* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Slide 1
Nucleic acid analogue wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genetic code wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
SNP genotyping wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Whole genome sequencing wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Heritability of IQ wikipedia , lookup
History of genetic engineering wikipedia , lookup
Hardy–Weinberg principle wikipedia , lookup
Human genome wikipedia , lookup
Polymorphism (biology) wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Designer baby wikipedia , lookup
Non-coding DNA wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Genome evolution wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Oncogenomics wikipedia , lookup
Dominance (genetics) wikipedia , lookup
Koinophilia wikipedia , lookup
Genetic drift wikipedia , lookup
Microsatellite wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Human genetic variation wikipedia , lookup
Population genetics wikipedia , lookup
Frameshift mutation wikipedia , lookup
Topic 11. Lecture 17. Variation and mutation
Variation within natural populations
All populations are genetically and phenotypically variable, but to very different extent. To
describe complex variation, we need to subdivide genotypes and phenotypes into traits.
This procedure requires care and common sense and strongly depends on the nature of
variation (see Basic Concepts). Traits can be of three kinds:
1) Unordered traits, such that there is no structure in their states.
Two states can only be identical or different. The most important
example is a nucleotide site, which can accept 4 states - A, T, G, C one cannot usually say that A is more similar to T than to G. Many
loci are unordered traits, if we all their alleles are equally different
from each other.
2) Quantitative traits, such that their states are numbers and, thus,
can be ordered. Such traits are common when phenotypes are
considered - think of body weight (continuous) or the number of
vertebrae (discrete). However, quantitative traits can also characterize
genotypes - for example, it often makes sense to consider the fraction
of nucleotides G and C within a segment of the genome - body size.
3) Complex traits (a garbage bin class), such that overall body shape.
Here we consider variation with natural populations without really
trying to understand why we observe what we observe - this will be
done later.
atagc
attgc
atggc
atcgc
Variation at the level of genotypes
Qualitatively, differences between (haploid) genotypes are of the following kinds:
I. Small-scale (point) differences (polymorphisms):
i) single-nucleotide substitutions or SNPs (red),
ii) insertions (blue),
iii) deletions (blue),
iv) complex (green).
II Large-scale differences:
i) deletions (purple),
ii) duplications,
iii) inversions,
iv) complex.
Relative frequencies of genetic differences are to a large extent dictated by mutation. Smallscale differences are ~1000 times more common than large-scale differences (although the
total number of nucleotides affected by large-scale differences may be higher).
For each single-nucleotide substitution that distinguishes two genotypes, there are ~0.1
indels (together), 0.01 complex differences, and 0.001 large-scale differences.
atcgatcatacgcatgtagttctagctagctagct-acgatcacacgctccgatgtcatcgaagtc
atcgatgatacgcatgtggttctag-tagctagctgcacgatc------------------aagtc
Small-scale genetic differences. The fundamental quantitative measure of genetic variation
is nucleotide diversity (virtual heterozygosity) H, the probability that in two alleles, randomly
drawn from the population, a nucleotide site is occupied by different nucleotides (ignoring
gaps).
Some representative values of H:
mammals:
Homo sapiens H = 0.001; Mus musculus H = 0.01.
ascidian:
Ciona savignyi H = 0.08
fruit flies:
Ciona savignyi holds the world
Drosophila melanogaster H = 0.01; D. mulleri H = 0.03. record in H among animals. Highly
variable populations are ideal to
worms:
study natural selection - so C.
Caenorhabditis elegans H = 0.01 C remanei H = 0.05. savignyi may be the next Drosophila.
ciliates
Paramecium aurelia H = 0.3 (hard to believe!) Mol. Biol. and Evol. 23, 2474-2479, 2006.
different prokaryotes
H = 0.01-0.1. (Ne = 1,000,000, only!).
H is mostly determined by per nucleotide mutation rate and effective population size.
Species with high H have "effectively large" populations. We will soon learn why this is so
However, H does not tell us the whole
story: the same value of H can be due
to:
1) a large number of rare alleles
or
2) a small number of common alleles
Thus, we need also to specify the
distribution of allele frequencies. Here
the general pattern is simple: most of
derived alleles are rare. Moreover, if we
compare actual distributions to those
expected under no selection, we
observe an excess of very rare alleles.
This excess is larger when functional
nucleotide sites are considered (and is
mostly due to negative selection).
Right: Distribution of allele (nucleotide)
frequencies in Arabidopsis thaliana.
