Download Calculating the Number of Genes

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Minimal genome wikipedia, lookup

Dominance (genetics) wikipedia, lookup

History of genetic engineering wikipedia, lookup

Comparative genomic hybridization wikipedia, lookup

Designer baby wikipedia, lookup

Mutagen wikipedia, lookup

Medical genetics wikipedia, lookup

Oncogenomics wikipedia, lookup

Mutation wikipedia, lookup

Cell-free fetal DNA wikipedia, lookup

Gene wikipedia, lookup

Artificial gene synthesis wikipedia, lookup

Genome evolution wikipedia, lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia, lookup

Hybrid (biology) wikipedia, lookup

Saethre–Chotzen syndrome wikipedia, lookup

Site-specific recombinase technology wikipedia, lookup

Gene expression programming wikipedia, lookup

Point mutation wikipedia, lookup

Genomic imprinting wikipedia, lookup

Epigenetics of human development wikipedia, lookup

Polycomb Group Proteins and Cancer wikipedia, lookup

Microevolution wikipedia, lookup

Segmental Duplication on the Human Y Chromosome wikipedia, lookup

Meiosis wikipedia, lookup

DiGeorge syndrome wikipedia, lookup

Down syndrome wikipedia, lookup

Skewed X-inactivation wikipedia, lookup

Genome (book) wikipedia, lookup

Chromosome wikipedia, lookup

Y chromosome wikipedia, lookup

Ploidy wikipedia, lookup

X-inactivation wikipedia, lookup

Neocentromere wikipedia, lookup

Karyotype wikipedia, lookup

Polyploid wikipedia, lookup

Transcript
Genetics…
…in the News
Chromosomal Mutations
• Chromosome mutations are variations from
the wild-type condition in...
– chromosome number,
– chromosome structure,
Karyotypes
(viewing chromosomes)
…the chromosome
complement of a
cell or individual,
.. refers to the
arrangement of
metaphase
chromosomes
according to
length,
Human Karyotypes
Female
Male
p
Physical Maps
(Cytological Maps)
• AT versus GC rich regions stain
differently,
– i.e. Giesma stain,
1
– in a very reproducible fashion.
• Short arm “petit” (p), long arm
(q),
• #s refer to regions, with
differential staining.
2
3
q
Chromosomal Mutations
– chromosome number,
– structure,
Aneuploidy
...the gain or loss of a single chromosome,
– monosomy: the loss of a single chromosome,
– trisomy: the gain of a single chromosome.
Meiotic Nondisjunction
...variation in chromosome number is caused
by the failure of paired homologs to
segregate properly during meiosis.
2n = 46, if human
Normal
Disjunction
We are following one pair of
homologs.
first division
second division
haploid gamete
(gametes)
Disomic
2n = 46, if human
We are following one pair of
homologs.
Nondisjunction
First Division
first division
second division
haploid gamete
(gametes)
Trisomic Trisomic Monosomic Monosomic
2n = 46, if human
Nondisjunction
We are following one pair of
homologs.
Second Division
first division
second division
haploid gamete
(gametes)
Disomic Disomic
Trisomic Monosomic
Monosomy, 2n - 1
2n =
45,
46 -5
The loss of a single chromosome in an otherwise diploid cell.
Autosomal Monosomy
• nearly always deleterious, usually lethal,
– recessive lethal alleles are expressed,
C
a
B
A
B
C
c
D
d
E
E
diploid
monosomic
C
c
c
Aa
BB Cc Dd
CC
Cc EE
Cc
cc
recessive lethal allele
recessive lethal alleles
Trisomy, 2n + 1
2n =
46
47,+3
The gain of a single chromosome in an otherwise diploid cell.
Autosomal Trisomy
• generally deleterious,
– usually changes the phenotype of the individual,
A
B
a
B
a
B
C
c
c
D
d
d
E
E
E
trisomic
Jimsonweed
(Datura stramonium)
Trisomy in plants
Tomato
Down Syndrome
(2n = 47, +21)
Trisomy in Humans
Down Syndrome
(2n = 47, +21)
• occurs at a frequency of about 0.15%,
• mental retardation (I.Q. 20 - 50),
• mean life expectancy is about 17 years,
• 47, +21 females are fertile,
• trisomy 21 risk factors, maternal age.
Down Syndrome
Trisomy in Humans
Down Syndrome Critical Genes
• Chromosome 21 has about + 351 genes,
– natural feedback mechanisms limit dosage
effects of most of these genes,
• It is estimated that the improper expression
of approximately 20-40 genes produces the
variety of phenotypes.
Maternal Age and Down Syndrome
Maternal Age?
• in female humans*, oocytes arrest
in Prophase I before birth,
– meiosis continues upon menstruation,
– thus, tetrad formation and cellular
function must be maintained for
decades.
• and, as mother’s age increases,
