Download Charakterisierung peroxisomaler und Lipid

Charakterisierung peroxisomaler und Lipid-Droplet
assoziierter Proteine der Hefe Saccharomyces cerevisiae
Dissertation zur Erlangung des Grades
eines Doktors der Philosophie
der Fakultät für Biologie und Biotechnologie
der Ruhr-Universität Bochum
Internationalen Graduiertenschule Biowissenschaften
der Ruhr-Universität Bochum
Abteilung für Systembiochemie
vorgelegt von
Dipl.-Biol. & Biochem. Mykhaylo O. Debelyy
aus
Dnepropetrovsk, Ukraine
Bochum
Juli, 2011
Zusammenfassung
In der vorliegenden Arbeit wurden Peroxisomen und Lipid-Droplet assoziierte
Proteine der Hefe S. cerevisiae untersucht. Lpx1p und Ldh1p sind putative Hydrolasen
und/oder Lipasen von Peroxisomen beziehungsweise Lipid-Droplets; Pex1p und Pex6p
sind peroxisomale AAA Proteine und Ubp15p stellt ein deubiquitinilierendes Enzym
dar.
Es konnte gezeigt werden, dass Lpx1p in Peroxisomen lokalisiert ist, wo
hingegen Ldh1p überwiegend zu Lipid-Droplets dirigiert wird. Lpx1p wie auch Ldh1p
besitzen das für Lipasen der a/ß-Hydrolase-Familie typische Sequenzmotiv GXSXG.
Beide Proteine tragen ein putatives, peroxisomales Typ 1 targeting Signal (PTS1) und
weisen untereinander zwei homologe Bereiche auf. Während gezeigt werden konnte, das
es sich bei Lpx1p um ein peroxisomales Enzym handelt, wurde anhand subzellulärer
Lokalisationsstudien für Ldh1p eine überwiegende Lokalisation an Lipid-Droplets
dargelegt. Für Lpx1p konnte ferner gezeigt werden, das dessen Lokalisation vom PTS1Rezeptor Pex5p abhängt. Ferner konnte für Lpx1p ein Huckepack-Transport in die
Peroxisomen gezeigt werden. Dem gegenüber ist der Transport von Ldh1p zu den LipidDroplets unabhängig von dessen PTS1.
Für Lpx1p und Ldh1p konnte in vitro mittels rekombinanter Proteine eine
Triacylglycerol-Lipase wie auch–hydrolase Aktivität belegt werden. Es konnte gezeigt
werden, dass Lpx1p nicht für das Vorhandensein funktioneller Peroxisomen benötigt
wird, ein Umstand der eher auf eine metabolische als auf eine Biogenesefunktion des
Proteins hinweist. Ldh1p ist hingegen notwendig für die Aufrechterhaltung normaler
Konzentrationen an nicht-polaren und polaren Lipiden in den Lipid-Droplets. Ein
Charakteristikum der Δldh1-Mutante ist das Auftreten übergroßer Lipid-Droplets sowie
einer übermäßigen Akkumulation nicht-polarer Lipide und Phospholipiden nach
Wachstum auf Medium mit Ölsäure als alleinige Kohlenstoffquelle. Basierend auf den
Daten wird eine Funktion von Ldh1p in der Aufrechterhaltung der Lipid-Homeostase in
der Hefe durch die Regulation des Spiegels an Phospholipiden wie auch nicht-polaren
Lipiden diskutiert.
Der peroxisomale Matrix Proteinimport wird durch zyklisierende Rezeptoren
ermöglicht, die zwischen dem Zytosol und der peroxisomalen Membran pendeln. Die
Ubiquitinilierung des Rezeptors dient dabei als dessen Exportsignal. Ein entscheidender
Schritt innerhalb dieses Zyklus ist die ATP-abhängige Ablösung des Rezeptors von der
peroxisomalen Membran. Dieser Schritt wird durch die peroxisomalen AAA ATPasen
Pex1p und Pex6p bewerkstelligt. In der vorliegenden Arbeit konnte gezeigt werden, dass
der AAA-Komplex sowohl die Pex5p-Dislokaseaktivität wie auch eine
deubiquitinilierende Aktivität beinhaltet. Im Einklang mit dieser Beobachtung konnte
Ubp15p, eine Ubiquitin-Hydrolase, als neuer Bestandteil des AAA-Komplexes
identifiziert werden. Ubp15p ist partiell peroxisomal lokalisiert und in der Lage
Ubiquitinreste vom modifizierten PTS1-Rezeptor Pex5p abzuspalten. Des Weiteren
weisen Ubp15p-defiziente Zellen einen stress-induzierten PTS1-Importdefekt auf. Diese
Ergebnisse führen zu dem Modell nachdem die Entfernung des Ubiquitins von Pex5p
ein spezifisches Ereignis darstellt welches ein wesendlicher Schritt im RezeptorRecycling darstellt.
