* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download What is RNA, and How Does it Differ from DNA?
Gene regulatory network wikipedia , lookup
Epitranscriptome wikipedia , lookup
Genome evolution wikipedia , lookup
RNA silencing wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Molecular cloning wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Expanded genetic code wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
List of types of proteins wikipedia , lookup
Community fingerprinting wikipedia , lookup
Non-coding RNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Biochemistry wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Gene expression wikipedia , lookup
Molecular evolution wikipedia , lookup
Genetic code wikipedia , lookup
Deoxyribozyme wikipedia , lookup
What is DNA, and How is it Used in Today’s Society? • Deoxyribonucleic Acid (DNA) – DNA is found in all living things (all life related?) – The hereditary material; found in the nucleus of eukaryotes (copied before each cell division; passes codes for physical traits to offspring) – Today, segments of DNA (genes) can be manipulated, and can be removed from/inserted into organisms (biotechnology, transgenic organisms) – Your DNA code is unique (excl. identical twins) criminal and paternity applications – Genetic diseases linked to various genes genetic screenings and counseling Figure 16.2 Figure 16.4 What is the Structure of DNA, and How is it Copied Before Cell Division? • Structure of DNA – A polymer, composed of nucleotides (which consist of a sugar, a phosphate group, and a nitrogenous base) • Sugar is deoxyribose • Nitrogenous bases: guanine, cytosine, adenine, and thymine – Double-stranded molecule, wound in helix (Watson, Crick, and Wilkins Nobel Prize) • Two strands joined by hydrogen bonds (two bonds between T/A; three bonds between C/G); unzip at high temperature or via enzyme action • DNA Replication (occurs during S-phase) – Code of new strand based on original template – Enzymes involved: DNA Polymerase, Helicase Figures 16.1 and 16.5 Figure 16.6 Figure 16.7 Figure 16.8 Figure (page 310) Figure 16.9 Figures 16.10 and 16.11 Figure 16.13 Figure 16.14 Figure 16.17 What is RNA, and How Does it Differ from DNA? • Ribonucleic Acid – the Messenger Molecule (and the Original Information Molecule) – Single-stranded molecule; but can take threedimensional shapes (stem loops, hairpins) – Sugar is ribose; bases: guanine, cytosine, adenine, and uracil (vs. thymine of DNA) – Three functional types (based on shapes) • Messenger RNA (m-RNA): transmits message of gene • Transfer RNA (t-RNA): 20 types (one for each of the 20 types of amino acids); work like enzymes • Ribosomal RNA (r-RNA): associated with proteins to form ribosomes Figure 5.27 RNA HAIRPINS AND STEM LOOPS RNA Hairpins: AGCCCGGUUCGAACCGGGCU AGCCCGGUUC-I UCGGGCCAAG-I --------------------------------------------------------------------------------------------------- RNA Stem Loops: AGCCCGGUUUUUUCCGGGCU UUU AGCCCGGI U UCGGGCCI U U What is the Role of RNA in Gene Expression? • Gene Expression: Gene (DNA) message (m-RNA) polypeptide (protein) TRANSCRIPTION TRANSLATION • Transcription (gene m-RNA) – Occurs in nucleus – Nucleotide sequence of m-RNA based on code of DNA (gene) • RNA polymerase enzyme involved in process – In eukaryotes, m-RNA often edited into exons and introns; exons processed into mature m-RNA that enters cytoplasm and is used for protein synthesis Figure 17.3 Figure 17.7 Figures 17.9 and 17.10 Figures 17.11 and 17.12 How are Proteins Synthesized Based on Genetic Instructions? • Translation (Protein synthesis: m-RNA polypeptides) – Occurs at ribosomes (in rough ER or cytoplasm) – t-RNA, bound to amino acids, associates with ribosome – Order of amino acids determined by GENETIC CODE: m-RNA codons (base triplets) bind to anticodons of t-RNAs; amino acids join (peptide bonds) to form polypeptides – Polyribosomes found in cells that exhibit high levels of protein synthesis (when many copies of same polypeptide are routinely synthesized) Figures 17.13 and 17.14 Figure 17.4 and 17.5 Figure 17.16 Figure 17.17 Figure 17.18 Figure 17.19 Figure 17.20 Overview of Gene Expression AAAACTCCCGGTATGAACCATATAT start stop TRANSCRIPTION GAGGGCCAUACUUGG TRANSLATION glu – gly – his – thr – try Figure 17.25 What are Genetic Mutations, and What are Their Effects? • Mutations: changes in DNA code; occur during replication – Genetic Code with “wobbly” third base • If AUU mutates to AUC? no effect • If AUU mutates to ACU? threonine replaces isoleucine – Change in amino-acid sequence may or may not change function of protein; typically involves changes in shape or charge – Point mutations: change in one base (often random; mutation rates can be increased by mutagens) • If wobble effect, no change in amino acid • Enzymes repair mutations at given rate, can be “overwhelmed” • Ex. Sickle-cell anemia: one of 146 amino acids in hemoglobin protein “in error” – Frame-shift mutations: large-scale error; shift in code • Genetic Cancers – Breast, ovarian, and colon cancers run in families (among others) – Oncogenes: genes that are associated with high rates of cancers – Tumor-suppressor genes: if mutated, more likely to develop cancer Figure 17.23 Figure 18.22