5 6 Based on ~450 known promoters PSPM – Position Specific Probability Matrix • Represents a motif of length k (5) • Count the number of occurrence of each nucleotide in each position 1 2 3 4 5 A 10 25 5 70 60 C 30 25 80 10 15 T 50 25 5 10 5 G 10 25 10 10 20 PSPM – Position Specific Probability Matrix • Defines Pi{A,C,G,T} for i={1,..,k}. – Pi (A) – frequency of nucleotide A in position i. 1 2 3 4 5 A 0.1 0.25 0.05 0.7 0.6 C 0.3 0.25 0.8 0.1 0.15 T 0.5 0.25 0.05 0.1 0.05 G 0.1 0.25 0.1 0.1 0.2 Identification of Known Motifs within Genomic Sequences • Motivation: – identification of new genes controlled by the same TF. – Infer the function of these genes. – Enable better understanding of the regulation mechanism. PSPM – Position Specific Probability Matrix • Each k-mer is assigned a probability. – Example: P(TCCAG)=0.5*0.25*0.8*0.7*0.2 1 2 3 4 5 A 0.1 0.25 0.05 0.7 0.6 C 0.3 0.25 0.8 0.1 0.15 T 0.5 0.25 0.05 0.1 0.05 G 0.1 0.25 0.1 0.1 0.2 Detecting a Known Motif within a Sequence using PSPM • The PSPM is moved along the query sequence. • At each position the sub-sequence is scored for a match to the PSPM. 1 2 3 • Example: A 0.1 0.25 0.05 sequence = ATGCAAGTCT… 4 5 0.7 0.6 C 0.3 0.25 0.8 0.1 0.15 T 0.5 0.25 0.05 0.1 0.05 G 0.1 0.25 0.1 0.1 0.2 Detecting a Known Motif within a Sequence using PSPM • The PSPM is moved along the query sequence. • At each position the sub-sequence is scored for a match to the PSPM. 1 2 3 • Example: A 0.1 0.25 0.05 sequence = ATGCAAGTCT… C 0.3 0.25 0.8 • Position 1: ATGCA 0.1*0.25*0.1*0.1*0.6=1.5*10-4 4 5 0.7 0.6 0.1 0.15 T 0.5 0.25 0.05 0.1 0.05 G 0.1 0.25 0.1 0.1 0.2 Detecting a Known Motif within a Sequence using PSPM • The PSPM is moved along the query sequence. • At each position the sub-sequence is scored for a match to the PSPM. 1 2 3 • Example: A 0.1 0.25 0.05 sequence = ATGCAAGTCT… C 0.3 0.25 0.8 • Position 1: ATGCA 0.1*0.25*0.1*0.1*0.6=1.5*10-4 • Position 2: TGCAA 0.5*0.25*0.8*0.7*0.6=0.042 4 5 0.7 0.6 0.1 0.15 T 0.5 0.25 0.05 0.1 0.05 G 0.1 0.25 0.1 0.1 0.2 Detecting a Known Motif within a Sequence using PSSM Is it a random match, or is it indeed an occurrence of the motif? PSPM -> PSSM (Probability Specific Scoring Matrix) – odds score : Oi(n) where n {A,C,G,T} for i={1,..,k} – defined as Pi(n)/P(n), where P(n) is background frequency. Oi(n) increases => higher odds that n at position i is part of a real motif. PSSM as Odds Score Matrix • Assumption: the background frequency of each nucleotide is 0.25. 1 2 3 4 1. Original PSPM (Pi): A 0.1 0.25 0.05 0.7 2. Odds Matrix (Oi): A 5 0.6 1 2 3 4 5 0.4 1 0.2 2.8 2.4 3. Going to log scale we get an additive score, Log odds Matrix (log2Oi): A 1 2 3 4 5 -1.322 0 -2.322 1.485 1.263 Calculating using Log Odds Matrix • Odds 0 implies random match; Odds > 0 implies real match (?). • Example: sequence = ATGCAAGTCT… 1 2 • Position 1: ATGCA -1.32+0-1.32-1.32+1.26=-2.7 odds= 2-2.7=0.15 • Position 2: TGCAA 1+0+1.68+1.48+1.26 =5.42 odds=25.42=42.8 3 4 5 A -1.32 0 -2.32 1.48 1.26 C 0.26 0 1.68 -1.32 -0.74 T 1 0 -2.32 -1.32 -2.32 G -1.32 0 -1.32 -1.32 -0.32 Calculating the probability of a Match ATGCAAG • Position 1 ATGCA = 0.15 Calculating the probability of a Match ATGCAAG • Position 1 ATGCA = 0.15 • Position 2 TGCAA = 42.3 Calculating the probability of a Match ATGCAAG • Position 