* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download No Slide Title
Agarose gel electrophoresis wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
List of types of proteins wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Genome evolution wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Restriction enzyme wikipedia , lookup
DNA supercoil wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Community fingerprinting wikipedia , lookup
Molecular evolution wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
DNA vaccination wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Non-coding DNA wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
The nucleus contains the chromosomes. Cells have many parts including the nucleus Plants are made of cells DNA is two strings of ”bases " Designated “A,” “C,” “G,” or “T” A gene is part of a chromosome and is made of DNA How much DNA is in cells? Species Genome Size (Mbp) Wheat Maize Soybean Tomato 16,000 2,500 1,115 1,000 Rice Arabidopsis Mouse Human 425 120 3,000 3,000 Genetic Information Processing in a Cell DNA Promoter Exon 1 Intron Exon 2 Trans.Term. Transcription Primary RNA Transcript Exon 1 Intron Exon 2 Processing Functional mRNA Exon 1 AUG Exon 2 AAAAAAAAAAAAAAAAA Stop Translation Protein Folding, Targeting, Decorating DNA Structure: Double Stranded, A always bonds to T, G bonds to C. Chains have polarity, 5’ and 3’ refers to positions on sugar. DNA sequence is always written in the 5’ to 3’ direction. 5’ P03-0-C -0-P02-0-C -0-P02-0-C 0 0 0 0 .. T ... C ... T A G C H0- 0 C-0-P02-0- G 0 C-0-P02-0- C-0-P02-0- C 0 3’ -0H A .. 0 3’ -0-P02-0-C = Deoxyribose, in sugar-phosphate backbone A = Adenine, G = Guanine, T = Thymine, C = Cytosine 0 C-0-P03 5’ Recognition sequences of some restriction enzymes Enzyme HindIII Recognition Site 5’-AA-G-C-T-T- 3’ 3’-T-T-C-G-AA- 5’ Type of End 5’ Phosphate extension BamHI 5’-GG-A-T-C-C- 3’ 5’ Phosphate 3’-C-C-T-A-GG- 5’ extension PstI 5’ -C-T-G-C-AG- 3’ 3’ -GA-C-G-T-C- 5’ 3’ hydroxyl extension Sau3aI* 5’-G-A-T-C-- 3’ 3’--C-T-A-G- 5’ 5’ Phosphate extension EcoRV* 5’-G-T-TA-A-C- 3’ 3’-C-A-AT-T-G- 5’ Blunt end * Enzyme won’t cut if methylated. How often do they cut? In theory, ‘4 cutter’ sites occur on average every 44 =256 nucleotides ‘6 cutter’ sites occur on average every 46 =4096 nucleotides They cut less frequently if the frequencies of the different bases is not equal, or if they are sensitive to cytosine or adenosine methylation. Restriction Fragments can be Separated by Gel Electrophoresis Discrete bands can be seen after restriction of DNA viruses, phage or plasmids but not organisms with big genomes. Lambda (48 Kb) Maize (2500Mb) 23 kb Stain UV light 9.4 kb 6.5 kb 4.0 kb 2.3 kb 2.0 kb + 0.5 kb Small fragments run faster Plasmid DNA Ligase can join DNA Fragments with compatible ends ---GGTCCTCAATGACCTC ---CCTGGAGTTACTGGAGCTAG AGCTTCTCGGAATCATGCATGC--AGAGCCTTAGTACGTACG--- BamHI end HindIII end No ligation ---GGTCCTCAATGACCTG ---CCTGGAGTTACTGGACCTAG BamHI end GATCCCTCGGAATCATGCATGC--GGAGCCTTAGTACGTACG--BamHI end ---GGTCCTCAATGACCTGGATCCCTCGGAATCATGCATGC-----CCTGGAGTTACTGGACCTAGGGAGCCTTAGTACGTACG--- ---GGTCCTCAATGACCTG ---CCTGGAGTTACTGGACCTAG BamHI end GATCTCTCGGAATCATGCATGC--AGAGCCTTAGTACGTACG--Sau3A end ---GGTCCTCAATGACCTGGATCTCTCGGAATCATGCATGC-----CCTGGAGTTACTGGACCTAGAGAGCCTTAGTACGTACG--- Main features of Plasmid Cloning Vectors e.g. pUC19 Polycloning site: AAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCA HindIII PstI XbaI BamHI KpnI EcoRI ß Galactosidase