* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Basic DNA
Comparative genomic hybridization wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Genetic code wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Silencer (genetics) wikipedia , lookup
List of types of proteins wikipedia , lookup
Genome evolution wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Community fingerprinting wikipedia , lookup
Biochemistry wikipedia , lookup
Genomic library wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Molecular cloning wikipedia , lookup
Point mutation wikipedia , lookup
DNA supercoil wikipedia , lookup
Biosynthesis wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Molecular evolution wikipedia , lookup
Non-coding DNA wikipedia , lookup
Deoxyribozyme wikipedia , lookup
DNA’s Function DNA • DNA = deoxyribonucleic acid. • DNA carries the genetic information in the cell – i.e. it carries the instructions for making all the structures and materials the body needs to function. • DNA is capable of self-replication. • Most of the cell’s DNA is carried in the nucleus – a small amount is contained in the mitochondria. Wellcome Images – Oliver Burston The structure of DNA • The shape of the molecule is described as a “double helix”. • The building blocks of DNA are nucleotides. • A nucleotide consists of one phosphate molecule, a five-sided sugar molecule (deoxyribose sugar), and one nitrogen base. DNA - the double helix Wellcome Images – Peter Artymiuk Wellcome Images – Oliver Burston The structure of the double helix Wellcome Images - Pete Jeffs The ladder model • The structure of DNA can be understood more easily by untwisting the double helix and displaying the molecule as if it were a ladder. • The side rails of the ladder (the “backbone”) are alternating phosphate and sugar molecules. The rungs are paired nitrogen base molecules held together by a hydrogen bond. The “ladder” model Backbone Base pair Nucleotide NIH - National Human Genome Research Institute The base pairing rule • Each “rung” of the DNA ladder is formed from two nitrogen bases. • There are four bases – adenine (A), thymine (T), cytosine (C), and guanine (G). • The base adenine always bonds with thymine (A-T), and cytosine always bonds with guanine (C-G). The base pairs The binding of two nucleotides forms a base pair. In DNA, cytosine and guanine are bound together by 3 hydrogen bonds, whereas adenine and thymine are bound by 2 hydrogen bonds. NIH - National Human Genome Research Institute Location of DNA • Most of the DNA occurs in the cell nucleus; however, each mitochondrion contains 37 genes – this is referred to as mitochondrial DNA. The function of DNA Genes • A chromosome consists of segments of DNA known as genes. • Genes contain the instructions for the construction of a particular protein, or RNA. • It is estimated that there are about 20,000–25,000 genes in the human genome (i.e. about 3 billion base pairs). Introns and exons • Genes consist of introns and exons • Exons are sections of coding DNA – i.e. they contain instructions for making proteins. • Introns are sections of non-coding DNA (once called "junk DNA") – i.e. they do not contain instructions for making proteins but are now believed to serve other important functions. The genetic code • The sequence of bases in a gene is a code instructing the cell how to construct a particular protein – i.e. the number of amino acids and the order in which they are to be assembled. Reading the code • The sequence of bases is read in groups of three called codons. • Thus the sequence: AAGCCGTTTAGAGAGATTCCT Is read as: AAG CCG TTT AGA GAG ATT CCT • Each codon represents one of the 20 different amino acids. How DNA works National Human Genome Research Institute - NIH Proteins are long chains of amino acids Cys Glu A M K Pro Cys Glu His Met Phe His The sequence of bases in a gene is a code instructing the cell how to construct a particular protein – i.e. the number of amino acids and the order in which they are to be assembled.