* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download 5` cap
Gene expression profiling wikipedia , lookup
RNA interference wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Community fingerprinting wikipedia , lookup
List of types of proteins wikipedia , lookup
Non-coding DNA wikipedia , lookup
Gene regulatory network wikipedia , lookup
Synthetic biology wikipedia , lookup
RNA silencing wikipedia , lookup
Biochemistry wikipedia , lookup
Polyadenylation wikipedia , lookup
Molecular evolution wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Expanded genetic code wikipedia , lookup
Point mutation wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genetic code wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Messenger RNA wikipedia , lookup
Non-coding RNA wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Transcriptional regulation wikipedia , lookup
From Gene to Protein How Genes Work AP Biology 1 gene – 1 enzyme hypothesis  Beadle & Tatum  Compared mutants of bread mold, Neurospora fungus  created mutations by X-ray treatments  X-rays break DNA  damage a gene  wild type grows on minimal media  sugars + required nutrients allows fungus to synthesize essential amino acids  mutants require added amino acids  each type of mutant lacks a certain enzyme needed AP Biology to produce a certain amino acid  non-functional enzyme from damaged gene Beadle & Tatum X rays or ultraviolet light Wild-type Neurospora create mutations asexual spores Minimal medium spores Growth on complete medium positive control Select one of the spores Test on minimal medium to confirm presence of mutation negative control Grow on complete medium Minimal media supplemented only with… experimentals Choline Pyridoxine Riboflavin Minimal Nucleic Arginine control amino acid p-Amino Niacin Inositol acid Folic supplements acid Thiamine benzoic acid AP Biology One gene / one enzyme hypothesis  Damage to specific gene, mapped to nutritional mutations gene cluster 1 gene cluster 2 gene cluster 3 chromosome arg-E encoded enzyme enzyme E glutamate arg-G arg-H arg-F enzyme F ornithine substrate in AP biochemical Biology pathway enzyme G citruline enzyme H arginosuccinate arginine gene that was damaged The “Central Dogma”  Flow of genetic information in a cell  How do we move information from DNA to proteins? DNA replication AP Biology RNA protein DNA gets all the glory, but proteins do all the work! trait RNA   ribose sugar N-bases uracil instead of thymine U : A C : G    single stranded lots of RNAs  DNA AP Biology mRNA, tRNA, rRNA, siRNA… transcription RNA Transcription from DNA nucleic acid language to RNA nucleic acid language AP Biology Transcription  Making mRNA   transcribed DNA strand = template strand untranscribed DNA strand = coding strand   synthesis of complementary RNA strand   same sequence as RNA transcription bubble enzyme  RNA polymerase 5 C DNA G 3 A G T A T C T A 53 G A G C A T C G T A C T 3 G C A U C G U C G T A G C A T T A C A G C T G A T A T 3 5 unwinding rewinding mRNA AP Biology build RNA coding strand 5 RNA polymerase template strand Bacterial chromosome Transcription in Prokaryotes Psssst… no nucleus! Cell membrane Cell wall AP Biology Transcription mRNA Transcription in Prokaryotes  Initiation  RNA polymerase binds to promoter sequence on DNA Role of promoter   Starting point  where to start reading  start of gene Template strand  which strand to read Direction on DNA  always read DNA 35 APBiology build RNA 53  Transcription in Prokaryotes  Promoter sequences enzyme subunit RNA polymerase read DNA 35 bacterial DNA Promoter TTGACA TATAAT –35 sequence –10 sequence RNA polymerase AP Biology strong vs. weak promoters Transcription in Prokaryotes  Elongation  RNA polymerase copies DNA as it unwinds   ~20 base pairs at a time  300-500 bases in gene builds RNA 53 Simple proofreading 1 error/105 bases  make many mRNAs  mRNA has short life not worth editing! AP  Biology  reads DNA 35 Transcription in Prokaryotes  Termination  AP Biology RNA polymerase stops at termination sequence Transcription in Eukaryotes Transcription Psssst… DNA can’t leave nucleus! RNA Processing Translation Protein AP Biology Prokaryote vs. Eukaryote genes  Prokaryotes  Eukaryotes   DNA in cytoplasm circular chromosome naked DNA  no