* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Answers to Biotech Jeopardy
Gene regulatory network wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Gel electrophoresis wikipedia , lookup
Non-coding DNA wikipedia , lookup
Molecular cloning wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Restriction enzyme wikipedia , lookup
Gene therapy wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Molecular evolution wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
List of types of proteins wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Answers to Biotech Jeopardy Biotechnology Test Review Questions: Easy Small, circular piece of bacterial DNA is called a ____. Give two examples of vectors: The entire collection of genes within human cells is called the _______________. Difference between technology and biotechnology? Function of restriction enzymes? HGP stands for? How many base pairs in HG? How many proteins? Difference between surrogate and biological mother? A _____________ is caused by a defective or mutant gene. Define gene. The first cell created by sexual reproduction is called a • Biotechnology Test Review Questions: • Easy • Small, circular piece of bacterial DNA is called a ____. • Give two examples of vectors: • The entire collection of genes within human cells is called the _______________. • Difference between technology and biotechnology? • Function of restriction enzymes? • HGP stands for? How many base pairs in HG? How many proteins? • Difference between surrogate and biological mother? • A _____________ is caused by a defective or mutant gene. • Define gene. • The first cell created by sexual reproduction is called a Medium 1. Inserting unrelated pieces of DNA together will result in ____________________. 2. IVF stands for? What is a synonym used for IVF? 3. What does transgenic mean? 4. Identical twins are considered to be genetic ___________. 5. How does IVF work? What does the female have to do? What does the male have to do? 6. Why does IVF sometimes result in twins, triplets, or quads? 7. Difference between fraternal vs. identical twins? 8. How does Gel Electrophoresis separate DNA fragments? 9. What is an example of a genetic disease? 10. What kind of ethical questions arise from IVF? • Medium • 1. Inserting unrelated pieces of DNA together will result in ____________________. • 2. IVF stands for? What is a synonym used for IVF? • 3. What does transgenic mean? • 4. Identical twins are considered to be genetic ___________. • 5. How does IVF work? What does the female have to do? What does the male have to do? • 6. Why does IVF sometimes result in twins, triplets, or quads? • 7. Difference between fraternal vs. identical twins? • 8. How does Gel Electrophoresis separate DNA fragments? • 9. What is an example of a genetic disease? • 10. What kind of ethical questions arise from IVF? • Disease Huntington’s disease, sickle cell anemia, cystic fibrosis • Ethical questions – Will anyone be harmed? – What will be done with the extra embryos? – Who will pay the cost? – Do all involved parties agree? – Is it safe for the mother and embryo? Difficult What is the difference between gene therapy and genetic engineering? Difference between a hybrid and chimera? Steps of genetic engineering? The Hind R1 restriction enzyme is used to slice DNA at the GAATTC between the G and C. Illustrate how this enzyme would precisely cut the fragment: ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT What research can be done using gel electrophoresis? • Difficult • What is the difference between gene therapy and genetic engineering? • Difference between a hybrid and chimera? • Steps of genetic engineering? • The Hind R1 restriction enzyme is used to slice DNA at the GAATTC between the G and C. Illustrate how this enzyme would precisely cut the fragment: • ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA • TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT • What research can be done using gel electrophoresis? • Hybrid has DNA from 2 organism in each cell • Chimera has cells from different organisms in the body