* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download codes for amino acids
Epigenetics of neurodegenerative diseases wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Oncogenomics wikipedia , lookup
Genomic imprinting wikipedia , lookup
Genome evolution wikipedia , lookup
Neuronal ceroid lipofuscinosis wikipedia , lookup
X-inactivation wikipedia , lookup
Genetic engineering wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
History of genetic engineering wikipedia , lookup
Copy-number variation wikipedia , lookup
Point mutation wikipedia , lookup
Genome (book) wikipedia , lookup
Gene expression programming wikipedia , lookup
Helitron (biology) wikipedia , lookup
Gene desert wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Gene therapy wikipedia , lookup
Gene nomenclature wikipedia , lookup
Gene expression profiling wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Microevolution wikipedia , lookup
A gene is composed of two parts: ON OFF regulatory coding region region (codes for amino acids) (on/off switch) Transcription factors turn genes on and off. Transcription factors are proteins that bind to a specific base sequence in DNA. …AGCCTACCAAAAAAGGTTCCACG… …TCGGATGGTTTTTTCCAAGGTGC… - Some transcription factors are activators: They turn genes ON. regulatory coding region region (codes for amino acids) (on/off switch) - Some transcription factors are activators: They turn genes ON. - Some transcription factors are repressors: They turn genes OFF. regulatory coding region region (codes for amino acids) (on/off switch) Concepts 1. What is a mutant? 2. How is hereditary information passed on from one generation to the next? What are the rules? 3. The same rules apply to all plants and animals. Normal Fly White Eyes Mutant Dark Body Mutant Tiny Wing Mutant Wings Held-Out Mutant A mutant is different than “normal”. The mutant characteristic is passed on to the next generation. Fruit Flies normal wing mutant normal wing mutant Genes are the basic units of inheritance. Plants and animals have two copies of every gene. Mom and dad each pass on only one copy of every gene to their children. Genes can be working (“good”) or broken (“bad”). One “good” copy of a gene is all that is needed to be normal. A mutant has two “bad” copies of a gene. x normal (has 2 good copies of wing gene) parents: +/+ offspring: normal (has 2 good copies of wing gene) x +/+ +/+ Each offspring gets one copy of the gene from each parent. All offspring are normal. x wingless mutant (has 2 bad copies of wing gene) parents: wingless mutant (has 2 bad copies of wing gene) -/- x offspring: -/- -/- Each offspring gets one copy of the gene from each parent. All offspring have 2 bad copies of wing gene. All offspring are wingless. x normal (has 2 good copies of wing gene) parents: mutant (has 2 bad copies of wing gene) +/+ offspring: x -/- +/- All offspring look normal because they only need one good copy of the wing gene. All offspring are “carriers” for a mutant copy of the wing gene. x carrier offspring: x +/- +/- -/+ +/+/+ These flies look normal because they only need one good copy of the wing gene. carrier -/- These flies have no wings because they have two bad copies of the wing gene. Cells Communicate with Each Other Through Signals and Receptors Cells Communicate with Each Other Through Signals and Receptors Some signals are secreted and can travel several cells away. Cells Communicate with Each Other Through Signals and Receptors Some signals are tethered and can only influence adjacent cells. Cells Communicate with Each Other Through Signals and Receptors Receptors sense signals and become activated. Activated receptors act to alter gene expression. A Morphogen is a Developmentally Important Type of Secreted Signal Morphogens have the following characteristics: 1. They are synthesized in some but not all cells. 2. They diffuse from the site of synthesis and are less concentrated the farther away from the source of synthesis. 3. Cells respond to different morphogen concentrations by activating expression of distinct sets of genes. Morphogens The dpp gene promotes skin development. In dpp mutants, skin is replaced by nervous system. The dpp gene is normally expressed in cells that will form skin. What would happen if the dpp gene was misexpressed in cells that would normally form the nervous system? Misexpression Experiment Normal embryo Dorsal Ventral Misexpression of dpp converts cells that would normally form nervous system into skin. The ag gene promotes stamen development stamen petal normal ag mutant In ag mutants, stamens are replaced by petals. The ag gene is normally expressed in stamens normal ag mutant What would happen if the ag gene was misexpressed in cells that would normally form petals? Misexpression Experiment normal ag mutant ag misexpression Misexpression of ag causes cells that would normally form petals to form stamens.