introns      DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence AP Biology Transcription in Eukaryotes  3 RNA polymerase enzymes  RNA polymerase 1    RNA polymerase 2   AP Biology transcribes genes into mRNA RNA polymerase 3   only transcribes rRNA genes makes ribosomes only transcribes tRNA genes each has a specific promoter sequence it recognizes Transcription in Eukaryotes  Initiation complex  transcription factors bind to promoter region upstream of gene   suite of proteins which bind to DNA  turn on or off transcription TATA box binding site  recognition site for transcription factors  transcription factors trigger the binding of RNA polymerase to DNA AP Biology Post-transcriptional processing  Primary transcript (pre-mRNA)   eukaryotic mRNA needs work after transcription mRNA processing (making mature mRNA)   mRNA splicing = edit out introns protect mRNA from enzymes in cytoplasm  add 5 cap mRNA P  add polyA tail 5' G PP 3' A intron = noncoding (inbetween) sequence ~10,000 bases eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript AP Biology mature mRNA transcript ~1,000 bases spliced mRNA Alteration of Pre-mRNA ends  add 5 cap Modified guanine nucleotide  Protects mRNA from enzymes  Helps ribosome recognize attachment site   add polyA tail About 30-200 adenine nucleotides added  Protects RNA from enzymes in cytoplasm  May facilitate export of mRNA to cytoplasm  AP Biology Splicing must be accurate  No room for mistakes! splicing must be exactly accurate  a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His  AP Biology AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP| Splicing enzymes  snRNPs    small nuclear RNA exon proteins Spliceosome   exon 3' spliceosome 5' 3' cut & paste No, not smurfs! “snurps” AP Biology intron 5' several snRNPs recognize splice site sequence  snRNPs snRNA mature mRNA lariat 5' exon 5' 3' exon 3' excised intron Ribozyme  RNA as ribozyme some mRNA can even splice itself  RNA as enzyme  Sidney Altman AP Biology Yale Thomas Cech U of Colorado Translation from nucleic acid language to amino acid language AP Biology Bacterial chromosome Translation in Prokaryotes Transcription mRNA Translation Psssst… no nucleus! protein Cell membrane Cell wall AP Biology Translation in Prokaryotes  Transcription & translation are simultaneous in bacteria DNA is in cytoplasm  no mRNA editing  ribosomes read mRNA as it is being transcribed  Smaller ribosomes  AP Biology Translation: prokaryotes vs. eukaryotes  Differences between prokaryotes & eukaryotes  time & physical separation between processes   AP Biology takes eukaryote ~1 hour from DNA to protein RNA processing Translation in Eukaryotes AP Biology mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon mRNA AUGCGUGUAAAUGCAUGCGCC ? protein AP Biology Met Arg Val Asn Ala Cys Ala Cracking the code  Crick  determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT  Nirenberg & Khorana determined mRNA–amino acid match  added fabricated mRNA to test tube of ribosomes, tRNA & amino acids    AP Biology  created artificial UUUUU… mRNA found that UUU coded for phenylalanine (phe) Other tests (AAA, GGG…) supported results The code  Code for ALL life!   strongest support for a common origin for all life Code is redundant   several codons for each amino acid 3rd base “wobble” Why is the wobble good?  Start codon    AP Biology AUG methionine Stop codons  UGA, UAA, UAG Wobble      1 tRNA can recognize 2-3 different mRNA codons Third base of a codon is known as the "wobble position" Explains why the multiple codons per amino acid differ by the third position 45 types of tRNA  translate 64 codons most versatile tRNA's are those with Inosine (I), a modified base, in the wobble position  AP Biology I can hydrogen bond with U, C, or A. How are the codons matched to amino acids? DNA mRNA 3 5 TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC codon 3 tRNA UAC amino acid Met AP Biology 5 GCA Arg CAU Val anti-codon 5 3 Transfer RNA structure  “Clover leaf” structure anticodon on “clover leaf” end  amino acid attached on 3 end  AP Biology Loading tRNA  Aminoacyl tRNA synthetase   Specific enzyme which bonds amino acid to specific tRNA bond requires energy   ATP  AMP energy stored in tRNA-amino acid bond  Unstable = so it can release