ABKÜRZUNGSVERZEICHNIS
AAA
ATP
ATPases Associated with various cellular Activities
Adenosine triphosphate
BPC
1,2-bis-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-sindacene-3undecanoyl)-sn-glycero-3-phosphocholine (bis-BODIPY-FL C11-PC)
Cell division cycle 48 protein
Candida rugosa lipase
1,2-O-dilauryl-rac-glycero-3-glutaric acid (6-methyl resorufin) ester
1,2-dioleoyl-3-(pyren-1-yl) decanoyl-rac-glycerol
Cdc48p
CRL
DGR
DPG
DUB
ERAD
GFP
Deubiquitinating enzyme
Green Fluorescence Protein
E1
E2
E3
Ubiquitin-activating enzymes
Ubiquitin-conjugating enzymes
Ubiquitin ligases
E. coli
min
ml
NPL
NSF
Escherichia coli
Minutes
Millilitre
Non-polar lipids
N-ethylmaleimide sensitive factor (fusion protein)
NTD
N-terminal domain
pex
PC
PE
PL
PLA
PLC
PLD
PMPs
peroxisome assembly
Phosphatidylcholine
Phosphatidylethanolamine
Polar lipids
Phospholipase A
Phospholipase C
Phospholipase D
Endoplasmic-Reticulum-Associated protein Degradation
PNB
Peroxisome Membrane Proteins
p-Nitrophenyl butyrate
PNS
ProtA
PTS
RING
post nuclear supernatant
Protein A
Peroxisomal Targeting Signal
really interesting new gene
SRH
Second region of homology
TEV
Ub
Tobacco Etch virus
Ubiquitin
Ubc
VCP
Ubiquitin-conjugating enzyme
Valosin-containing protein
Characterization of peroxisome- and lipid droplet-related
proteins of Saccharomyces cerevisiae
Dissertation to obtain the degree
Doctor Philosophiae (Doctor of Philosophy, PhD)
at the Faculty of Biology and Biotechnology
Ruhr-University Bochum
International Graduate School of Biosciences
Ruhr-University Bochum
Department of Systems Biochemistry
submitted by
Dipl.-Biol. & Biochem. Mykhaylo O. Debelyy
from
Dnepropetrovsk, Ukraine
Bochum
July, 2011
ERKLÄRUNG
Hiermit erkläre ich, dass ich die Arbeit selbständig verfasst und bei keiner anderen Fakultät
eingereicht und dass ich keine anderen als die angegeben Hilfsmittel verwendet habe. Es
handelt sich bei der heute von mir eingereichten Dissertation um sechs in Wort und Bild
völlig übereinstimmende Exemplare.
Weiterhin erkläre ich, dass digitale Abbildung nur die originalen Daten enthalten und in
keinem Fall inhaltsverändernde Bildbearbeitung vorgenommen wurde.
Bochum, den
_______________________________________
(Unterschrift)
Vorsitzender der Prüfungskommission:
Prof. Dr. Franz Narberhaus (Fakultät für Biologie, RUB)
1. Gutachter: Prof. Dr. Ralf Erdmann (Medizinische Fakultät, RUB)
2. Gutachter: Prof. Dr. Ulrich Kück (Fakultät für Biologie, RUB)
3. Gutachter: PD Dr. Mathias Lübben (Fakultät für Biologie, RUB)
INDEX__________________________________________________________________
INDEX
3
CHAPTER 1. INTRODUCTION
ABSTRACT
1.1
Biology of peroxisomes
1.1.1 Structure and function of peroxisomes
1.1.2 Biogenesis of peroxisomes
1.1.3 Posttranslational modifications of peroxins
1.1.4 Peroxisomal AAA-ATPase peroxins
1.2
Biology of lipid droplets
1.2.1 Structure and function of lipid droplets
1.2.2 Biogenesis of lipid droplets
1.2.3 Interactions between peroxisome and lipid droplets
1.3
Objectives
4
5
5
5
7
12
14
19
19
21
22
24
CHAPTER 2. ORIGINAL WORKS
2.1
Biology of peroxisomes
2.1.1 Lpx1p is a peroxisomal lipase required for normal peroxisomes
morphology
2.1.2 The AAA peroxins Pex1p and Pex6p function as dislocases for the
ubiquitinated peroxisomal import receptor Pex5p
2.1.3 Ubp15p, an ubiquitin hydrolase associated with the peroxisomal
export machinery
2.2
Biology of lipid droplets
2.2.1 The putative Saccharomyces cerevisiae hydrolase Ldh1p is
localized to lipid droplets
2.2.2 Involvement of the Saccharomyces cerevisiae hydrolase Ldh1p
in lipid homeostasis
25
25
CHAPTER 3. DISCUSSION
3.1
Novel hydrolases of S. cerevisiae
3.2
Ubp15p, a novel compound of AAA-complex
77
77
83
CHAPTER 4. REFERENCES
90
CHAPTER 5. MISCELLANEOUS
5.1
Publications
5.2
Personal contribution to the papers
5.3
Conferences
5.4
Curriculum Vitae
5.5
Acknowledgement
5.6
Global scientific outlook for human race
104
104
105
106
107
108
109
25
36
42
65
65
71
3
CHAPTER 1. INTRODUCTION_____________________________________________
4
ABSTRACT
The peroxisomal and lipid droplets related proteins of yeast S. cerevisiae were
characterized in this work. Lpx1p and Ldh1p are putative hydrolases and/or lipases of
peroxisome and lipid droplets respectively; Pex1p and Pex6p are peroxisomal AAA
ATPases; and Ubp15p is a deubiquitinating enzyme.