maternal detection of trisomy may
be attenuated and spontaneous
abortions drops.
* Research may suggest otherwise.
Other Human Autosomal Trisomics
• Edwards Syndrome (2n = 47, +18)
–
–
–
–
0.0125% live births,
mental abnormalities,
“faunlike ears”, “rockerbottom feet”, small jaw,
nearly all die within several weeks of birth,
• Patau Syndrome (2n = 47, +13),
–
–
–
–
0.005% live births,
mental abnormalities,
cleft lip, small mal-formed head, “rockerbottom feet”,
mean life expectancy is about 130 days.
Autosomal Trisomy Causation
• Age of Parents,
• Random Errors,
– or genetic predisposition,
• Especially malfunction of recombination
machinery,
– crossing over and subsequent recombination are
necessary for proper chromosome disjunction.
Sex Chromosome Monosomy
• Turner Syndrome (2n = 45, X),
– sometimes referred to as XO,
Turner Syndrome
(2n = 45, X)
- 0.03% live female births,
- infertile,
- normal intelligence,
although specific
cognitive functions
may be affected.
Sex Chromosome Trisomy
• Klinefelter Syndrome (2n = 47, XXY),
Klinefelter Syndrome
(2n = 47, XXY)
- 0.1% - 0.2% live male births,
- infertile,
- mildly retarded.
48, XXXY; 48, XXYY;
49, XXXXY; 49, XXXYY
XXX Syndrome
(2n = 47, XXX)
• 47, XXX Syndrome,
– 0.08 % female births,
– typically normal development,
– fertile.
XYY Syndrome
(2n = 47, XYY)
• 2n = 47, XYY Syndrome,
–
–
–
–
0.10 % male births,
above average height,
sub-normal intelligence,
fertile.
Genetic Disposition for Antisocial and Criminal Behavior?
No.
1,000,000
Conceptions
850,000
Live Births
150,000
Spontaneous Abortions
5165
Chromosomal Abnormalities
1849 (about 2:1 males)
Sex Chromosome Aneuploid
1183 (20: 2: 1)
Autosomal Trisomics
1,000,000
Conceptions
850,000
Live Births
150,000
Spontaneous Abortions
75,000
Chromosome Mutations
39,000; Trisomics
13,500; XO
Aneuploidy Summary
• Autosomal Monosomy,
– nearly always deleterious,
• Autosomal Trisomy,
– usually deleterious,
– trisomic individuals usually show distinct phenotypes,
• Sex Chromosome Aneuploidy,
– results in Turner or Klinefelter Syndromes,
– 2n = 47, XXX, often normal,
– 2n = 47, XYY, mild retardation, tall.
Chapter 5
• Do all of the practice questions (except 20).
Plant Biotechnology
Information later in
the Quarter
Chromosomal Mutations
• Chromosome mutations are variations from
the wild-type condition in...
– chromosome number,
– chromosome structure,
Polyploidy
…more than two haploid sets of chromosomes
are present,
–
–
–
–
2n = diploid,
3n = triploid,
4n = tetraploid,
etc.
Polyploidy Generalities
de novo
• rare in most animal species,
• known in lizards, fish and amphibians,
• fairly common in plants,
• odd numbers of ploidy are not usually maintained,
– 3n, 5n, etc.
• rarely found in organisms that rely on sexual propagation.
Autopolyploidy
...polyploidy resulting from the replication of one or
more sets of chromosomes,
…the additional set of chromosomes is identical to
the normal haploid complement of that species.
added
1x
2x
Autopolyploidy
…can be induced by treating cells
with the drug colchicine,
 colchicine: is a alkaloid
derivative from the autumn crocus
(Crocus veneris),
...inhibits microtubule polymerization,
and thus inhibits the separation of
chromosomes during meiosis.
Crocus veneris
…autumn crocus,
…meadow saffron,
…naked ladies.
Colchicine Treatment
• 2n cells undergo S-phase,
• no separation of chromosomes is accomplished,
• no cell division occurs,
• at telophase, the nuclear membrane reforms,
• treatment for one cell cycle leads to 4n cells.
Natural Autopolyploidy
• Heat, cold also affect microtubule polymerization
and can lead to autopolyploidy.
Allopolyploidy
…formed by the union of two or more distinct
chromosome sets,
...i.e., from different species.
The Sad Tail of Raphanobrassica
…Vegetable of the Proletariet?
Cast
Dr. G. Karpechenko, Russian Plant breeder,
Brassica oleracea (2n = 18),
- cabbage, large above ground food stock, ~value-less root,
Raphanus sativus (2n = 18),
- the common radish, large root food stock, ~value-less leaves.
Super Vegetable?
Cabbage
2n1 = 18
n1 = 9
Radish
2n2 = 18
n2 = 9
x
n1 + n2 = 18
sterile
spontaneous autopolyploidy
2n1 + 2n2 = 36
Amphidiploid
…double diploid,
2n1 + 2n2
…have balanced gametes of the type n1 + n2,
these gametes fuse to make fertile 2n1 + 2n2.
Raphanobrassica?
• Roots of cabbage, leaves of radish,