1 ATGCA = 0.15 • Position 2 TGCAA = 42.3 • Position 3 GCAAG = 0.18 Calculating the probability of a match ATGCAAG • Position 1 ATGCA = 0.15 • Position 2 TGCAA = 42.3 • Position 3 GCAAG = 0.18 P (i) = S / (∑ S) Example 0.15 /(.15+42.8+.18)=0.003 P (1)= 0.003 P (2)= 0.993 P (3) =0.004 Building a PSSM for short motifs • Collect all known sequences that bind a certain TF. • Align all sequences (using multiple sequence alignment). • Compute the frequency of each nucleotide in each position (PSPM). • Incorporate background frequency for each nucleotide (PSSM). Graphical Representation – Sequence Logo • Horizontal axis: position of the base in the sequence. • Vertical axis: amount of information (bits). • Letter stack: order indicates importance. • Letter height: indicates frequency. • Consensus can be read across the top of the letter columns. WebLogo - Input • http://weblogo.berkeley.edu WebLogo - Output Genes: Proteins: Finding new Motifs • We are given a group of genes, which presumably contain a common regulatory motif. • We know nothing of the TF that binds to the putative motif. • The problem: discover the motif. Motif Discovery Motif Discovery Example Predicting the cAMP Receptor Protein (CRP) binding site motif Extract experimentally defined CRP Binding Sites GGATAACAATTTCACA AGTGTGTGAGCGGATAACAA AAGGTGTGAGTTAGCTCACTCCCC TGTGATCTCTGTTACATAG ACGTGCGAGGATGAGAACACA ATGTGTGTGCTCGGTTTAGTTCACC TGTGACACAGTGCAAACGCG CCTGACGGAGTTCACA AATTGTGAGTGTCTATAATCACG ATCGATTTGGAATATCCATCACA TGCAAAGGACGTCACGATTTGGG AGCTGGCGACCTGGGTCATG TGTGATGTGTATCGAACCGTGT ATTTATTTGAACCACATCGCA GGTGAGAGCCATCACAG GAGTGTGTAAGCTGTGCCACG TTTATTCCATGTCACGAGTGT TGTTATACACATCACTAGTG AAACGTGCTCCCACTCGCA TGTGATTCGATTCACA Create a Multiple Sequence Alignment GGATAACAATTTCACA TGTGAGCGGATAACAA TGTGAGTTAGCTCACT TGTGATCTCTGTTACA CGAGGATGAGAACACA CTCGGTTTAGTTCACC TGTGACACAGTGCAAA CCTGACGGAGTTCACA AGTGTCTATAATCACG TGGAATATCCATCACA TGCAAAGGACGTCACG GGCGACCTGGGTCATG TGTGATGTGTATCGAA TTTGAACCACATCGCA GGTGAGAGCCATCACA TGTAAGCTGTGCCACG TTTATTCCATGTCACG TGTTATACACATCACT CGTGCTCCCACTCGCA TGTGATTCGATTCACA Generate a PSSM XXXXXTGTGAXXXXAXTCACAXXXXXXX XXXXXACACTXXXXTXGATGTXXXXXXX PROBLEMS… • When searching for a motif in a genome using PSSM or other methods – the motif is usually found all over the place ->The motif is considered real if found in the vicinity of a gene. • Checking experimentally for the binding sites of a specific TF (location analysis) – the sites that bind the motif are in some cases similar to the PSSM and sometimes not! Computational Methods • This problem has received a lot of attention from CS people. • Methods include: – Probabilistic methods – hidden Markov models (HMMs), expectation maximization (EM), Gibbs sampling, etc. – Enumeration methods – problematic for inexact motifs of length k>10. … • Current status: Problem is still open. Tools on the Web • MEME – Multiple EM for Motif Elicitation. http://meme.sdsc.edu/meme/website/ • metaMEME- Uses HMM method http://meme.sdsc.edu/meme • MAST-Motif Alignment and Search Tool http://meme.sdsc.edu/meme • TRANSFAC - database of eukaryotic cis-acting regulatory DNA elements and trans-acting factors. http://transfac.gbf.de/TRANSFAC/ • eMotif - allows to scan, make and search for motifs at the protein level. http://motif.stanford.edu/emotif/