It was shown that Lpx1p is present in the peroxisome but Ldh1p is
predominantly localized to lipid droplets. Lpx1p as well as Ldh1p comprises the typical
GXSXG-type lipase motif of members of the α/β-hydrolase family. Both proteins carry a
putative peroxisomal targeting signal type-1 (PTS1) and can be aligned with two regions
of homology. While Lpx1p was shown to be a peroxisomal enzyme, subcellular
localization studies revealed that Ldh1p is predominantly localized to lipid droplets. It
was shown that Lpx1p import is dependent on the PTS1 receptor Pex5p. Moreover, it
was shown that Lpx1p is piggyback-transported into peroxisomes. But it was
demonstrated that targeting of Ldh1p to lipid droplets occurs independently of the PTS1
receptor Pex5p.
Triacylglycerol lipase as well as hydrolase activities were shown for both
recombinant proteins Lpx1p and Ldh1p in vitro. It was shown that the Lpx1p protein is
not required for wild-type-like steady-state function of peroxisomes, which might be
indicative of a metabolic rather than a biogenetic role. It was clearly shown that
peroxisomes in Δlpx1 mutants have an aberrant morphology characterized by
intraperoxisomal vesicles or invaginations. It was shown that Ldh1p is not required for
the function and biogenesis of peroxisomes. Ldh1p is required for the maintenance of a
steady-state level of the nonpolar and polar lipids of lipid droplets. A characteristic
feature of the Δldh1 strain is the appearance of giant lipid droplets and an excessive
accumulation of nonpolar lipids and phospholipids upon growth on medium containing
oleic acid as a sole carbon source. Ldh1p is thought to play a role in maintaining the
lipid homeostasis in yeast by regulating both phospholipid and nonpolar lipid levels.
It is known that the peroxisomal matrix protein import is facilitated by cycling
receptors shuttling between the cytosol and the peroxisomal membrane. One crucial step
in this cycle is the ATP-dependent release of the receptors from the peroxisomal
membrane. This step is facilitated by the peroxisomal AAA ATPases Pex1p and Pex6p
with ubiquitination of the receptor being the main signal for its export. It was shown in
this work that the AAA-complex contains Pex5p dislocase as well as deubiquitinating
activity. Ubp15p, an ubiquitin hydrolase, was identified as novel constituent of the
complex. Ubp15p partially localizes to peroxisomes and is capable to cleave off
ubiquitin-moieties from the PTS1-receptor Pex5p. Furthermore, Ubp15p-deficient cells
are characterized by a stress related PTS1-import defect. The results merge to a picture
in which removal of ubiquitin of the PTS1-receptor Pex5p is a specific event and might
represent a vital step in receptor recycling.
CHAPTER 1. INTRODUCTION_____________________________________________
5
CHAPTER 1. INTRODUCTION
1.1
Biology of peroxisomes
1.1.1 Structure and function of peroxisomes
Peroxisomes or microbodies are a class of structurally and functionally related ubiquitous
eukaryotic organelles that are involved in lipid and antioxidant metabolism (179). Originally
these structures were described as cellular organelles in 1966 by C. de Duve and P. Baudhuin
(33) after they had been first mentioned in a PhD thesis of J. Rhodin a more than a decade
earlier (177). Generally, peroxisomes are spherical organelles with diameter from 0.1 to 1 µm
envelop by a single phospholipid bilayer membrane (218) (Fig. 1.1.1.1).
Fig. 1.1.1.1 Induction of peroxisomes in yeast S. cerevisiae by oleic acid. Localization and
morphology of peroxisome. (A) Red staining: labeling of peroxisome by DsRed-PTS2; Green
staining: partial labeling of peroxisome by GFP-Ubp15p; (B) Electron microscopy image of
wild-type; (C) Electron microscopy image of peroxisome free mutant (Δpex19); C, cytosol;
ER, endoplasmic reticulum; L, lipid droplets; M, mitochondria; N, nucleus; P, peroxisome.
The peroxisome-family includes peroxisomes, glyoxysomes of plants and fungi, glycosomes
of trypanosomes, and Woronin-bodies of filamentous fungi (11, 138, 179) (Fig.1.1.1.2). The
unique variability in function of peroxisomes is displayed by an electron-dense proteinaceous
organellar matrix that contains no DNA (179), but is extremely variable in their enzyme
content, adjusted to metabolic functions according to the cellular needs.
CHAPTER 1. INTRODUCTION_____________________________________________
6
Fig. 1.1.1.2 Induction of peroxisomes in yeast species and filamentous fungi. Peroxisomes
can have highly variable sizes and shapes. Furthermore, they can be present in clusters but
can also be dispersed throughout the cytoplasm. A) Aspergillus tamarii cell grown on oleate
showing peroxisomes. In addition, Woronin bodies are present near the septum (arrow). Many
lipid bodies are present. B) Hansenula polymorpha cell from a methanol-limited chemostat.
