* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Ch_17 From Gene to Protein
Molecular cloning wikipedia , lookup
Transcription factor wikipedia , lookup
RNA interference wikipedia , lookup
Gene expression profiling wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
List of types of proteins wikipedia , lookup
Community fingerprinting wikipedia , lookup
RNA silencing wikipedia , lookup
Gene regulatory network wikipedia , lookup
Non-coding DNA wikipedia , lookup
Polyadenylation wikipedia , lookup
Biochemistry wikipedia , lookup
Synthetic biology wikipedia , lookup
Point mutation wikipedia , lookup
Molecular evolution wikipedia , lookup
Expanded genetic code wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genetic code wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Messenger RNA wikipedia , lookup
Non-coding RNA wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Chapter 17. From Gene to Protein AP Biology 2005-2006 Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins A AP Biology alkaptonuria (black urine from alkapton) PKU (phenylketonuria) Genes create phenotype each disease is caused by non-functional enzyme B C D E 2005-2006 AP Biology 2005-2006 1 gene – 1 enzyme hypothesis Beadle & Tatum Compared mutants of bread mold, Neurospora fungus created mutations by X-ray treatments X-rays break DNA inactivate a gene wild type grows on “minimal” media sugars + required precursor nutrient to synthesize essential amino acids mutants require added amino acids each type of mutant lacks a certain enzyme AP Biology needed to produce a certain amino acid non-functional enzyme = broken gene 2005-2006 1941 | 1958 Beadle & Tatum George Beadle Edward Tatum AP Biology 2005-2006 Beadle & Tatum’s Neurospora experiment AP Biology 2005-2006 So… What is a gene? One gene – one enzyme One gene – one protein but many proteins are composed of several polypeptides but each polypeptide has its own gene One gene – one polypeptide but not all proteins are enzymes but all proteins are coded by genes but many genes only code for RNA One gene – one product AP Biology but many genes code for more than one product … Where does that leave us?! 2005-2006 Defining a gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” RNA gene – Elizabeth Pennisi, Science 2003 polypeptide 1 gene polypeptide 2 AP Biology polypeptide 3 It’s hard to hunt for wabbits, if you don’t know what a wabbit looks like. 2005-2006 The “Central Dogma” How do we move information from DNA to proteins? transcription DNA replication AP Biology translation RNA protein For simplicity sake, let’s go back to genes that code for proteins… 2005-2006 From nucleus to cytoplasm… Where are the genes? Where are proteins synthesized? genes are on chromosomes in nucleus proteins made in cytoplasm by ribosomes How does the information get from nucleus to cytoplasm? AP Biology messenger RNA nucleus 2005-2006 RNA ribose sugar N-bases uracil instead of thymine U : A C : G single stranded mRNA, rRNA, tRNA, siRNA…. transcription DNA AP Biology RNA 2005-2006 Transcription Transcribed DNA strand = template strand Synthesis of complementary RNA strand untranscribed DNA strand = coding strand transcription bubble Enzyme AP Biology RNA polymerase 2005-2006 Transcription in Prokaryotes Initiation RNA polymerase binds to promoter sequence on DNA Role of promoter 1. Where to start reading = starting point 2. Which strand to read = template strand 3. Direction on DNA = always AP Biology reads DNA 3'5' 2005-2006 Transcription in Prokaryotes Promoter sequences AP Biology RNA polymerase molecules bound to bacterial DNA 2005-2006 Transcription in Prokaryotes Elongation RNA polymerase unwinds DNA ~20 base pairs at a time reads DNA 3’5’ builds RNA 5’3’ (the energy governs the synthesis!) No proofreading 1 error/105 bases many copies short life not worth it! AP Biology 2005-2006 Transcription RNA AP Biology 2005-2006 Transcription in Prokaryotes Termination RNA polymerase stops at termination sequence mRNA leaves nucleus through pores RNA GC hairpin turn AP Biology 2005-2006 Transcription in Eukaryotes AP Biology 2005-2006 Prokaryote vs. Eukaryote genes Prokaryotes Eukaryotes DNA in cytoplasm circular