* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Protein
RNA interference wikipedia , lookup
Bottromycin wikipedia , lookup
Gene regulatory network wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
RNA silencing wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Non-coding DNA wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Polyadenylation wikipedia , lookup
List of types of proteins wikipedia , lookup
Molecular evolution wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Biochemistry wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Messenger RNA wikipedia , lookup
Non-coding RNA wikipedia , lookup
Expanded genetic code wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Gene expression wikipedia , lookup
DNA Transcription and Translation Sections 12.3 and 12.4 Do Now 1. What is RNA? 2. What are proteins used for in our bodies? 3. Fill in the chart below: DNA RNA TACGA TACGA Structure Sugar Base Example strand: Complimentary: Gene Segment of DNA that codes for a protein The Central Dogma of Biology: DNA codes for RNA and RNA makes protein (the synthesis of) One Gene – One Enzyme The Beadle and Tatum experiment showed that one gene codes for one enzyme. One gene codes for one polypeptide. polypeptide - a chain of covalently bonded amino acids. (proteins are made of one or more polypeptide) Let’s make some observations about RNA’s structure RNA RNA stands for: Ribonucleic RNA acid is found: Nucleus and Cytoplasm RNA Structure Like DNA, RNA is made up of subunits called _____________, which are made of three parts: Sugar (ribose) Phosphate Nitrogen Base RNA’s Nitrogen Bases Adenine (A) Cytosine (C) Guanine (G) Uracil (U) There are 3 types of RNA: Messenger RNA (mRNA) – long strands of RNA nucleotides that are formed complementary to one strand of DNA. Transfer RNA (tRNA) – smaller segments of RNA nucleotides that transport amino acids to the ribosomes. Ribosomal RNA (rRNA) – associates with protein to form the ribosome. All RNA is … Single stranded Many different shapes “Cheap copy” of DNA Do Now 1. What is a protein made of? 2. Explain the process between DNA and proteins. Transcription First step in making proteins Process of taking one gene (DNA) and converting into a mRNA strand DNA -> RNA Location: Nucleus of the cell Steps to Transcription 1. An enzyme attaches to the promoter (start signal region) of a gene and unwinds the DNA Steps to Transcription (Cont.) 2. One strand acts as a template. Steps to Transcription (Cont.) 3. A mRNA copy is made from the DNA template strand by RNA polymerase 4. A mRNA copy is made until it reaches the termination (stop signal) sequence 5. The two strands of DNA rejoin. Template vs. Non Template Strand Transcription animation https://www.youtube.com/watch?v=ztPkv7wc3yU Transcribe this DNA to mRNA mRNA Processing Pre-mRNA – the original sequence of RNA created during transcription mRNA reaches the ribosomes RNA Processing What is RNA Processing? After transcription the pre-mRNA molecule undergoes processing 5’ cap is added Poly A tail is added to the 3’ end Introns are removed. Do Now Label the Transcription diagram RNA Processing In Eukaryotes only Introns- non-coded sections Exons- codes for a protein Before RNA leaves the nucleus, introns are removed and exons are spliced together A cap and poly A tail are added to ends of the sequence mRNA leaves the nucleus through the nuclear pores Why is it necessary to add the poly A tail and 5’ cap? Let’s try an activity (11.5) http://www2.pearsonsuccessnet.com/snpapp/iText/pro ducts/0-13-115075-8/index.html Pg. 339 Pg. 339 Let’s an example… Original DNA Sequence (DNA): 5’ GTACTACATGCTATGCAT 3’ Translate it (RNA): 3’ CAUGAUGUACGAUACGUA 5’ Add the 5’ cap: 3’ CAUGAUGUACGAUACGUA 5’ cap Finish the job! Remove the introns “UGUA” and “AUAC”: 3’ CAUGAUGUACGAUACGUA 5’ 3’ CAUGACGGUA 5’ cap Add a poly A tail onto the 3’ end Poly A tail 3’ CAUGACGGUA 5’ cap cap Get a new partner! DNA Strand of non-template strand: 5’ ATCGGTAGAGTATTTACAGATA 3’ Remove introns: CGGUA UUACAG Think, Pair, Share Take a minute think on your own, then pair with your partner, and share your ideas! Evolutionary, why do you think there are introns? Where did they come from? Why do we have them? Remember there is NO wrong answer! PROTEINS! Proteins are made up of amino acids!!! Proteins are polymers of amino acids Only 20 different amino acids BUT there are hundreds of thousands of different proteins How can this be? Let’s compare to it to the English language How many letters are in the alphabet? A,b,c,d,… 26 How many words are there? Miss, Ings, is, smart, .. Almost infinite! Each word has a unique structure of letters. Similar to proteins and amino acids Proteins- (PCFNa) -made of 20 different Amino Acids - Amino Acids bond to form polypeptide chains How do amino acids form these peptide chains? Peptide Bonds – Link each amino acids together to form proteins How many amino acids are in a dipeptide chain? How about a tripeptide chain? How many water molecules are formed from 2 amino acids? How many water molecules are formed from 100 amino acids? Do Now Perform transcription on this DNA segment: GCTTCATACGA Do RNA processing and remove the introns: GAA and UGC How does this mRNA sequence leave the nucleus? Where does it go? Protein Structure http://www3.interscience.wiley.com:8100/legacy/college/boyer/0471661791/structure/HbMb/hbmb.htm Translation Production of proteins from mRNA mRNA goes to the ribosomes in the cytoplasm or the RER and produces proteins Steps to Translation 1. mRNA leaves the nucleus and binds to a ribosome 2. the 5’ end of mRNA binds to ribosome Ribosome Two subunits to the ribosome 3 grooves on the ribosome (A, P, E) A: tRNA binding site P: polypeptite bonding site E: exit site Steps to Translation (Cont.) 3. Ribosome looks for the start Codon (AUG) Codon: group of 3 nucleotides on the messenger RNA that specifies one amino acid (64 different codons) Steps to Translation (Cont.) 4. Amino acids attached to a tRNA molecule and are brought over to the mRNA. 5. This tRNA has an anticodon that matches the codon on the mRNA strand Anticodon: Group of 3 unpaired nucleotides on a tRNA strand. (binds to mRNA codon) tRNA Think-Pair-Share The mRNA sequence reads the following codons: What amino acids do they stand for? AUG GGA GAG CAA ** What amino acid does the anticodon CGU stand for?