PLoS Biology 3, 1289-1299, 2005.
1)
cacacgcgatgactc
catacacgatgactc
catacgcgatgtctc
catacgcgatgacac
2)
cacacgcgatgactc
cacacacgatgtctc
catacacgatgtctc
catacgcgatgactc
Frequencies of individual alleles also do not tell us the whole story. Indeed, distributions of
alleles of different loci (states of different traits) can dependent on each other.
Independent joint distribution of alleles at several loci means that the frequency of a
genotype is equal to the product of frequencies of its constituent alleles. A convenient
measure of non-independence of distributions of alleles is the coefficient of association (or
of linkage disequilibrium - a horrible term!):
d = [AB] [ab] - [Ab] [aB]
independence
dependence
Here, the mode of reproduction makes a big difference. In asexual populations alleles of
even distant loci are strongly associated with each other (e. g., A appears only with B, and a
only with b - this is known as clonal population structure). As the result, d is maximal.
In contrast, in sexual populations only alleles at tightly linked loci are associated, and for
pairs of more distant loci d is very close to 0. More specifically, in humans d ~0 when the
distance between nucleotide sites D is >50,000 (Africans) or >100,000 (non-Africans). In
Drosophila melanogaster, d ~0 when D > 1000, and in D. mulleri: d ~0 when D >300. Thus, in
species with high H, d disappears at shorter distances - there is a reason for this!
If individuals are sexual diploids, maternal and paternal alleles are usually distributed more
or less independently (Hardy-Weinberg law), with an occasional excess of homozygotes.
Joint distribution of alleles at two variable traits, A and B, within an apomictic
population, with derived alleles shown by capital letters, together with a sample
from phylogeny (genealogy) of genotypes within the population. If each derived
allele currently present within the population appeared due to a unique mutation,
joint distribution of traits A and B is hierarchical (left). However, homoplasy can
create all four possible genotypes and, thus, a conflict (right).
Joint distribution of alleles at two variable traits, A and B, within an amphimictic
outcrossed population, with derived alleles shown by capital letters, together with
a sample from phylogenies (genealogies) of genotype segments within the
population. Genealogies of traits A and B are independent, due to recombination
between them. Thus, all four possible genotypes can appear without homoplasy.
Large-scale genetic differences. Such differences were discovered by
Dobzhansky and Sturtevant in 1938, who observed long polymorphic inversions
in Drosophila polythene chromosomes using light microscope. Only recently, it
became technically possible to study large-scale genetic differences in species
without such chromosomes. They turned out to be quite common.
A typical human is heterozygous for ~50 deletions larger than 5,000 nucleotides
each, totaling ~750 kb of sequence (Nature Genetics 38, 75 - 81, 2006).
A total of 1,447 copy number variable regions (CNVRs), which can encompass
overlapping or adjacent gains or losses, covering 360 megabases (12% of the
genome) were identified in 270 humans from four populations with ancestry in
Europe, Africa or Asia. These CNVRs contained hundreds of genes, disease loci,
functional elements and segmental duplications. Notably, the CNVRs
encompassed more nucleotide content per genome than SNPs (Nature 444, 444454, 2006).
The excess of rare derived alleles in large-scale variation is even more
pronounced than in small-scale variation.
The chromosomal locations of 1,447 CNVRs are indicated by lines to either side of
ideograms. Green lines denote CNVRs associated with segmental duplications;
blue lines denote CNVRs not associated with segmental duplications. The length
of right-hand side lines represents the size of each CNVR. The length of left-hand
side lines indicates the frequency that a CNVR is detected.
Variation at the level of phenotypes
It makes sense to distinguish two kinds of phenotypic variation:
1) phenotypic variation that directly reflects genetic variation (monogenic traits),
2) phenotypic variation with complex inheritance (polygenic traits).
Monogenic traits are relatively rare and often drastic.
i) Recessive lethals. In a variety of animals, it has been found that an individual carries 1-3
heterozygous recessive lethals.
Mutant and normal phenotypes for Lucania goodei.
The embryo on top has as bulbous head with
beady eyes. The embryo on the bottom left is a
pinhead with bulbous ventricles. The embryo on
the bottom right is wild type.
All the observed recessive lethals in vertebrates
cause gross morphological defects.
Recessive visible alleles are ~10 less common than
recessive lethal alleles.
Variation of proteins can be studied by gel electrophoresis. This method, rarely used these
days, played a major role in investigation of variation. Individual genetic differences often
can be seen in electrophoregramms.
