Download Polyploidy

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Genetic engineering wikipedia, lookup

Hybrid (biology) wikipedia, lookup

Frameshift mutation wikipedia, lookup

Biology and consumer behaviour wikipedia, lookup

Genomic library wikipedia, lookup

NEDD9 wikipedia, lookup

Epistasis wikipedia, lookup

Mutagen wikipedia, lookup

Ridge (biology) wikipedia, lookup

Saethre–Chotzen syndrome wikipedia, lookup

Mutation wikipedia, lookup

Gene expression profiling wikipedia, lookup

History of genetic engineering wikipedia, lookup

Oncogenomics wikipedia, lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia, lookup

Minimal genome wikipedia, lookup

Artificial gene synthesis wikipedia, lookup

DiGeorge syndrome wikipedia, lookup

Gene wikipedia, lookup

Polycomb Group Proteins and Cancer wikipedia, lookup

Designer baby wikipedia, lookup

Genomic imprinting wikipedia, lookup

Epigenetics of human development wikipedia, lookup

Skewed X-inactivation wikipedia, lookup

Point mutation wikipedia, lookup

Gene expression programming wikipedia, lookup

Genome evolution wikipedia, lookup

Segmental Duplication on the Human Y Chromosome wikipedia, lookup

Meiosis wikipedia, lookup

Site-specific recombinase technology wikipedia, lookup

Microevolution wikipedia, lookup

Y chromosome wikipedia, lookup

Genome (book) wikipedia, lookup

Chromosome wikipedia, lookup

X-inactivation wikipedia, lookup

Neocentromere wikipedia, lookup

Karyotype wikipedia, lookup

Ploidy wikipedia, lookup

Polyploid wikipedia, lookup

Transcript
Polyploidy
…more than two haploid sets of chromosomes
are present,
–
–
–
–
2n = diploid,
3n = triploid,
4n = tetraploid,
etc.
Autopolyploidy
...polyploidy resulting from the replication of one or
more sets of chromosomes,
…the additional set of chromosomes is identical to
the normal haploid complement of that species.
Autopolyploidy
…can be induced by treating cells with the drug
colchicine,
 colchicine: is a alkaloid derivative from the
autumn crocus (Crocus veneris),
...inhibits microtubule polymerization, and thus inhibits
the separation of chromosomes during meiosis.
Colchicine Treatment
• cells undergo S-phase,
• no separation of chromosomes is accomplished,
• no cell division occurs,
• at telophase, the nuclear membrane reforms,
• treatment for one cell cycle leads to 4n cells.
Amphidiploid
…double diploid,
2n1 + 2n2
…have balanced gametes of the type n1 + n2,
these gametes fuse to make fertile 2n1 + 2n2.
Autopolyploidy Applications
• Treating a plant with colchicine often
produces autopolyploidy, resulting in plants
with larger flowers and/or fruit,
4n
2n
8n
2n
Allopolyploidy Applications
B. oleracea (cabbage, cauliflower, Brocolli, kale, etc.)
2n = 18
n=9
B.
n1napas
+ n2 =( 19
Oil rape, canola oil)
2n1 + 2n2 = 38
n = 10
B. campestris (turnip, turnip rape)
2n = 20
amphidiploid
4n x 2n = 3n?
• The creation of triploids can be
accomplished by crossing a tetraploid with
a diploid,
• Most triploid individuals are sterile.
Generation of a Triploid Cells
Meiosis in a Triploid Organism
Who’d want to Eat That?
• Bananas,
• Seedless Watermelon,
• Most other seedless varieties,
• Some oysters.
Environmental Applications?
grass carp
(Ctenopharyngodon idella)
• Triploid grass carp prefer pondweeds,
• do not prefer plants such as cattail, water lily, etc.
Polyploidy Summary
• More than 2 whole sets of chromosomes,
• Autopolyploidy,
– from the same genome,
– naturally occurring, or induced,
– often results in larger varieties,
• Allopolyploidy,
– from different genomes,
– naturally occurring, or induced,
– often results in larger varieties,
• Autotriploids,
– most often sterile
– can produce beneficial traits.
Monoploidy
…a haploid of a diploid is monoploid,
…has one chromosome set.
Monoploid
• male wasps, bees and ants have only 1
haploid genome,
– males develop from unfertilized eggs,
• gametes are formed by mitosis.
Monoploid Applications
• monoploid plants can be created by
culturing pollen grains (n = 1),
– the population of haploid organisms is then
screened for favorable traits,
– the plants are then treated with colchicine
which generates a 2n plant homozygous for the
favorable traits.
Chromosomal Mutations
– chromosome number,
– structure,
Chromosome Structure
• Changes in chromosome structure can come
about due to,
deletions
duplications
rearrangements
Chromosomal Deletions
• a deletion results in a lost portion of a
chromosome,
Deletion Causative Agents
heat,
radiation,
viruses,
chemicals,
errors in recombination.
Terminal Deletions
Off the End
Intercalary Deletions
From the Middle
Intercalary Deletions
From the Middle
Recognizing Deletions
Terminal
Intercalary
Homologous Pairs?
Intercalary
Hemizygous
Terminal
Hemizygous: gene is present in a single dose.
Psuedodominance: hemizygous genes are expressed.
Deletions
…result in partial monosomy,
 remember monosomy: 2n, -1,
…the organism is monosomic for the portion
of the chromosome that is deleted,
…as in monosomy, most segmental deletions
are deleterious.