Intact ß Gal product cleaves X-gal substrate in media, to make a blue colony. palindromes 2.7 Kb Ori Amp = ampicillin resistance Amp growth on amp media forces the bacteria to maintain the plasmid. Ori = origin of DNA replication which also controls copy number. By inserting your sequences in a cloning vector with an Amp resistance gene you can force E. coli to grow your sequences by growing it on Amp media. Molecular Cloning: Cutting of DNA and ligating it into a cloning vector will allow you to propagate the fragment in some organism and subsequently purify it. Cut Plasmid Vector Cut source DNA Mix and Ligate Recombinant plasmid Transform E. coli How to select recombinant plasmids Nonrecombinant plasmid Recombinant plasmid After transformation of E. coli, only circular plasmids with a single copy of the vector sequences will replicate (ori needed). Only E. coli with a vector sequences can grow on the antibiotic. But, both recombinant and nonrecombinant plasmids will allow E. coli to grow. How to select recombinant plasmids, cont’ Nonrecombinant plasmids have intact ß-gal genes and make blue colonies when grown in media with Xgal. Blue colony (non-recombinant) White colony (recombinant) Recombinant plasmids make white colonies because the ß-gal gene is interrupted Making Restriction Site Maps: A 3 Kb HindIII fragment was cloned into the the HindIII site of the 2.7 Kb plasmid cloning vector pUC19 (polycloning site shown below). The fragment sizes following restriction digestion allows you to make a map. Cloning site Left Right CCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTG HindIII PstI XbaI BamHI KpnI EcoRI Fragment size data Enzyme Digest HindIII EcoRI KpnI PstI HindIII + PstI BamHI HindIII + BamHI BamHI + PstI Fragment sizes (in Kb) 3.0, 2.7 5.7 5.7 4.7, 1.0 2.7, 2.0, 1.0 3.9, 1.8 2.7, 1.8, 1.2 3.9, 1.0, 0.8 H From pUC19 Restriction Map B P HPBKE Bacteriophage Lambda can be used as a cloning vector Phage infects E. coli Phage Genome replicates Phage package their DNA, lyse cell and re-infect Phage makes coat proteins and packages it genome Advantages of cloning in Lambda: •Can clone > 20 Kb in replacement vectors •Transfection more efficient than transformation Different types of genomic cloning vectors Typical insert size Plasmid Insert Vector <1 to 10 Kb Lambda phage 10 to 23 Kb Cosmid 20 to 45 Kb A plasmid with site that enables it to be incorporated into phage particles. BAC <50 to 150 Kb Bacterial Artificial Chromosome (a very big plasmid) Yeast Artificial Chromosome 100 to 500 Kb Maintained as a chromosome in yeast Libraries of Genomic Clones A library is simply a collection of clones. Genomic clones are made from chromosomal DNA of some organism. A Genome Equivalent is the number of clones it would take for the size of the cloned fragments to equal the size of the genome of the organism. Fox example, consider a genome equivalent for maize, with a genome size of 2.5 X 109 bases, or 2, 500,000 Kb. Clone size Genome equivalent 5 Kb (e.g. plasmid) 20 Kb (e.g. Lambda) 100 Kb (e.g. BAC) 500,000 clones 125,000 clones 25,000 clones Libraries need to be bigger than a genome equivalent to have a good chance of containing any given sequence. To have a 95% chance of containing any given sequence a library needs to be three genome equivalents. Four genome equivalents should have a 99% chance. These calculations assume the cuts in the DNA occur randomly which is never the case when using restriction enzymes. Libraries of Genomic clones, cont’ Complete genomic