Why do we see an extra band between those that correspond to homozygotes in
heterozygotes at TDH and MDH loci? Because the corresponding proteins are dimers.
Monogenic polymorphism in Asclepias syriaca, common milkweed.
Monogenic polymorphism with
multiple alleles in ladybug
Harmonia axyridis.
In humans, monogenic polymorphisms include blood groups, the ability to roll tong, the
ability to taste phenylthiocarbamide, and a large number of rare, pathological variants
responsible for Mendelian diseases.
Anyway, 1:1 correspondence between genetic and phenotypic variation is not very common.
Polygenic traits are those whose variation is affected by variation in more than one
genetical trait. Often, the environment also affects variation in polygenic traits. It is possible
that a particular phenotypic trait is polygenic in a more variable population and monogenic
in a less variable population. Polygenic traits can be of 3 kinds:
1) Discrete traits:
Podarcis melisellensis is a lizard with an obvious polymorphism in the colouration of
abdomen and throat: adult males are orange, yellow or white; females are yellow or white.
These colours can be found in different populations, but the frequency of the 3 morphs
varies.
2) Quantitative traits:
Many quantitative traits have Gaussian or normal distribution, such that the probability
density of individuals with trait value x is (where m is the mean value of the trait and s is its
standard deviation):
Genetic variation underlying variation in quantitative tratis can invlove many variable
quantitative trait loci (QTLs), but some of them may be of particular importance.
In tomato, one QTL, fw2.2, was responsible for a large step in the increase in fruit size in
the course of domestication. When transformed into large-fruited cultivars, a cosmid
derived from the fw2.2 region of a small-fruited wild species reduced fruit size drastically.
The cause of the QTL effect is a single gene, ORFX, that is expressed early in floral
development, controls carpel cell number, and has a sequence suggesting structural
similarity to the human oncogene c-H-ras p21 (Science 289, 85-88, 2000).
3) Complex traits:
Guppies (Poecilia reticulata) show extreme variation in the color patterns of males. The
picture shows three females from a natural population in Trinidad (middle panel), and six
males from the same population (left and right panels). Each male is essentially unique in
his color pattern, and this variation is almost entirely genetically based.
Complex polymorphism in Vipera seoanei.
The spectacular color polymorphism in the Hawaiian Happy-face spider Theridon grallator.
This is possibly an adaptation to confuse predators, such as birds, by preventing them from
establishing a reliable feeding pattern.
Concluding remarks about within-population variation:
1) All populations are variable to some extent, at all levels,
2) Traits and their states responsible for variation come in many different kinds,
3) Genetic variation is ultimately produced by mutation and evaluated by
selection,
4) The action of selection upon genetic variation is the key mechanism of
Darwinian evolution, and will be treated separately.
Mutation - the first factor of Microevolution
Mutation, together with selection, is one of only two factors that are absolutely
necessary for Darwinian evolution.
What is mutation, mechanistically? - A set of processes that generate mutations,
changes of genotypes. There are two such processes:
1) DNA replication, due to errors in it
2) DNA repair, due to errors in it
DNA replication struggles to be as precise as physically feasible.
The difference between a mutation and a damage must be clearly understood damages violate integrity of DNA, mutations change its sequence.
Struggle for fidelity of DNA replication - proofreading 3'-exonuclease activity. Binding of
nucleotides has error of c. 10−4, due to
extremely short-lived imino and enol tautomery.
However, the lesion rate in DNA is only 10−9.
This increased accuracy is due to the fact that
DNA polymerase can chew back mismatched
pairs to a clean 3′ end using its built-in 3′→5′
'proof-reading' exonuclease activity. This
activity, which cannot be perfectly selective,
sometimes removes ~50% of correctly attached
nucleotide, so that fidelity is definitely involved
with cost.
Some common DNA
damages. In each
human cell, every day,
many thousands of
"spontaneous" DNA
damages occur - and all
of them must be
repaired. No wonder,
that some of these
damages are repaired
inprecisely, producing
mutations.
In multicellular organisms, the timing of a mutation affects the number of mutants.
Germline mutations occuring in a diploid multicellular male.
(left) A mutation that occurred late will be present only in one or a small number of
gametes, and will result a single mutant offspring (singleton).
(center) A mutation that occurred earlier will be present in many gametes and will
result in several mutant offspring (cluster).
(right) A damage that affected only one DNA strand in the gamete can be
transmitted unrepaired to the zygote and lead to a mutation in half of cells in the
offspring.
