* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Chapter 17.
Transcription factor wikipedia , lookup
RNA interference wikipedia , lookup
Gene expression profiling wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
List of types of proteins wikipedia , lookup
Biochemistry wikipedia , lookup
Community fingerprinting wikipedia , lookup
RNA silencing wikipedia , lookup
Gene regulatory network wikipedia , lookup
Non-coding DNA wikipedia , lookup
Molecular evolution wikipedia , lookup
Polyadenylation wikipedia , lookup
Point mutation wikipedia , lookup
Expanded genetic code wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genetic code wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Messenger RNA wikipedia , lookup
Non-coding RNA wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Chapter 17. From Gene to Protein MCC BP Based on work by K. Foglia www.kimunity.com Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins A MCC BP alkaptonuria (black urine from alkapton) PKU (phenylketonuria) Genes create phenotype each disease is caused by non-functional enzyme B C D E Based on work by K. Foglia www.kimunity.com MCC BP Based on work by K. Foglia www.kimunity.com 1 gene – 1 enzyme hypothesis Beadle & Tatum Compared mutants of bread mold, Neurospora fungus created mutations by X-ray treatments X-rays break DNA inactivate a gene wild type grows on “minimal” media sugars + required precursor nutrient to synthesize essential amino acids mutants require added amino acids each type of mutant lacks a certain enzyme MCC BP needed to produce a certain amino acid non-functional enzyme = broken gene Based onwww.kimunity.com work by K. Foglia 1941 | 1958 Beadle & Tatum George Beadle Edward Tatum MCC BP Based on work by K. Foglia www.kimunity.com Beadle & Tatum’s Neurospora experiment MCC BP Based on work by K. Foglia www.kimunity.com So… What is a gene? One gene – one enzyme One gene – one protein but many genes only code for RNA One gene – one product MCC BP but many proteins are composed of several polypeptides but each polypeptide has its own gene One gene – one polypeptide but not all proteins are enzymes but all proteins are coded by genes but many genes code for more than one product … Where does that leave us?! Based on work by K. Foglia www.kimunity.com Defining a gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” RNA gene – Elizabeth Pennisi, Science 2003 polypeptide 1 gene polypeptide 2 MCC BP polypeptide 3 It’s hard to hunt for wabbits, if you don’t know what a wabbit looks like. Based on work by K. Foglia www.kimunity.com The “Central Dogma” How do we move information from DNA to proteins? transcription DNA replication MCC BP translation RNA protein For simplicity sake, let’s go back to genes that code for proteins… Based on work by K. Foglia www.kimunity.com From nucleus to cytoplasm… Where are the genes? Where are proteins synthesized? proteins made in cytoplasm by ribosomes How does the information get from nucleus to cytoplasm? MCC BP genes are on chromosomes in nucleus messenger RNA nucleus Based on work by K. Foglia www.kimunity.com RNA ribose sugar N-bases uracil instead of thymine U : A C : G single stranded mRNA, rRNA, tRNA, siRNA…. transcription DNA MCC BP RNA Based on work by K. Foglia www.kimunity.com Transcription Transcribed DNA strand = template strand Synthesis of complementary RNA strand transcription bubble Enzyme MCC BP untranscribed DNA strand = coding strand RNA polymerase Based on work by K. Foglia www.kimunity.com Transcription in Prokaryotes Initiation RNA polymerase binds to promoter sequence on DNA Role of promoter 1. Where to start reading = starting point 2. Which strand to read = template strand 3. Direction on DNA = always reads DNA 3'5' MCC BP Based on work by K. Foglia www.kimunity.com Transcription in Prokaryotes MCC BP Promoter sequences RNA polymerase molecules bound to Based on work by K. Foglia bacterial DNA www.kimunity.com Transcription in Prokaryotes Elongation RNA polymerase unwinds DNA ~20 base pairs at a time reads DNA 3’5’ builds RNA 5’3’ (the energy governs the synthesis!) No proofreading 1 error/105 bases many copies short life not worth it! MCC BP Based on work by K. Foglia www.kimunity.com Transcription RNA MCC BP Based on work by K. Foglia www.kimunity.com Transcription in Prokaryotes Termination RNA polymerase stops at termination sequence mRNA leaves nucleus through pores RNA GC hairpin turn MCC BP Based on work by K. Foglia www.kimunity.com Transcription in Eukaryotes MCC BP Based on work by K. Foglia www.kimunity.com Prokaryote vs. Eukaryote genes Prokaryotes Eukaryotes DNA in cytoplasm circular chromosome naked DNA no introns DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence MCC BP Based on work by K. Foglia www.kimunity.com Transcription