amino acid at ribosome easily Trp C=O OH OH Trp C=O O Trp H2O O activating enzyme tRNATrp anticodon AP Biology tryptophan attached to tRNATrp AC C UGG mRNA tRNATrp binds to UGG condon of mRNA Ribosomes  Facilitate coupling of tRNA anticodon to mRNA codon  Structure     ribosomal RNA (rRNA) & proteins Made in nucleolus Assemble when attached to mRNA 2 subunits   large small E P A Ribosomes  A site (aminoacyl-tRNA site)   P site (peptidyl-tRNA site)   holds tRNA carrying next amino acid to be added to chain holds tRNA carrying growing polypeptide chain Met E site (exit site)  AP Biology empty tRNA leaves ribosome from exit site U A C A U G 5' E P A 3' Building a polypeptide    Initiation  brings together mRNA, ribosome subunits, initiator tRNA-Met  AUG = start codon Elongation  adding amino acids based on codon sequence  Growing polypeptide = peptide bonds Termination  end codon: UAA, UAG, UGA 3 2 1 Leu Val Met Met Met Met Leu Ala Leu Leu release factor Ser Trp tRNA U AC 5' C UGAA U mRNA A U G 3' E P A 5' UAC GAC A U G C U GAA U 5' 3' U A C GA C A U G C U G AAU 5' 3' U AC G A C AA U AU G C U G 3' A CC U GG U A A 3' Polyribosome  A cluster of ribosomes simultaneously translating an mRNA strand AP Biology Destinations: Protein targeting    Signal peptide  address label     start of a secretory pathway AP Biology  secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… RNA polymerase DNA Can you tell the story? amino acids exon intron tRNA pre-mRNA 5' cap mature mRNA aminoacyl tRNA synthetase polyA tail large ribosomal subunit polypeptide 5' small ribosomal subunit AP Biology tRNA E P A ribosome 3' Got Questions? Can I translate that for you? AP Biology Substitute Slides for Student Print version AP Biology Can you tell the story? AP Biology Extra Slides (used some years & not others) AP Biology Translation  Codons  AP Biology blocks of 3 nucleotides decoded into the sequence of amino acids Building Proteins  Organelles involved nucleus  ribosomes  endoplasmic reticulum (ER)  Golgi apparatus  vesicles  The Protein Assembly Line nucleus AP Biology ribosome ER Golgi apparatus vesicles From nucleus to cytoplasm…  Where are the genes?   Where are proteins synthesized?   genes are on chromosomes in nucleus proteins made in cytoplasm by ribosomes How does the information get from DNA in nucleus to cytoplasm?  AP Biology messenger RNA nucleus Alternative splicing  Alternative mRNAs produced from same gene   when is an intron not an intron… different segments treated as exons Starting to get hard to define a gene! AP Biology Domains  Modular architecture of many proteins   exons may represent functional units of protein easier to mix and match in the production of new proteins? AP Biology So… What is a gene?  One gene – one enzyme?    One gene – one protein?    but many proteins are composed of several polypeptides but each polypeptide has its own gene One gene – one polypeptide?   but not all proteins are enzymes but all proteins are coded by genes but many genes only code for RNA (tRNA, rRNA…) One gene – one product?  AP Biology but many genes code for more than one product … So… Where does that leave us?! Defining a gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” – Elizabeth Pennisi, Science 2003 gene RNA polypeptide 1 gene polypeptide 2 AP Biology polypeptide 3 It’s hard to hunt for wabbits, if you don’t know what a wabbit looks like. TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT human genome CGACTAGCATGATCGATCAGCTACATGCTAGCACACYC GTACATCGATCCTGACATCGACCTGCTCGTACATGCTA 3.2 billion bases CTAGCTACTGACTCATGATCCAGATCACTGAAACCCTA GATCGGGTACCTATTACAGTACGATCATCCGATCAGAT CATGCTAGTACATCGATCGATACTGCTACTGATCTAGC TCAATCAAACTCTTTTTGCATCATGATACTAGACTAGC TGACTGATCATGACTCTGATCCCGTAGATCGGGTACCT ATTACAGTACGATCATCCGATCAGATCATGCTAGTACA TCGATCGATACTGCTACTGATCTAGCTCAATCAAACTC TTTTTGCATCATGATACTAGACTAGCTGACTGATCATG ACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGA TCATCCGATCAGATCATGCTAGTACATCGATCGATACT AP Biology Any Questions?? What color would a smurf turn if he held his breath? AP Biology The Transcriptional unit enhancer exons 1000+b 20-30b 3' RNA TATA polymerase TAC transcriptional unit 5' DNA ACT introns 5' 3' 5' AP Biology 3'
 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                            