*** Steps to Translation (Cont.) 6. tRNA binds to the mRNA sequence and adds an amino acid 7. Each amino acid matches up with 1-6 tRNA molecules 8. tRNA leaves and amino acids bond together through a polypeptide bond Think – Pair - Share Find the amino acid sequence for the following mRNA sequence (translation) AUGCGACGAAUUUAA Translation Animations http://wwwclass.unl.edu/biochem/gp2/m_biology/animation/gene /gene_a3.html http://www.stolaf.edu/people/giannini/flashanimat/m olgenetics/translation.swf Steps to Translation (Cont.) 9. The mRNA sequence continues until a stop codon is reached. 10. The amino acids disconnect from the mRNA sequence and a protein is formed. Think-Pair-Share Get with a partner, one partner transcribes and the other translates. Do Now Do transcription on this DNA sequence: CGTACGCTCCCTAGACTA Do Translation- Remember to start the right place! Do Now Do transcription on this DNA sequence: TTTTATACTGAGGGTTAACTCGT Do Translation- Remember to start the right place! 1. 2. 3. 4. 5. 6. 1. Initiation The two ribosomal subunits come together with the mRNA and the first tRNA molecule which attaches to the start codon (AUG). This is the only tRNA that will attach to the P site. The first amino acid is always methionine. 2. Codon Recognition The tRNA anticodon will hydrogen bind to the mRNA codon in the A site. 3. Bond Formation The amino acid in the P site will form a peptide bond with the amino acid in the A site. 4. Translocation The tRNA's and the mRNA move down one site. The empty tRNA is released from the exit site. 5. Repeat This process will repeat hundreds of times. 6. Termination Translation is terminated with the stop codon is reached. There are three different stop codons UGA, UAA, UAG. The release factor recognizes the stop codon and releases the polypeptide strand. All the factors break apart and are reused. Do Now Take the following amino acid sequence, do reverse transcription and translation (find RNA and DNA). Methionine, Arginine, Alanine, Serine, Tryptophan, Tyrosine, Leucine, Valine, stop What do you notice about your DNA sequences? Do Now Template strand of DNA: 5’ TTACGGCTAGGAGTAGCCGAATTCTG 3’ Remove the introns: CUCAUC Determine protein sequence Do Now How do cells know what protein to make when? Gene Regulation: ability of an organism to control which genes are transcribed. Controlling Transcription Transcription factors ensure that a gene is used at the right time and that protein are made in the right amounts The complex structure of eukaryotic DNA also regulate transcription. HOX Genes Everyone develops from a zygote Zygote undergoes mitosis Cell differentiation: cells become specialized Certain gene sequences determine cell differentiation HOX Genes Homeobox Genes (Hox Genes) are sequences of DNA Hox genes are responsible for the general body pattern of most animals. HOX Genes Are transcribed at specific times, and located in specific places on the genome Mutations: Telephone We are going to play the game telephone. Every time a DNA makes a copy (spreading of a message), mutations can happen (mistakes in a message) Mistakes in DNA Cell make mistakes in replication, and transcription Most often these mistakes are fixed EX. Mutations A permanent change that occurs in a cell’s DNA is called a mutation. Three types of mutations: Point mutation Insertion Deletion Point Mutation Substitution: A change in just one base pair Missense Mutation: amino acid is change Nonsense Mutation: amino acid is changed to a stop codon Frameshift Mutations Causes the reading frame to shift to the left or the right Insertion: Addition of a nucleotide Deletion: Removal of a nucleotide ACGAAATACAGACAT Decide what type of mutation occurred: ACGAAATAGAGACAT ACAAATACAGACAT ACGAAATACAGGACAT Causes of Mutations Mutations can happen spontaneously Mutagens: Certain chemicals or radiation that can cause DNA damage Causes bases to mispair and bond with the wrong base High-energy forms of radiation, such as X rays and gamma rays, are highly mutagenic. Sex Cell vs. Somatic Cell Mutations Somatic cell mutations are not passed on to the next generation. Mutations that occur in sex cells are passed on to the organism’s offspring and will be present in every cell of the offspring Chromosomal Mutations Piece of chromosome can be broken off, duplicated, or moved to another chromosome Fragile X Syndrome Repeat of CGG about 30 times Causes mental and behavior impairments Protein Folding and Stability Substitutions also can lead to genetic disorders. Ex. Sickle Cell Anemia (caused by a substitution mutation) Can change both the folding and stability of the protein Sickle Cell Anemia Causes of Mutations Mutations can happen spontaneously Mutagens: Certain chemicals or radiation that can cause DNA damage Causes bases to mispair and bond with the wrong base High-energy forms of radiation, such as X rays and gamma rays, are highly mutagenic. Sex Cell vs. Somatic Cell Mutations Somatic cell mutations are not passed on to the next generation. Mutations that occur in sex cells are passed on to the organism’s offspring and will be present in every cell of the offspring