in Eukaryotes 3 RNA polymerase enzymes RNA polymerase I RNA polymerase I I MCC BP transcribes genes into mRNA RNA polymerase I I I only transcribes rRNA genes only transcribes rRNA genes each has a specific promoter sequence it recognizes Based on work by K. Foglia www.kimunity.com Transcription in Eukaryotes Initiation complex transcription factors bind to promoter region upstream of gene MCC BP proteins which bind to DNA & turn on or off transcription TATA box binding site only then does RNA polymerase bind to DNA Based on work by K. Foglia www.kimunity.com Post-transcriptional processing Primary transcript eukaryotic mRNA needs work after transcription Protect mRNA from RNase enzymes in cytoplasm add 5' cap mRNA 5' cap add polyA tail 5' G PPP CH 3' A 3 Edit out introns intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence primary mRNA transcript MCC BP mature mRNA transcript pre-mRNA Based on work by K. Foglia www.kimunity.com spliced mRNA Transcription to translation Differences between prokaryotes & eukaryotes time & physical separation between processes RNA processing MCC BP Based on work by K. Foglia www.kimunity.com Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing needed MCC BP Based on work by K. Foglia www.kimunity.com From gene to protein transcription DNA mRNA mRNA leaves nucleus through nuclear pores MCC BP nucleus translation a a a a protein a ribosomea cytoplasm a a a a a a a a a a proteins synthesized by ribosomes using Based on work by K. Foglia www.kimunity.com instructions on mRNA How does mRNA code for proteins? DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC ? protein MCC BP Met Arg Val Asn Ala Cys Ala How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? Based on work by K. Foglia www.kimunity.com Cracking the code 1960 | 1968 Nirenberg & Matthaei determined 1st codon–amino acid match UUU coded for phenylalanine created artificial poly(U) mRNA added mRNA to test tube of ribosomes, tRNA & amino acids mRNA synthesized single amino acid polypeptide chain phe–phe–phe–phe–phe–phe MCC BP Based on work by K. Foglia www.kimunity.com MCC BP Heinrich Matthaei Based on work by K. Foglia www.kimunity.com Marshall Nirenberg Translation Codons MCC BP blocks of 3 nucleotides decoded into the sequence of amino acids Based on work by K. Foglia www.kimunity.com mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC ? protein MCC BP Met Arg Val Asn Ala Cys Ala Based on work by K. Foglia www.kimunity.com The code For ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid Why is this a good thing? Start codon AUG methionine Stop codons MCC BP UGA, UAA, UAG Based on work by K. Foglia www.kimunity.com How are the codons matched to amino acids? DNA mRNA 3' 5' 5' 3' TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC codon 3' tRNA UAC amino acid Met MCC BP 5' GCA Arg CAU Val anti-codon Based on work by K. Foglia www.kimunity.com aa aa aa cytoplasm transcription translation aa aa aa aa aa protein aa aa aa nucleus MCC BP Based on work by K. Foglia www.kimunity.com tRNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3' end MCC BP Based on work by K. Foglia www.kimunity.com Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA endergonic reaction energy stored in tRNA-amino acid bond MCC BP ATP AMP unstable so it can release amino acid at ribosome Based on work by K. Foglia www.kimunity.com Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits MCC BP large small Based on work by K. Foglia www.kimunity.com Ribosomes P site (peptidyl-tRNA site) A site (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain E site (exit site) MCC BP holds tRNA carrying growing polypeptide chain empty tRNA leaves ribosome from exit site Based on work by K. Foglia www.kimunity.com Building a polypeptide Initiation MCC BP brings together mRNA, ribosome subunits, proteins & initiator tRNA Elongation Termination Based on work by K. Foglia www.kimunity.com Elongation: growing a polypeptide MCC BP Based on work by K. Foglia www.kimunity.com Termination: release polypeptide Release factor “release protein” bonds to A site bonds water molecule to polypeptide chain Now what happens to the polypeptide? MCC BP Based on work by K. Foglia www.kimunity.com Protein targeting Signal peptide address label Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm start of a secretory pathway MCC BP Based on work by K. Foglia www.kimunity.com RNA polymerase DNA Can you tell the story? amino acids exon intron tRNA pre-mRNA 5' cap mature mRNA aminoacyl tRNA synthetase polyA tail large subunit polypeptide ribosome 5' small subunit MCC BP tRNA E P A Based on work by K. Foglia www.kimunity.com 3' Put it all together… MCC BP Based on work by K. Foglia www.kimunity.com Any Questions?? MCC BP Based on work by K. Foglia www.kimunity.com