More than 80% of the cell is filled with cuboid-shaped peroxisomes. C) Saccharomyces
cerevisiae cell grown on oleate showing clustered peroxisomes. D) Penicillium chrysogenum
hyphae producing the fluorescent peroxisomal protein green fluorescent protein-Ser-Lys-LeuCOOH (GFP-SKL). Cells were grown in penicillin-producing medium and treated with
Mitotracker Orange to stain the mitochondria. The bar represents 1 mm, unless indicated
otherwise. L, lipid body; M, mitochondrion; N, nucleus; P, peroxisome; V, vacuole. Taken
with modifications from (107).
The peroxisomal matrix harbours at least 50 different enzymes that are linked to
diverse biochemical pathways (96). The β-oxidation of fatty acids and the detoxification of
hydrogen peroxide are regarded as the central function of peroxisomes (191, 219). But there is
one exception: the Woronin-bodies, function of which is only the plugging of the septal pores
in case of hyphal injury. While the ß-oxidation in fungi and plants exclusively take place in
peroxisomes (179, 191, 219), in mammalian cells only the very long chain fatty acids are
oxidized in peroxisomes (97, 121). Moreover, peroxisomes are involved in the synthesis of
CHAPTER 1. INTRODUCTION_____________________________________________
7
plasmalogens (which contribute more than 80% of the phospholipid content of the white
matter in the brain), cholesterol and bile acids (17, 76, 118, 119) as well as the oxidation of
alcohols, metabolism of prostaglandins, catabolism of purines and polyamines, the main
reaction of photorespiration in plant leafs and final steps of penicillin biosynthesis in some
filamentous fungi (80, 153, 215, 216, 218). They are the source of signalling molecules such
as
jasmonates
in
plants
(36,
160,
225)
or
lipid-derived
ligands
for
PPARs
(peroxisomeproliferator-activated receptors) in humans (51).
The existence of severe inherited diseases in human caused by malfunctions in
peroxins, encoded by PEX genes, stimulates intensive research interest to the field of
peroxisome biogenesis. So far 34 peroxins were discovered to be involved in different stages
of peroxisome biogenesis (217). Human peroxisomal disorders can be categorized as either
single-enzyme disorders or peroxisomal biogenetic defects (229). Single-enzyme disorders,
such as for example Refsum disease is caused by a defect of phytanoyl-CoA hydroxylase,
whereas X-linked adrenoleukodystrophy is caused by a defect in a peroxisomal ATPtransporter. In contrast, biogenesis defects are mostly caused by mutations in the PEX genes
(211). Peroxisomal disorders are associated with morphological peroxisomal defects such as
inclusions or invaginations (56, 151).
1.1
Biology of peroxisomes
1.1.2 Biogenesis of peroxisomes
As peroxisomes do not contain genetic material, their protein content is determined by
the import of nuclear encoded proteins (26). Peroxisomes can multiply by division (152) or de
novo by budding from the endoplasmic reticulum (84, 123). Without exception, peroxisomal
matrix proteins are synthesized on free ribosomes and are subsequently imported in a posttranslational manner (136, 188). Like the sorting of proteins to other cellular compartments,
protein targeting to peroxisomes depends on signal sequences. Peroxisomal import of most
matrix proteins depends on the conserved PTS1 (peroxisomal targeting signal type 1) receptor
Pex5p, which recognizes the PTS1 localized at the very C-terminus of the cargo proteins
(170, 212). The three-amino-acid signal SKL (serine–lysine–leucine) was the first PTS1 to be
discovered, and is in many cases sufficient for directing a protein to peroxisomes. Based on
mutagenesis experiments, amino acid permutations and sequence comparisons between
different species, the PTS1 generally fits the consensus (S/A/C)-(K/R/H)-(L/M). A second
peroxisomal targeting signal (PTS2) (188) is present in considerably fewer peroxisomal
CHAPTER 1. INTRODUCTION_____________________________________________
8
proteins. PTS2 is usually located within the first 20 amino acids of the protein, and has been
defined as (RK)-(LVIQ)-XX-(LVIHQ)-(LSGAK)-X-(HQ)-(LAF) (166). PTS2-bearing
proteins are recognized by the cytosolic conserved receptor Pex7p (188).
Based on the concept of cycling receptors (38, 144), the matrix protein import can be
divided into four steps: 1) receptor-cargo recognition in the cytosol, 2) docking at the
peroxisomal membrane, 3) cargo-translocation and release, and 4) receptor release from the
membrane and recycling. After the cargo recognition by their cognate receptor in the cytosol
(72), in yeast the second step in receptor cycle is facilitated by Pex14p together with Pex13p
and Pex17p form the docking subcomplex at the peroxisomal membrane and interact in this
cycle with both soluble import receptors Pex5p and Pex7p (176) (Fig. 1.1.2.1).
Fig. 1.1.2.1 The receptor cycle. According to the model of the cycling receptor, the
peroxisomal protein import conceptually can be divided in five steps: (I) cargo recognition in
the cytosol and (II) docking of the receptor–cargo complexes to the peroxisomal membrane.