chromosome naked DNA no introns DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence AP Biology 2005-2006 Transcription in Eukaryotes 3 RNA polymerase enzymes RNA polymerase I RNA polymerase I I AP Biology transcribes genes into mRNA RNA polymerase I I I only transcribes rRNA genes only transcribes rRNA genes each has a specific promoter sequence it recognizes 2005-2006 Transcription in Eukaryotes Initiation complex transcription factors bind to promoter region upstream of gene AP Biology proteins which bind to DNA & turn on or off transcription TATA box binding site only then does RNA polymerase bind to DNA 2005-2006 Post-transcriptional processing Primary transcript eukaryotic mRNA needs work after transcription Protect mRNA from RNase enzymes in cytoplasm add 5' cap mRNA 5' cap add polyA tail 5' G PPP CH 3' A 3 Edit out introns intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence primary mRNA transcript AP Biology mature mRNA transcript pre-mRNA 2005-2006 spliced mRNA Transcription to translation Differences between prokaryotes & eukaryotes time & physical separation between processes RNA processing AP Biology 2005-2006 Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing needed AP Biology 2005-2006 From gene to protein transcription DNA mRNA mRNA leaves nucleus through nuclear pores AP Biology nucleus translation a a a a protein a ribosomea cytoplasm a a a a a a a a a a proteins synthesized by ribosomes using 2005-2006 instructions on mRNA How does mRNA code for proteins? DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC ? protein AP Biology Met Arg Val Asn Ala Cys Ala How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 2005-2006 Cracking the code 1960 | 1968 Nirenberg & Matthaei determined 1st codon–amino acid match UUU coded for phenylalanine created artificial poly(U) mRNA added mRNA to test tube of ribosomes, tRNA & amino acids mRNA synthesized single amino acid polypeptide chain phe–phe–phe–phe–phe–phe AP Biology 2005-2006 AP Biology Heinrich Matthaei Marshall2005-2006 Nirenberg Translation Codons AP Biology blocks of 3 nucleotides decoded into the sequence of amino acids 2005-2006 mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC ? protein AP Biology Met Arg Val Asn Ala Cys Ala 2005-2006 The code For ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid Why is this a good thing? Start codon AUG methionine Stop codons UGA, AP Biology UAA, UAG 2005-2006 How are the codons matched to amino acids? DNA mRNA 3' 5' 5' 3' TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC codon 3' tRNA UAC amino acid Met AP Biology 5' GCA Arg CAU Val anti-codon 2005-2006 aa aa aa cytoplasm transcription translation aa aa aa aa aa protein aa aa aa nucleus AP Biology 2005-2006 tRNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3' end AP Biology 2005-2006 Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA endergonic reaction energy stored in tRNA-amino acid bond AP Biology ATP AMP unstable so it can release amino acid at ribosome 2005-2006 Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits AP Biology large small 2005-2006 Ribosomes P site (peptidyl-tRNA site) A site (aminoacyl-tRNA site) holds tRNA carrying growing polypeptide chain holds tRNA carrying next amino acid to be added to chain E site (exit site) AP Biology empty tRNA leaves ribosome from exit site 2005-2006 Building a polypeptide Initiation brings together mRNA, ribosome subunits, proteins & initiator tRNA Elongation Termination AP Biology 2005-2006 Elongation: growing a polypeptide AP Biology 2005-2006 Termination: release polypeptide Release factor “release protein” bonds to A site bonds water molecule to polypeptide chain Now what happens to the polypeptide? AP Biology 2005-2006 Protein targeting Signal peptide address label Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm start of a secretory pathway AP Biology 2005-2006 RNA polymerase DNA Can you tell the story? amino acids exon intron tRNA pre-mRNA 5' cap mature mRNA aminoacyl tRNA synthetase polyA tail large subunit polypeptide ribosome 5' small subunit AP Biology tRNA E P A 2005-2006 3' Put it all together… AP Biology 2005-2006 Any Questions?? AP Biology 2005-2006