libraries, of a specific size fragment, should not be made from complete enzyme digests. For example, if you want 20 Kb clones, Sau3a fragments are too small and EcoRI are usually too small or too big. 20 Kb S S SS E S E S S SSS E E SS SS S S S SSS S S S S S E E E E S S S SS SS S S SSS S S E Partial Sau3a digest fragments Digests of maize DNA for 15 min. with different amounts of Sau3a Increasing Sau3a conc. 20 Kb 2 Kb Screening libraries by bacterial colony hybridization. Plate transformed E coli, bacteria carrying clones form colonies* Transfer colonies to membrane Expose to X-ray film to identify colonies that hybridize to probe Lyse colonies with NaOH, neutralize, bake s.s DNA onto membrane Hybridize with labeled s.s.DNA probe, which will anneal to homologous sequences * Same approach works great with bacteriophage lambda plaques DNA Polymerase can be used to Radioactively Label DNA Step 1) Melt DNA into single strands. 5’ GTACGTCTGACTCGTTCATCTGCGCTTAGACTGCATGACGTAGCTGATCGCTGACAATTCGTAAT 3’ 3’ CATGCAGACTGAGCAAGTAGACGCGAATCTGACGTACTGCATCGACTAGCGACTGTTAAGCATTA 5’ 5’ GTACGTCTGACTCGTTCATCTGCGCTTAGACTGCATGACGTAGCTGATCGCTGACAATTCGTAAT 3’ 3’ CATGCAGACTGAGCAAGTAGACGCGAATCTGACGTACTGCATCGACTAGCGACTGTTAAGCATTA 5’ Step 2) Add small random primers. 5’ GTACGTCTGACTCGTTCATCTGCGCTTAGACTGCATGACGTAGCTGATCGCTGACAATTCGTAAT 3’ 3’ CTAGCG 5’ 3’ CATGCAGACTGAGCAAGTAGACGCGAATCTGACGTACTGCATCGACTAGCGACTGTTAAGCATTA 5’ 5’ TAGACT Labeling DNA with Polymerase, continued... Step 3) Extend new strand from template by incorporating A, T, G and labeled C 5’ GTACGTCTGACTCGTTCATCTGCGCTTAGACTGCATGACGTAGCTGATCGCTGACAATTCGTAAT 3’ CATGCAGACTGAGCAAGTAGACGCGAATCTGACGTACTGCATCGACTAGCG 5’ * * * * * * * * * * * 3’ CATGCAGACTGAGCAAGTAGACGCGAATCTGACGTACTGCATCGACTAGCGACTGTTAAGCATTA 5’ 5’ TAGACTGCATGACGTAGCTGATCGCTGACAATTCGTAAT * * * * * * * Step 4) Re-melt the double-stranded DNA and use to probe single stranded target DNA. Libraries can also be screened with immunological assays Steps: 1) Plate and transfer cells to membrane 2) Lyse cells and bind protein to membrane 3) Hybridize membrane to primary antibody, made from the protein you are interested in (e.g. in a rabbit) 4) Wash membrane and hybridize to secondary antibody (e.g. goat anti-rabbit) which is chemically linked to an enzyme (e.g. a peroxidase or phosphatase). 5) Wash membrane and apply substrate that is modified by enzyme to produce a colored compound right on the filter. Construction of cDNA libraries A cDNA library represents the transcribed sequences in the cells the library was made from. The content depends on the cell types used and the treatment of those cells before harvest. Why make a cDNA library instead of a genomic library? You may want your gene already processed with no promoter. e.g. for expression in another organism, or to compare to the genomic clone to document mRNA processing. Your gene may be in much higher frequencies in this library than a genomic library. You may be looking for genes that are turned on specifically in this cell type, or trying to demonstrate that your DNA sequence is transcribed. General process of making a cDNA library 1) purify polyadenylated RNA mRNA AAAAAAAAAAAAAAAAA 2) Make first strand DNA with poly-T primer, reverse transcriptase and dNTPs AAAAAAAAAAAAAAAAA TTTTTTTTT 3) Degrade RNA (chemically or enzymatically) TTTTTTTTT 1st strand DNA 4) Make second strand using DNA polymerase & dNTPs. DNA primer used varies with different protocols TTTTTTTTT AAAAAAAAA 5) Clone double stranded DNAs into cloning vector.