(III) Cargo-translocation into the peroxisomal matrix. (IV) Disassembly of the receptor–cargo
complex and (V) export of the receptor back to the cytosol. PTS1-containing proteins are
recognized by the soluble import receptor Pex5p in the cytosol. Proteins harbouring the PTS2
are recognized by Pex7p and the cofactors Pex18p and Pex21p in S. cerevisiae, the
orthologous Pex20p in other fungi or Pex5L in plants and mammals. After this step, the
receptor–cargo complex targets to and associates with the peroxisomal membrane via the
docking complex consisting of Pex14p, Pex13p and Pex17p. The transport of PTS1-proteins
across the membrane is facilitated by formation of a pore mainly consisting of Pex14p and
Pex5p. Pex8p connects the RING-complex to the docking complex. The three ubiquitin
ligases Pex2p, Pex10p and Pex12p form the RING-complex and together with ubiquitin
conjugating enzymes like Pex4p are responsible for receptor ubiquitination. In the last step of
the cycle, the receptor Pex5p is exported back to the cytosol by the two AAA-peroxins Pex1p
and Pex6p and is enabled for the next round of import. Taken from (179).
CHAPTER 1. INTRODUCTION_____________________________________________
9
It was demonstrated by using the yeast two-hybrid system and pull-down assays that yeast S.
cerevisiae Pex5p directly interacts with two separate regions of Pex14p, amino acid residues
1-58 and 235-308. The latter binding site at the C-terminus of Pex14p overlaps with a binding
site of Pex7p at amino acid residues 235-325 (158). The functional assessment of these two
binding sites of Pex14p with the PTS-receptors indicates that they have distinct roles.
Deletion of the N-terminal 58 amino acids caused a partial defect of matrix protein import in
Δpex14 cells expressing the Pex14-(59-341)-p fragment; however, it did not lead to a pex
phenotype. In contrast, truncation of the C-terminal 106 amino acids of Pex14p completely
blocked this process (158). It was proposed that the C-terminus of Pex14p contains the actual
docking site and that the N-terminus could be involved in a Pex5p-Pex14p association inside
the peroxisomal membrane (158).
The molecular mechanism of how the cargo proteins traverse the peroxisomal
membrane remains unclear. However, recent reports demonstrated the transient formation of a
dynamic pore which is adapted to the size of the cargo and could facilitate the translocation of
at least 9 nm particles (222).
The final step in the receptor cycle is the release of the receptor back to the cytsosol to
facilitate a new round of import. With respect to the PTS1-receptor Pex5p, recent reports
demonstrated that its dislocation from the peroxisomal membrane to the cytosol at the end of
the receptor cycle is ATP-dependent and catalyzed by the AAA-peroxins Pex1p and Pex6p
(150, 172). With this respect in accordance to the export-driven import model it is believed,
that the export of receptor delivers the energy for cargo-translocation (184).
Pex4p-catalysed mono-ubiquitination of Pex5p direct the receptor for recycling,
thereby enabling further rounds of matrix protein import, whereas Ubc4p-catalysed
polyubiquitination targets Pex5p to proteasomal degradation (44, 106, 171, 172).
The import of peroxisomal membrane proteins (PMPs) is differing from the import
machinery of peroxisomal matrix proteins (43, 68). This is in agreement with the fact that
most pex-mutants are distinguished by an affected import of matrix proteins but not affected
import of PMPs. In these mutants, the PMPs are imported in peroxisomal remnants, so called
ghosts (25, 183, 188). Only several mutants were characterized by the complete absence of
detectable peroxisomal membrane ghosts. Functional complementation of these mutants led
to the identification of Pex3p, Pex19p and in some organisms Pex16p which are involved in
the biogenesis of the peroxisomal membrane (10, 41, 60, 67, 88, 146, 179, 200) (Fig. 1.1.2.2).
CHAPTER 1. INTRODUCTION_____________________________________________ 10
Fig. 1.1.2.2 Topogenesis of peroxisomal membrane proteins. Two routes are proposed for
the targeting of peroxisomal membrane proteins (PMPs). Class I proteins are directly
imported into existing peroxisomes. Class II proteins are first targeted to ER where they
concentrate in pre-peroxisomal vesicles which then are targeted to existing peroxisomes or
function as an origin for de novo formation of peroxisomes. Currently, it is controversially
discussed whether class I PMPs are also targeted to the ER and whether class II PMPs are
also targeted to existing peroxisomes. Taken from (179).
Various roles have been suggested for Pex19p. Initially, due to its capacity to interact
with the majority of the peroxisomal membrane proteins (PMPs), and according, to its
multiple localization at the peroxisomal membrane and in the cytosol, Pex19p is considered to
be a soluble import receptor for newly synthesized PMPs (100, 185). As a consequence,
Pex19p binds PMPs in the cytosol and delivers them to the peroxisomal membrane by
docking to its membrane anchored binding partner Pex3p (67, 179) (Fig. 1.1.2.3).
Subsequent, Pex19p is additionally assumed to behave as a PMP-specific chaperone.
Correspondingly, Pex19p bear the capacity to adhere and sustain PMP by the development of
a soluble complex and in this manner anticipating conglomeration of the PMP (105, 192).
Also, Pex19p has possibility to function as an insertion factor during PMP import (54, 198) or
act as an assembly/disassembly factor for peroxisomal membrane complexes at the
peroxisomal membrane (52, 179). Recently, it was shown that Pex19p is required for the
transport of Pex3p from the endoplasmic reticulum (ER) to the peroxisomal membrane (84).
