* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Chapter 17 Recombinant DNA and Biotechnology
Maurice Wilkins wikipedia , lookup
Gene regulatory network wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Promoter (genetics) wikipedia , lookup
List of types of proteins wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Gene expression wikipedia , lookup
Molecular evolution wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Point mutation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
DNA supercoil wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Silencer (genetics) wikipedia , lookup
DNA vaccination wikipedia , lookup
Non-coding DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Community fingerprinting wikipedia , lookup
Molecular cloning wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Recombinant DNA & Biotechnology Recombinant DNA • recombinant DNA molecules contain DNA from different organisms – any two DNAs are joined by DNA ligase 5’GGATCATGTA-OH 3’CCTAGTACAT-P P-CCCGATTTCAAT HO-GGGCTAAAGTTA DNA ligase 5’GGATCATGTACCCGATTTCAAT 3’CCTAGTACATGGGCTAAAGTTA figure 17-01.jpg restriction enzymes degrade invading viral DNA Figure 16.1 Cleaving and Rejoining DNA • RE produce many different DNA fragments restriction enzymes recognize specific DNA sequences (recognition sites) EcoRI 5’GGATCGAATTCCCGATTTCAAT 3’CCTAGCTTAAGGGCTAAAGTTA a palindrome reads the same left-to-right in the top strand and right-to-left in the bottom strand staggered cuts produce “sticky ends” Figure 16.4 Cutting and Rejoining DNA • restriction enzymes (RE) produce specific DNA fragments for ligation – RE are defensive weapons against viruses – RE “cut” (hydrolyze) DNA at specific sites – RE “staggered cuts” produce “sticky ends” – sticky ends make ligation more efficient gel electrophoresis Figure 16.2 Cleaving and Rejoining DNA • RE produce many different DNA fragments – for a 6 bp recognition site 1/46 = 1/4096 x 3x109 bp/genome = 7.3 x105 different DNA fragments • gel electrophoresis sorts DNA fragments by size • hybridization with a labeled probe locates specific DNA fragments Southern hybridization of a labeled probe to a DNA target Figure 16.3 gel electrophoresis & Southern hybridization Cloning Genes • genetic engineering requires lots of DNA – cloning produces lots of exact copies – DNA clones are replicated by host cells – DNA is cloned in a DNA vector – a DNA vector has an origin of replication (ori) that the host cell recognizes pBR322 is a historical bacterial cloning plasmid a Yeast Artificial Chromosome vector has yeast ori, centromere and telomeres Agrobacterium Ti plasmid has an Agrobacterium ori and T DNA that integrates into plant DNA Figure 16.5 Cloning Genes • a DNA vector with its ligated insert must be introduced into the host cell • chemical treatment makes cells “competent” - ready for heat shock transformation • electroporation opens pores in the plasma membrane • mechanical treatment inserts DNA physically Cloning Genes • vectors carry reporter genes – antibiotic resistance protects host cells that carry a vector (selection) – proteins such as -galactosidase, luciferase or Green Fluorescent Protein (GFP) identify transformed cells (screening) bacterial plasmid pBR322 is a cloning vector that encodes ampicillin & tetracycline antibiotic resistances insertion of a target DNA inactivates tetracycline resistance Figure 16.6 ligating vector to insert ~4300 bp; 0.1 µg; 1.7 x 1011 molecules each cut + with the same RE 900 bp; 0.063 µg; 5.7 x 1010 molecules DNA ligase ligation/transformation • ligation of vector to insert produces several products – vector ligated to itself (recircularized) – insert ligated to itself (circularized, no ori) – two vectors ligated together – two (or more) inserts ligated together – several DNAs ligated together, but not circularized – 1 vector ligated to 1 insert DNA ligation/transformation • transformation is a very inefficient process 1µg typical plasmid vector = 3 x 1011 copies added to highly competent E. coli cells yields at best 109 antibiotic resistant colonies 3 x 1011/109 = 300 vectors/transformed E. coli ligation/transformation • ligation produces a mess of products • transformation is an inefficient random process • selection (antibiotic) sorts out successful vector transformations • screening identifies transformants with the insert in the vector 8.5 x 107 cells are plated 37 form colonies 24 contain vectors with inserts bacterial transformation has several potential outcomes Figure 16.6 creation of a DNA library in host bacteria using a plasmid vector Figure 16.7 Sources of DNA for Cloning • chromosomal DNA restriction fragments – ligated to vectors cut with the same RE – transferred into bacteria = a genomic DNA library • a target DNA is identified by hybridization reverse transcription produces DNA from an RNA template Figure 16.8 Sources of Genes for Cloning • mRNAs reverse transcribed into cDNAs – tissue-specific; age specific; treatment vs. normal, etc. cDNAs – ligated to vectors – grown in host cells and screened by hybridization Sources of Genes for Cloning • make DNA sequences synthetically – custom oligonucleotides duplicate natural sequences or create mutant sequences • site-directed mutagenesis makes an exact change (mutation) in a cloned gene What to do With a Cloned (Altered?) Gene • compare gene expression in two cell types – a “gene chip” (microarray) displays short synthetic oligonucleotides – mRNAs from two different sources are labeled differently – mRNAs bind to their complements – a scanner detects mRNA binding by one cell type, the other, or both microarray analysis compares gene expression in two different samples Figure 16.10 What to do With a Cloned (Altered?) Gene • mutational analysis – classical genetics found mutations and studied their effects – cloning technology causes mutations and studies their effects • “knockout” mutations insertion of an inactivated gene by homologous recombination Figure 16.9 What to do With a Cloned (Altered?) Gene • RNA interference (RNAi) produces a “knockdown” phenotype – a gene transcribed “backwards” makes an antisense transcript • antisense transcript + normal mRNA = double-stranded RNA – small interfering RNA (siRNA) forms double-stranded RNA with normal mRNA – some viruses inject double-stranded RNA What to do With a Cloned (Altered?) Gene • eukaryotic cells attack d.s. RNA – enzymes “cut” d.s. RNA into 21-23 nt siRNAs (“dicer”) – siRNAs guide enzymes to cut target RNAs (“slicer”) – siRNAs guide RNA dependent RNA polymerase to make more d.s. RNA – [miRNAs control developmental gene expression] siRNA is used to silence gene expression Figure 16.11 What to do With a Cloned (Altered?) Gene • search for “invisible” interactions – two hybrid systems identify a receptor’s ligand • split a transcription activator into DNAbinding and activating domains • fuse receptor to DNA-binding domain • fuse cDNA library to activating domain • activate a reporter gene when receptor and ligand bind a two-hybrid system detects binding proteins Figure 16.12 What to do With a Cloned (Altered?) Gene • make the protein… – a cloning vector tells the cell to replicate it (with an ori) – an expression vector tells a cell to efficiently transcribe and translate a gene in it an expression vector instructs a host cell to make a protein Figure 16.13 tissue plasminogen activator is a clot buster Figure 16.14 Table 16.1 What to do With a Cloned (Altered?) Gene • medically useful proteins have been expressed • plant biotechnology speeds up crop improvement – endogenous insecticides – herbicide resistance – improved nutrition – stress tolerance • “biotech” animals serve as bioreactors to produce useful proteins “somatic cell nuclear transfer” with engineered cells makes a sheep that produces a useful protein CSI • Short Tandem Repeats (STRs) are used to identify individuals by “DNA Fingerprinting” – many sets of STRs exist in the human genome – the lengths of STR markers differs for different individuals – different-sized STR markers run differently on agarose gels DNA fingerprint analysis using an STR marker Figure 16.17 Figure 16.18