Why do mutations happen?
1. "Everything consistng of parts crumbles ..." (Buddha, ~2400 years ago).
"Mutations are accidents, and accidents will happen" (Alfred Sturtevant, 1938).
2. Alternatively, mutation can be an adaptation, that enables organisms to
occasionally produce improve offspring.
To some extent, Buddha and Sturtevant are certainly right: laws of molecular
physics do not allow perfect fidelity of DNA handling. If an organism would try to
reduce its mutation rate to zero, the cost, in terms of both time and energy, of DNA
handling, would approach infinity. We will consider evolution of mutation later.
Kinds of mutations
A simple mutation consists of replacing a sequence segment of length k with another
segment of length n.
The most common cases (the same as variation - not surprising, as mutation produces it) 1) Single-nucleotide substitutions (k = n = 1).
(AAAGAAA > AAATAAA). A majority of all mutations belong to this class. Substitutions of a
purine with a purine and, thus, of a pyrimidine with a pyrimidine, if the opposite DNA strand
is considered (AAAGAAA > AAAAAAA; AAACAAA > AAATAAA), are called transitions, and
purine > pyrimidine (AAAGAAA > AAATAAA) and pyrimidine > purine (AAATAAA >
AAACAAA) substitutions are called transversion. Transitions are usually 2-3 times more
common than transversions.
2) deletions (n = 0) (AAAGAAA > AAAAAA).
3) insertions (k = 0) (AAAAAA > AAATTAAA). Very often, insertions are duplications
(ACGTGA > ACGTGTGA).
4) complex events (both k and n are larger than 1) they constitute less than 1% of all mutations.
This limits evolution.
Very occasionally, really complex mutations, referred to as closely spaced
multiple mutations (CSMMs) occur:
Three extreme CSMMs. Barred sequences denote deleted nucleotides whereas
nucleotides substitutions are indicated below the wild-type sequence. Exonic
sequence is denoted by upper case letters, whereas intronic sequence is shown
in lower case. The dash in the sequence of mutation B with a ‘‘g’’ below is
indicative of the insertion of a single guanine in the mutant allele (Human
Mutation 30, 1435, 2009).
Still, single-nucleotide substitutions, and short deletions or insertions constitute
~99% of all mutations, which constrains the course of evolution.
A lot of data on mutation come from patients suffering from Mendelian diseases.
Example: summary of mutations that cause Werner syndrome
Here, SNP = benign
single-nucleotide
substitution, and
deletion/insertion =
complex event.
Werner syndrome (OMIM catalog # 277700) is an autosomal recessive human
genetic instability syndrome whose phenotype mimics premature aging - patients
appear to age rapidly after puberty, and are at increased risk of developing
clinically important, age-dependent diseases such as cancer, atherosclerotic
cardiovascular disease, diabetes mellitus and osteoporosis. Werner syndrome
appears in individuals whose genotypes carry two inactive alleles of the WRN
protein, which is a DNA helicase.
How mutation, acting alone, affects the population?
Considering mutation alone is not very realistic: mutation is a rather slow force,
so we cannot ignore other forces - selection and drift. Still, this analysis is needed
for understanding more complex models. The following dynamical equation
connects allele frequencies in successive generation:
[A]t+1 = [A](1 - m) + n(1-[A])
In order to find equilibria, we substitute [A], instead of [A]t+1, into this equation. As
the result, a dynamical equation is converted into an algebraic equation:
[A] = [A](1 - m) + n(1-[A])
and solve it for [A]. The only solution, [A]eq, is given by:
[A]eq = n/(m+n)
Thus, if mutation acts alone, the equilibrium frequency of allele A is equal to the
ratio of the mutation rate towards this allele over the sum all mutation rates. It is
easy to show that this equilibrium is (globally) stable.
What is the equilibrium frequency of a?
Qualitative view on
the dynamics of two
alleles under
mutation.
In fact, this dynamical system can be investigated completely and explicitly. The
frequency of A slowly approaches its equilibrium value in the following way
[A](t) = n/(m+n) + ([A]0- n/(m+n))exp{-(m+n)(t-t0)}, if ([A]0 < n/(m+n))
[A](t) = n/(m+n) - ([A]0- n/(m+n))exp{-(m+n)(t-t0)}, if ([A]0 > n/(m+n))
You do not need to remember this formula.