Pex3p is an integral membrane protein at the peroxisomal membrane with a topology distinct
all over species (60, 75, 93, 179, 199).
CHAPTER 1. INTRODUCTION_____________________________________________ 11
Fig. 1.1.2.4 Pex19p-dependent import of PMPs. Class I peroxisomal membrane proteins
(PMPs) harbour a peroxisomal membrane protein targeting signal (mPTS) which is
recognized in the cytosol by the import receptor and/or PMP-specific chaperone Pex19p, a
farnesylated, mostly cytosolic protein with a small portion of the protein found associated
with the peroxisomal membrane. In the next step, the cargo-loaded Pex19p docks to the
peroxisomal membrane via association with its docking factor Pex3p. Then the PMP is
inserted into the membrane in an unknown manner but presumably with assistance of Pex19p,
Pex3p and, in some organisms, Pex16p. The requirement of ATP for this process is not clear.
Finally, Pex19p shuttles back to the cytosol where it might start a new round of import. Taken
from (179).
In Saccharomyces cerevisiae, Pex3p bear an N-terminal transmembrane region and a large Cterminal domain to be turned toward the cytosolic side of the peroxisome (86, 179). Pex3p
performs a pivotal function in the import of PMPs at which point it assists as a docking factor
at the peroxisomal membrane and acts as binding partner for Pex19p-PMP-complexes
meanwhile import of the PMPs (49, 53, 147). Pex3p additionally acts as a crucial factor in the
de novo development of peroxisomes as it is considered to be the initiating step for this
peroxisome assembling action.
PMP insertion into the peroxisomal membrane in some organism required assistance
of Pex16p. It was demonstrated that Pex16p is an integral membrane protein which is mainly
found in higher eukaryotes (129, 179, 200) and in the yeast Y. lipolytica (41). Although the
mammalian Pex16p is an integral membrane protein with the C- as well as the N-terminus
facing the cytosol (87), the yeast Pex16p is a membrane associated protein facing the
peroxisomal lumen (41). It was shown that Pex16p execute distant activities in peroxisome
CHAPTER 1. INTRODUCTION_____________________________________________ 12
biogenesis. The mammalian Pex16p is required for the topogenesis of membrane proteins and
acts in the very early stages of peroxisome biogenesis while the yeast Pex16p is a negative
regulator of peroxisomal fission (41, 108, 179).
1.1
Biology of peroxisomes
1.1.3 Posttranslational modifications of peroxins
The theory of cycling receptors Pex5p and Pex7p imply consecutive interaction of the
receptors to distinct proteins or protein complexes at the peroxisome (116, 158). The
regulation of such interactions are implementing by reversible posttranslational modification
such as phosphorylation and/or ubiquitination (116, 171).
Actually, the membrane proteins Pex14p and Pex15p were shown to be
phosphorylated (42, 99, 114). Nevertheless, the physiological functions of phosphorylation in
peroxisomal matrix protein import are unexplored (116).
Recently, two peroxins have been shown to be ubiquitinated. For example, Pex18p, a
protein involved in the PTS2 pathway, is constitutively degraded in an ubiquitin-dependent
manner (174). Considering such observation two independent research groups demonstrated
polyubiquitination of Pex5p in cells deficient in constituents of the AAA or Pex4p-Pex22p
complexes (106, 171). Besides, it was shown for Pex5p that polyubiquitination leads to the
proteasomal degradation (171). It was demonstrated that ubiquitination of proteins requires
the consecutive activity of at least three types of enzymes: a ubiquitin-activating enzyme (E1),
a ubiquitin-conjugating enzyme (E2), and a ubiquitin ligase (E3) (167, 226) (Fig. 1.1.3.1).
At the terminating stage of the ubiquitination cascade an isopeptide bond amongst
ubiquitin and the lysine residue of the substrate is arranged. This reaction is catalyzed by the
E2 enzyme, usually in association with the E3 ligase. The length of the ubiquitin chain
conjugated to a protein substrate is carrying out a considerably meaningful function.
Polyubiquitinated proteins (the minimal chain length is four ubiquitin moieties) are
normally distinguished from other non-ubiquitinated proteins and degraded by the proteasome
(213). In contrast, monoubiquitination, an attachment of a single ubiquitin moiety, regulates
cellular processes such as endocytosis, sorting into multivesicular bodies and virus budding in
a proteasome-independent way (81).
It was shown that Pex5p is a monoubiquitinated and stable protein in wild-type cells.
Pex5p monoubiquitination occurs at the peroxisome and is blocked in cells deficient of
operative
docking
or
RING
finger
complexes,
evoking
concept
that
Pex5p
CHAPTER 1. INTRODUCTION_____________________________________________ 13
monoubiquitination is a late event in peroxisomal matrix protein import (116, 171). It was
shown that polyubiquitination of Pex5p protein is not a prerequisite for functional
peroxisomal protein import in S. cerevisiae (169).
Fig. 1.1.3.1 The ubiquitylation pathway. Free ubiquitin (Ub) is activated in an ATPdependent manner with the formation of a thiol-ester linkage between E1 and the carboxyl
terminus of ubiquitin. Ubiquitin is transferred to one of a number of different E2s. E2s
associate with E3s, which might or might not have substrate already bound. For HECT
domain E3s, ubiquitin is next transferred to the active-site cysteine of the HECT domain
followed by transfer to substrate (S) (as shown) or to a substrate-bound multi-ubiquitin chain.
