* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Polyploidy
Genetic engineering wikipedia , lookup
Copy-number variation wikipedia , lookup
Human genome wikipedia , lookup
Dominance (genetics) wikipedia , lookup
Frameshift mutation wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Gene desert wikipedia , lookup
Genomic library wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Oncogenomics wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
Ridge (biology) wikipedia , lookup
History of genetic engineering wikipedia , lookup
Gene expression profiling wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Minimal genome wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
DiGeorge syndrome wikipedia , lookup
Point mutation wikipedia , lookup
Designer baby wikipedia , lookup
Genomic imprinting wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Skewed X-inactivation wikipedia , lookup
Genome evolution wikipedia , lookup
Gene expression programming wikipedia , lookup
Segmental Duplication on the Human Y Chromosome wikipedia , lookup
Microevolution wikipedia , lookup
Genome (book) wikipedia , lookup
Y chromosome wikipedia , lookup
X-inactivation wikipedia , lookup
Polyploidy …more than two haploid sets of chromosomes are present, – – – – 2n = diploid, 3n = triploid, 4n = tetraploid, etc. Amphidiploid …double diploid, 2n1 + 2n2 …have balanced gametes of the type n1 + n2, these gametes fuse to make fertile 2n1 + 2n2. Allopolyploidy Applications B. oleracea (cabbage, cauliflower, Brocolli, kale, etc.) 2n = 18 n=9 B. n1napas + n2 =( 19 Oil rape, canola oil) 2n1 + 2n2 = 38 n = 10 B. campestris (turnip, turnip rape) 2n = 20 amphidiploid 4n x 2n = 3n? • The creation of triploids can be accomplished by crossing a tetraploid with a diploid, • Most triploid individuals are sterile. Generation of a Triploid Cells Meiosis in a Triploid Organism Why Wouldn’t this work? Environmental Applications? grass carp (Ctenopharyngodon idella) • Triploid grass carp prefer pondweeds, • do not prefer plants such as cattail, water lily, etc. Polyploidy Summary • More than 2 whole sets of chromosomes, • Autopolyploidy, – from the same genome, – naturally occurring, or induced, – often results in larger varieties, • Allopolyploidy, – from different genomes, – naturally occurring, or induced, – often results in larger varieties, • Autotriploids, – most often sterile – can produce beneficial traits. Monoploidy …a haploid of a diploid is monoploid, …has one chromosome set. Monoploid • male wasps, bees and ants have only 1 haploid genome, – males develop from unfertilized eggs, • gametes are formed by mitosis. Monoploid Applications • monoploid plants can be created by culturing pollen grains (n = 1), – the population of haploid organisms is then screened for favorable traits, – the plants are then treated with colchicine which generates a 2n plant homozygous for the favorable traits. Chromosomal Mutations – chromosome number, – structure, Chromosome Structure • Changes in chromosome structure can come about due to, deletions duplications rearrangements Chromosomal Deletions • a deletion results in a lost portion of a chromosome, Deletion Causative Agents heat, radiation, viruses, chemicals, errors in recombination. Terminal Deletions Off the End Intercalary Deletions From the Middle Intercalary Deletions From the Middle Recognizing Deletions Terminal Intercalary Homologous Pairs? Intercalary Hemizygous Terminal Hemizygous: gene is present in a single dose. Psuedodominance: hemizygous genes are expressed. Deletions …result in partial monosomy, remember monosomy: 2n, -1, …the organism is monosomic for the portion of the chromosome that is deleted, …as in monosomy, most segmental deletions are deleterious. Cri-du-chat Syndrome (46, -5p) 46, -5p ...terminal deletion of the small arm (petite arm) of chromosome 5, • Cri-du-chat Syndrome, – – – – 0.002% live births, anatomic mutations, often mental retardation, abnormal formation of vocal mechanisms. Chromosomal Duplication ...an event that results in the increase in the number of copies of a particular chromosomal region, Duplication Cause and Effect Causes: – duplications often result from unequal crossing over, – can occur via errors in replication during S-Phase. Effects: – results in gene redundancy, – produces phenotypic variation, – may provide an important source for genetic variability during evolution. Unequal Crossing Over Produces both duplications and deletions! Duplication Phenotypes Duplication in Evolution …essential genes do not tolerate mutation, …duplications of essential genes, then subsequent mutations, confers adaptive potential to the organism, …new gene family members are ‘recruited’ to perform new functions. flowering plant algae moss nutrients need uptake need uptake need uptake transport to other tissue transport to other tissue transport to seeds Arabidopsis Chromosome Structure • Changes in chromosome structure can come about