Cri-du-chat Syndrome
(46, -5p)
46, -5p
...terminal deletion of the small arm
(petite arm) of chromosome 5,
• Cri-du-chat Syndrome,
–
–
–
–
0.002% live births,
anatomic mutations,
often mental retardation,
abnormal formation of vocal
mechanisms.
Chromosomal Duplication
...an event that results in the increase in the
number of copies of a particular
chromosomal region,
Duplication Cause and Effect
Causes:
– duplications often result from unequal crossing over,
– can occur via errors in replication during S-Phase.
Effects:
– results in gene redundancy,
– produces phenotypic variation,
– may provide an important source for genetic variability
during evolution.
Unequal Crossing Over
Produces both duplications and deletions!
Duplication Phenotypes
Duplication in Evolution
…essential genes do not tolerate mutation,
…duplications of essential genes, then
subsequent mutations, confers adaptive
potential to the organism,
…new gene family members are ‘recruited’ to
perform new functions.
flowering plant
algae
moss
nutrients
need uptake
need uptake
need uptake
transport to other tissue
transport to other tissue
transport to seeds
Arabidopsis
Chromosome Structure
• Changes in chromosome structure can come
about due to,
deletions
duplications
rearrangements
Chromosomal Inversions
…inversion: aberration in which a portion of
the chromosome is turned around 180o.
Paracentric Inversion
...an inversion in which the centomere is not
included,
A
B
C
A
B
B
A
C
...a paracentric inversion does not change arm
length ratio.
Inversion Heterozygotes
…an organism with one wild-type and one
chromosome containing an inversion,
A
B
C
B
A
C
…not heterozygous for the genes, heterozygous
for the chromosomes.
Inversion Loop
no crossing over
Paracentric
Produces haploid gamete.
Paracentric
Produces gamete with inversion.
Paracentric
Produces a chromosome with two centromeres.
Nonviable gametes.
Dicentric
...a chromosome having two centromeres;
Non-Viable (gametes) Segregate
Dicentric/Ascentric
…results only when the crossing over occurs
within the region of the paracentric inversion,
Paracentric
No centromeres. Deletions.
Nonviable gametes.
Acentric
…a chromosome having no centromeres,
…segregates to daughter cells randomly, or is
lost during cell division,
…deletions impart partial monosomy.
Paracentric Outcomes
1 Normal Gamete, 1 Inversion Gamete, No Crossover Classes
Recombination is not inhibited, but recombinant gametes are
selected against.
Pericentric Inversion
...an inversion in which the centromere is
included,
A
B
C
A
C
B
...a pericentric inversion results in a change in
chromosome arm length.
Pericentric
Recombination and Inversions
• Paracentric and Pericentric;
– 1 Normal Gamete,
– 1 Inverted Gamete,
– No Crossover Classes = No Recombination,
Inversions select against recombinant gametes,
thus preserves co-segregation of specific alleles.
Inversions and Evolution
• Inversions ‘lock’ specific alleles together,
– all offspring get the alleles from either a wildtype, or inverted chromosome,
• If the ‘set of alleles’ is advantageous, the set
can be maintained in the population.
Assignment
• Understand the differences between
‘Interference’, and the suppression of
recombination resulting from inversions,
• Be able to recognize data, and predict
results given either case.
Translocations
…translocation: aberration associated with
the transfer of a chromosomal segment to a
new location in the genome.
Synteny
Description of DNA segments in which gene order is identical between species.
Terminal Translocation
Reciprocal Translocation
Robertsonian Translocations
…the fusion of long arms of acrocentric
chromosomes,
Down Syndrome
• 95% of Down Syndrome individuals are a result of
Trisomy 21,
– the probability of having a second Down Syndrome child
is usually similar to the population at large,
• However, there is second cause of Down Syndrome
caused by a Robertsonian translocations that is
heritable.
Familial Down Syndrome
Assignment
• Do a Punnett Square or a Split Fork Diagram
of,
Parent 1: wild-type for Chromosomes 14, 21
x
Parent 2: heterozygous for 14q;21q translocation.
Hint
gametes
Trinucleotide Repeat Expansions
FMR1
Fragile X Mental Retardation 1
...GCGCGGCGGTGACGGAGGCGCCGC
TGCCAGGGGGCGTGCGGCAGCG...
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
…CTGGGCCTCGAAGCGCCCGCAGCCA
cgg
cgg
cgg
cgg
...
cgg
cgg
cgg
cgg
> 200
Fragile Site Mutations
Assignment
(think about these...)
• Truncated Genes;
– genes that are no longer full length, due to a
mutation,
• Gene Fusions;
– genes that contain coding sequence from two
different genes, resulting from a chromosomal
mutation.
Review
• know genotypes and phenotypes,
–
–
–
–
–
–
trisomy,
monosomy,
inversions,
duplications,
deletions,
fragile site mutations,
• be able to predict heritability, and recognize
data-sets and infer the condition.
Assigned Problems
• Chapter 5, 51 - 5.19
• Quantitative Trait Loci Problems Online
Coming Up
• Wednesday;
– Dosage Compensation (X-linked genes),
– Questions and problems.
• Friday: Exam.