For RING E3s, current evidence indicates that ubiquitin might be transferred directly from the
E2 to the substrate. Taken with modifications from (226).
It was shown that Pex5p is a monoubiquitinated and stable protein in wild-type cells.
Pex5p monoubiquitination occurs at the peroxisome and is blocked in cells deficient of
operative
docking
or
RING
finger
complexes,
evoking
concept
that
Pex5p
monoubiquitination is a late event in peroxisomal matrix protein import (116, 171). It was
shown that polyubiquitination of Pex5p protein is not a prerequisite for functional
peroxisomal protein import in S. cerevisiae (169). Moreover, it was shown that
polyubiquitinated forms of Pex5p concentrate in definite pex mutants in an Ubc4p-dependent
fashion (116), an observation that is in agreement with previous reports (106, 171). Despite,
monoubiquitination of Pex5p in wild-type cells is not controlled by Ubc4p, and peroxisome
biogenesis is not disturbed in cells deficient of Ubc4p (116). Besides, it was demonstrated the
polyubiquitination of Pex5p is part of a quality control system that direct membraneaccumulated Pex5p for proteasomal degradation (44, 106, 172).
The protein Pex19p acts as a receptor and chaperone of peroxisomal membrane
proteins (PMPs) (190). The conserved CaaX box peroxin Pex19p is known to be modified by
CHAPTER 1. INTRODUCTION_____________________________________________ 14
farnesylation (67, 104, 146). It was recently shown that the complete pool of Pex19p is
processed by farnesyltransferase in vivo and that this modification is independent of
peroxisome induction or the Pex19p membrane anchor Pex3p. Moreover, it was demonstrated
that genomic mutations of PEX19, which blocks farnesylation are critical for correct matrix
protein import into peroxisomes. It was shown that mutants defective in Pex19p farnesylation
are characterized by a significantly reduced steady-state concentration of prominent
peroxisomal membrane proteins Pex11p and Ant1p as well as constitutive compounds of the
peroxisomal import machinery such as RING peroxins (180).
1.1
Biology of peroxisomes
1.1.4 Peroxisomal AAA-peroxins
The highly diverse and adaptive character of peroxisomes is accomplished by modulation of
their enzyme content, which is mediated by dynamically operating protein-import
machineries. The import of matrix proteins into the peroxisomal lumen has been described as
the ATP-consuming step. It was shown that the peroxisomal AAA-ATPase (ATPase
Associated with various cellular Activities) proteins Pex1p and Pex6p are mechano-enzymes
and core components of a complex which dislocates the cycling import PTS1-receptor Pex5p
from the peroxisomal membrane back to the cytosol. Such release of Pex5p has been regarded
as the final step of the peroxisomal protein import cascade. The AAA-mediated process is
regulated by the ubiquitination status of the receptor Pex5p. Pex4p-catalysed monoubiquitination of Pex5p primes the receptor for recycling, thereby enabling further rounds of
matrix protein import, whereas Ubc4p-catalysed polyubiquitination targets Pex5p to
proteasomal degradation (168).
AAA-proteins are characterized by a typical modular architecture as they contain an
N-terminal non-ATPase domain which is followed by at least one conserved AAA domain.
Each AAA-cassette usually contains an ATP-binding site (Walker A) and an ATP-hydrolysis
site (Walker B) along with other motifs, such as the SRH (46) (Fig 1.1.4.1).
Pex1p and Pex6p are type II AAA-proteins, which are characterized by two AAA
domains. In both AAA peroxins, the second AAA domain is more conserved than the first
one. Interaction and subsequent oligomerization of Pex1p and Pex6p is believed to be
initiated in the cytosol and involves their first less conserved AAA domains (D1) (19, 204).
Although neither binding nor hydrolysis of ATP at D1 seems to be essential for
functionality in both yeast and humans, the interaction of human Pex1p and Pex6p is
CHAPTER 1. INTRODUCTION_____________________________________________ 15
stimulated by binding of ATP to D1 of human Pex1p and Pex6p (48, 204). Furthermore, ATP
binding, but not hydrolysis, at the second AAA cassette (D2) of Pex1p is required for the
Pex1p–Pex6p interaction in both systems (19, 204).
Fig 1.1.4.1 Molecular organization of the AAA complex in S. cerevisiae. The AAA
peroxins Pex1p and Pex6p are composed of an NTD, a non-conserved AAA domain (D1) and
a conserved AAA domain (D2). The AAA domains contain ATP-binding sites (A) and, with
the exception of D1 of Pex6p, also ATP-hydrolysis sites (B). Pex1p and Pex6p form a
heteromeric complex, and oligomerization requires the presence of the D1 domains and is
stimulated by ATP binding to Pex1p D2. Recruitment of the AAA complex to peroxisomes
occurs via binding of Pex6p NTD to Pex15p and requires ATP binding at Pex6p D1, while
detachment from Pex15p needs ATP binding and hydrolysis at Pex6p D2. The peroxisomal
AAA complex dynamically associates with the functional matrix protein-import machinery
(importomer) and Pex4p (Ubc10p) is supposed to be required for the disconnection of the
AAA complex from the importomer. Taken with modifications from (168).