due to, deletions duplications rearrangements Chromosomal Inversions …inversion: aberration in which a portion of the chromosome is turned around 180o. Paracentric Inversion ...an inversion in which the centomere is not included, A B C A B B A C ...a paracentric inversion does not change arm length ratio. Inversion Heterozygotes …an organism with one wild-type and one chromosome containing an inversion, A B C B A C …not heterozygous for the genes, heterozygous for the chromosomes. Inversion Loop no crossing over Paracentric Produces haploid gamete. Paracentric Produces gamete with inversion. Paracentric Produces a chromosome with two centromeres. Nonviable gametes. Dicentric ...a chromosome having two centromeres; Non-Viable (gametes) Segregate Dicentric/Ascentric …results only when the crossing over occurs within the region of the paracentric inversion, Paracentric No centromeres. Deletions. Nonviable gametes. Acentric …a chromosome having no centromeres, …segregates to daughter cells randomly, or is lost during cell division, …deletions impart partial monosomy. Paracentric Outcomes 1 Normal Gamete, 1 Inversion Gamete, No Crossover Classes Recombination is not inhibited, but recombinant gametes are selected against. Pericentric Inversion ...an inversion in which the centromere is included, A B C A C B ...a pericentric inversion results in a change in chromosome arm length. Pericentric Recombination and Inversions • Paracentric and Pericentric; – 1 Normal Gamete, – 1 Inverted Gamete, – No Crossover Classes = No Recombination, Inversions select against recombinant gametes, thus preserves co-segregation of specific alleles. Inversions and Evolution • Inversions ‘lock’ specific alleles together, – all offspring get their alleles from either a wildtype, or inverted chromosome, • If the ‘set of alleles’ is advantageous, the set can be maintained in the population. Assignment • Understand the differences between ‘Interference’, and the suppression of recombination resulting from inversions, • Be able to recognize data, and predict results given either case. Chapter 5 • Do all of the practice questions. Translocations …translocation: aberration associated with the transfer of a chromosomal segment to a new location in the genome. Terminal Translocation Reciprocal Translocation Translocation and Semi-Sterility …semi-sterility; a condition in which a proportion of all gametophytes (in plants) or zygotes (in animals) are inviable. • Up to 50% are inviable as a result of translocations. Robertsonian Translocations …the fusion of long arms of acrocentric chromosomes, Down Syndrome • 95% of Down Syndrome individuals are a result of Trisomy 21, – the probability of having a second Down Syndrome child is usually similar to the population at large, • However, there is second cause of Down Syndrome caused by a Robertsonian translocations that is heritable. Familial Down Syndrome Assignment • Do a Punnett Square or a Split Fork Diagram of, Parent 1: wild-type for Chromosomes 14, 21 x Parent 2: heterozygous for 14q;21q translocation. Hint gametes Assignment (think about these...) • Truncated Genes; – genes that are no longer full length, due to a mutation, • Gene Fusions; – genes that contain coding sequence from two different genes, resulting from a chromosomal mutation. Syntenic • Relationship of two or more loci found to be linked in one species; literally “on the same thread”. • Conserved Synteny: state in which the same two loci are found to be linked in several species. Cereals Conserved Synteny Description of DNA segments in which gene order is identical between species. Trinucleotide Repeat Expansions FMR1 Fragile X Mental Retardation 1 ...GCGCGGCGGTGACGGAGGCGCCGC TGCCAGGGGGCGTGCGGCAGCG... cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg …CTGGGCCTCGAAGCGCCCGCAGCCA cgg cgg cgg cgg ... cgg cgg cgg cgg > 200 Fragile Site Mutations Dosage Compensation • X chromosomes in females provide twice the genes, as in males, – Drosophila: female genes are expressed at 50% of the male levels, – Mammals: one X chromosome in females is silenced. Canadian Cat Scientists Sees it First Barr Body Lyon Hypothesis Mary Lyon; in humans, X chromosomes from father and mother are randomly inactivated. X Inactivation Barr Body The structure of the chromosome is altered. X-Linked Mosaicism Different cell lineages contribute to different body locations on the body. Epigenesis • A change in gene regulation brought about without a change in DNA sequence, – often to the structure of the chromosome, – or through modification of the nucleotide bases, – or through post transcriptional regulation. Chapter 5 Review • know genotypes and phenotypes, – – – – – – – trisomy, monosomy, inversions, duplications, deletions, polyploidy, dosage compensation. • be able to predict heritability, and recognize datasets and infer the condition. Monday • Reciprocal Translocations, • Mapping deletions, • Review • Work some problems.