Methods of measuring mutation
Every direct measurement of mutation must involve comparing a descendent with its
ancestors. The number of generations which separate them can vary from 1 to very many.
Mutations must be recorded at some level - from DNA sequences to fitness. Estimates of
mutation rates should ideally be expressed as per nucleotide site probabilities of events of
different kinds (substitutions, deletions, etc.). From these, we can get expected genomic
numbers of mutations: T = 2Gm.
Number of generations that separates ancestors and descendents
1, parent-offspring
comparisons
10-1000, mutationaccumulation
experiments
Very many,
accumulation of
mutations in evolution
DNA sequence
Microsatellites
C. elegans,
D. melanogaster
Homo-Pan
Phenotype
Human Mendelian
diseases
Vm
Level at which mutations
are detected:
Fitness
Drosophila,
Mukai et al.
If the total number of generations that
separate modern humans and chimpanzees
is K, and the fraction of differences between
their selectively neutral sequences is p, the
estimate of mutation rate is, approximately
m = p/K
Mutation-accumulation experiments
work in essentially the same way, but
on a much shorter time scale.
Data on mutation rates
Species
Method
Estimate - normal:
Results
Per nucleotide, if not
stated otherwise
Neel et al.,
1986
Homo sapiens
1 generation, electrophoresis
1.8 x 10-5 per protein
Nachman & Crowell,
2000
Homo sapiens
Many generations (HomoPan)
2.2 x 10-8
Kondrashov,
2003
Homo sapiens
1 (or few) generations
Mendelian phenotypes
1.8 x 10-8
Denver & Lynch, 2004
C. elegans
300 generations,
direct sequencing
2.0 x 10-8
10-5 - mitochondria
Mukai 1964, 1972
D. melanogaster
100 generations, fitness
1 per genome
Keightley et al.,
2007
D. melanogaster
100 generations,
direct sequencing
0.8x10-8
Homo sapiens
1 generation (sperm),
direct sequencing
10-2 - 10-4 per "locus"
Estimate - hot-spots:
Jeffreys et al., 2002
nonCpG
transversions
CpG
transitions
CpG
transversions
indels
Rates of human
mutations, observed in
patients these days
0.53
15.4
1.5
0.10
Human-chimpanzee
divergence of
pseudogenes
0.46
13.3
3.7
0.19
Comparison of instant vs. long-term estimates of human mutation rates.
A finer point: mutation rate is not uniform alone the genome
Apparently, per nucleotide
rates of mutations of
different kinds are not
uniform across the human
genome, and rates of
mutaitons of different kinds
vary, along the genome, in
a correlated way.
A finer point: mutation rate at a site can strongly depend on its context
Hypermutability of 5'CpG3' dinucleotides in mammalian genomes, due to
methylation of cytosine residues, within such contexts.
The methylated cytosine may be converted to thymine by accidental
deamination. The cytosine to thymine change can be corrected only by the
mismatch repair which is very inefficient.
As a result, C>T transition rate if ~15 times higher for C's that are within CpG
contexts, than for C's that are outside CpG contexts.
Thus, mammalian genomes are strongly depleted of CpG dinucleotides - in noncoding DNA, such dinucleotides constitute only ~1% of all dinucleotides, instead
of ~6% (1/16) expected.
However, coding exons contain a much higher fraction of CpG dinucleotides. As a
result, a large fraction of human pathogenic missense and nonsense mutations
(~40%) occur within CpG's, mostly those that encode arginine.
Key points about mutation:
In multicellular eukaryotes, per nucleotide per generation total mutation rate is
~10-8.
The total per genome mutation rate is, thus, >1 (flies and worms) and even >100
(mammals), and, apparently, at least ~1 bad mutation occurs each generation.
Thus, negative selection must be constantly at work.
In prokaryotes and unicellular eukaryotes, genomic per replication mutation rate
is <<1. However, it is not clear what is generation in these organisms.
Quiz:
Question 1: suppose that we want to design a coding sequence that mutates slowly, and,
thus, lacks CpG's. Can we do this, for an arbitrary encoded amino acid sequence?
Hint: what is the minimal and the maximal number of CpG dinucleotides in a coding
sequence that encodes a pentapeptide Met Ala His Gly Arg?
Question 2: can we say that coding sequences are designed in such a way that their rate of
mutation is as low as possible?
Question 3: do you think that evolution should try to produce sequences with the minimal
mutation rate and, generally, to reduce the mutation rate as much as possible?
Hint: nobody knows the exact answer to this – so just express you own thoughts.