– dud-vegetable for Karpechenko, abandoned the project.
• Revived by the Scottish Plant Breeding Station in
Dundee, Scotland,
– Raphanobrassica’s high dry matter content makes it an
excellent fodder for sheep and cattle.
Allopolyploidy in Plants
Wheat
Cotton
Apples
Plums
Strawberries
Longanberries
Tobacco
Potatoes
more...
Plant secondary metabolite, inhibits microtubule function
Autopolyploidy Applications
• Treating a parent plant with colchicine often produces
autopolyploidy, resulting in offsprings with larger flowers
and/or fruit,
4n
2n
8n
2n
Allopolyploidy Applications
B. oleracea (cabbage, cauliflower, Brocolli, kale, etc.)
2n = 18
n=9
B.
n1napas
+ n2 =( 19
Oil rape, canola oil)
2n1 + 2n2 = 38
n = 10
B. campestris (turnip, turnip rape)
2n = 20
amphidiploid
4n x 2n = 3n?
• The creation of triploids can be
accomplished by crossing a tetraploid with
a diploid,
• Most triploid individuals are sterile.
Generation of a Triploid Cells
Meiosis in a Triploid Organism
Who’d want to Eat That?
• Bananas,
• Seedless Watermelon,
• Most other seedless varieties,
• Some oysters.
Environmental Applications?
grass carp
(Ctenopharyngodon idella)
• grass carp prefer pondweeds,
• do not prefer plants such as cattail, water lily, etc.
 Triploid grass carp do not reproduce…
Polyploidy Summary
• More than 2 whole sets of chromosomes,
• Autopolyploidy,
– from the same genome,
– naturally occurring, or induced,
– often results in larger varieties,
• Allopolyploidy,
– from different genomes,
– naturally occurring, or induced,
– often results in larger varieties,
• Autotriploids,
– most often sterile
– can produce beneficial traits.
Monoploidy
…a haploid of a diploid is monoploid,
…has one chromosome set.
Monoploid
• male wasps, bees and
ants have only 1 haploid
genome,
– males develop from
unfertilized eggs,
• gametes are formed by
mitosis.
Bees (example)
Monoploid Applications
• monoploid plants can be created by
culturing pollen grains (n = 1),
– the population of haploid organisms is then
screened for favorable traits,
– the plants are then treated with colchicine
which generates a 2n plant homozygous for the
favorable trait(s).
Chromosomal Mutations
– chromosome number,
– structure,
Chromosome Structure
• Changes in chromosome structure can come
about due to,
deletions
duplications
rearrangements
Chromosomal Deletions
…a deletion results in a lost portion of a
chromosome,
– deletion causative agents,
• heat,
• radiation,
• viruses,
• chemicals,
• errors in recombination.
Terminal Deletions
Off the End
Intercalary Deletions
From the Middle
Recognizing Deletions
Terminal
Intercalary
Homologous Pairs?
Intercalary
Hemizygous
Terminal
Hemizygous: gene is present in a single dose.
Psuedodominance: hemizygous genes are expressed.
Deletions
…result in partial monosomy,
 remember monosomy: 2n, -1,
…the organism is monosomic for the portion
of the chromosome that is deleted,
…as in monosomy, most segmental deletions
are deleterious.
Cri-du-chat Syndrome
(2n = 46, -5p)
2n = 46, -5p
...terminal deletion of the small arm
(petite arm) of chromosome 5,
• Cri-du-chat Syndrome,
–
–
–
–
0.002% live births,
anatomic mutations,
often mental retardation,
abnormal formation of vocal
mechanisms.
Chromosome Structure
• Changes in chromosome structure can come
about due to,
deletions
duplications
rearrangements
Chromosomal Duplication
...an event that results in the increase in the
number of copies of a particular
chromosomal region,
Duplication Cause and Effect
Causes:
– duplications often result from unequal crossing over,
– can occur via errors in replication during S-Phase.
Effects:
– results in gene redundancy,
– produces phenotypic variation,
– may provide an important source for genetic variability
during evolution.
Unequal Crossing Over
Produces both duplications and deletions!
Duplication in Evolution
…essential genes do not tolerate mutation,
…duplications of essential genes, followed by
mutations, confers adaptive potential to the
organism,
…new gene family members are ‘recruited’ to
perform new functions.
flowering plant
algae
moss
nutrients
need uptake
need uptake
need uptake
transport to other tissue
transport to other tissue
transport to seeds
Arabidopsis
Chromosome Structure
• Changes in chromosome structure can come
about due to,
deletions
duplications
rearrangements
Chromosomal Inversions
…inversion: aberration in which a portion of
the chromosome is turned around 180o.
Paracentric Inversion
...an inversion in which the centomere is not
included,
A
B
C
A
B
B
A
C
...a paracentric inversion does not change arm
length ratio.
Inversion Heterozygotes
…an organism with one wild-type and one
chromosome containing an inversion,
A
B
C
B
A
C
…not heterozygous for the genes, heterozygous
for the chromosomes.
Inversion Loop
no crossing over gametes
Paracentric
Produces haploid gamete.
Paracentric
Produces gamete with inversion.
Paracentric
Produces a chromosome with two centromeres.
Nonviable gametes.
Dicentric
...a chromosome having two centromeres;
Non-Viable (gametes) Segregate
Dicentric/Ascentric
…results only when the crossing over occurs
within the region of the paracentric inversion,
Paracentric
No centromeres. Deletions.
Nonviable gametes.
Acentric
…a chromosome having no centromeres,
…segregates to daughter cells randomly, or is
lost during cell division,
…deletions impart partial monosomy.
Paracentric Outcomes
1 Normal Gamete, 1 Inversion Gamete, No Crossover Classes
Recombination is not inhibited, but recombinant gametes are
selected against.
Pericentric Inversion
...an inversion in which the centromere is
included,
A
B
C
A
C
B
...a pericentric inversion results in a change in
chromosome arm length.
Pericentric
Recombination and Inversions
• Paracentric and Pericentric;
– 1 Normal Gamete,
– 1 Inverted Gamete,
– (No) Crossover Classes = No Recombination…
…in area of inversion.
Inversions select against recombinant gametes,
thus preserves co-segregation of specific alleles.
Inversions and Evolution
• Inversions ‘lock’ specific alleles together,
– all offspring get their alleles from either a wildtype, or inverted chromosome,
• If the ‘set of alleles’ is advantageous, the set
can be maintained in the population.
Assignment
• Know how inversions alter the outcomes of
recombination,
• Understand the differences between ‘Interference’,
and the suppression of recombination resulting
from inversions,
• Be able to recognize data, and predict results given
either case.
Chapter 5
• Do all of the practice questions (except 20).
Chromosome Structure
• Changes in chromosome structure can come
about due to,
deletions
duplications
rearrangements
Translocations
…translocation: aberration associated with
the transfer of a chromosomal segment to a
new location in the genome.
Terminal Translocation
Reciprocal Translocation
Translocation and Semi-Sterility
…semi-sterility; a condition in which a proportion of all
gametophytes (in plants) or zygotes (in animals) are
inviable.
• Up to 50% are not viable as a result of translocations.
Robertsonian Translocations
…the fusion of long arms of acrocentric
chromosomes,
Down Syndrome
• 95% of Down Syndrome individuals are a result of
Trisomy 21,
– the probability of having a second Down Syndrome child
is usually similar to the population at large,
• However, there is second cause of Down Syndrome
caused by a Robertsonian translocations that is
heritable.
Familial Down Syndrome
Assignment
• Do a Punnett Square or a Split Fork Diagram
of,
Parent 1: wild-type for Chromosomes 14, 21
x
Parent 2: heterozygous for 14q;21q translocation.
Hint
gametes
Trinucleotide Repeat Expansions
FMR1
Fragile X Mental Retardation 1
...GCGCGGCGGTGACGGAGGCGCCGC
TGCCAGGGGGCGTGCGGCAGCG...
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
cgg
…CTGGGCCTCGAAGCGCCCGCAGCCA
cgg
cgg
cgg
cgg
...
cgg
cgg
cgg
cgg
> 200
Fragile Site Mutations
Syntenic
• Relationship of two or more loci found to
be linked in one species; literally “on the
same thread”.
• Conserved Synteny: state in which the
same two loci are found to be linked in
several species.
Cereals
Conserved Synteny
Description of DNA segments in which gene order is identical between species.
Chapter 5 Review
• know genotypes and phenotypes for exam 2,
–
–
–
–
–
–
–
trisomy,
monosomy,
inversions,
duplications,
deletions,
polyploidy,
dosage compensation.
• be able to predict heritability, and recognize
data-sets and infer the condition.
Wednesday
• Work Chapter 5 problems, we’ll work them
together.
• Quiz through assigned reading (syllabus).
• Keep studying.
Exam #1
Mean = 82.5%
Median = 81%
Mode = 82.5%
A range: | | | | | | | | | | | |
B range: | | | | | | | | | | | |
C range: | | | | | |
D range: | | | | | |
Failing: |