Pex1p and Pex6p are believed to form heterohexameric structures in the cytosol and at the
peroxisomal membrane (47, 178, 203, 204). However, it is not clear whether formation of a
heteromeric assembly of the AAA peroxins is a prerequisite for their function, as one
population of Pex1p does not co-localize with Pex6p in mammalian cells (204, 228).
Although the formation of hexameric structures is common to AAA proteins, the
formation of heterohexamers has been found in few other cases, such as the m-AAA (matrix
CHAPTER 1. INTRODUCTION_____________________________________________ 16
AAA) complex, consisting of Yta10p and Yta12p, which is active at the matrix site of the
inner mitochondrial membrane, (7) or the six different Rpt ATPases from the 19S proteasome
(62).
The recruitment of AAA-complexes to peroxisomes is mediated by the tail-anchored
peroxisomal membrane proteins Pex15p in S. cerevisiae or its functional orthologue Pex26p
in human cells via binding of the N-terminal domain of Pex6p, stimulated by ATP binding to
the Walker A motif of Pex6p D1 (20, 145). In contrast, the Walker A and B motifs of Pex6p
D2 are required for an efficient detachment from Pex15p/Pex26p (20, 57, 204). Although
Pex15p and Pex26p have been described as adaptor proteins for the N-terminal part of Pex6p,
no adaptor has yet been identified for Pex1p (Fig. 1.1.4.2).
Fig. 1.1.4.2 Schematic representation of interaction between Pex15p and Pex6p. The Nterminus of Pex15p interacts with the N-terminal part of Pex6p, an interaction which is
stimulated by ATP-binding to the first AAA domain (A1) of Pex6p. On the other side
hydrolysis of ATP by the second AAA domain of Pex6p (B2) stimulates release of Pex6p
from Pex15p. Taken from (20).
The NTD (N-terminal domain) of murine Pex1p represents the only available crystal
structure of the AAA peroxins (193). The NTD folds into two structurally independent
globular subdomains (N- and C-lobe), which comprise an N-terminal double-ψ fold and a Cterminal β-barrel, separated by a shallow groove. Similar grooves were found in the adaptorbinding sites within the NTDs of VCP, NSF and VAT (VCP-like ATPase from
Thermoplasma), suggesting functional similarity (193).
The Pex15p-anchored AAA complex itself is part of an even larger protein complex at
the peroxisomal membrane, the peroxisomal matrix protein import machinery called the
CHAPTER 1. INTRODUCTION_____________________________________________ 17
importomer (178). To conclude, at least in S. cerevisiae, the Pex1p-bound nucleotides seem to
influence the Pex1p–Pex6p interaction, while the different nucleotide states of Pex6p regulate
the dynamic Pex6p–Pex15p/Pex26p association. The non-conserved domains are responsible
for oligomerization, while the conserved domains exhibit the main ATPase activity.
Import of folded proteins into peroxisomes occurs in a post-translational manner and
depends on ATP. The soluble PTS1 receptor Pex5p is the major signal-recognition factor of
proteins destined for the peroxisomal matrix. The receptor cycle of Pex5p involves cargo
recognition in the cytosol, docking of the receptor–cargo complex to the peroxisomal
membrane, translocation of the receptor–cargo complex to the luminal side of the membrane,
followed by release of the cargo into the matrix and retrotranslocation of the receptor back to
the cytosol (44).
Permeabilized cell systems of human fibroblasts provided the first evidence that Pex5p
accumulated reversibly at the peroxisomal membrane under ATP-modulated conditions (38).
Detailed in vitro studies revealed that the binding and translocation of Pex5p itself is ATPindependent while the export of Pex5p back to the cytosol requires ATP (69). The identity of
the corresponding ATPase remained a matter of debate until in vitro systems in S. cerevisiae
(172) and human fibroblast cells (150) identified Pex1p and Pex6p as the motor proteins of
Pex5p export. Their function in this process requires the presence of their membrane-anchor
proteins, Pex15p or Pex26p.
The in vitro reconstitution of the complete Pex5p cycle revealed that ATP binding and
hydrolysis at both Pex1p D2 and Pex6p D2 is needed for receptor dislocation (172).
Interestingly, the Walker B motif of Pex1p D2 seems to have no function in formation or
targeting of the AAA complexes (19, 204) and thus may be exclusively required for handling
of the substrate. The binding and consumption of ATP is believed to induce conformational
changes within the AAA peroxins that generate the driving force to pull the receptor out of
the membrane by a mechanism possibly similar to the one of Cdc48p (p97/VCP) in ERAD
The mechanism of substrate recognition by the AAA peroxins is not understood.
Although Pex5p and the AAA-proteins form a complex at the peroxisomal membrane (150,
172, 178), no direct interaction of the PTS1 receptor with either Pex1p or Pex6p has been
reported. This interaction seems to be regulated or mediated by a third factor, which could
represent an unknown adaptor protein of the AAA-peroxins or post-translational modification
of the substrate. It is well known that both processes play a central role in the function of
Cdc48p (p97/VCP) (98, 227), which is the closest evolutionary relative of Pex1p and Pex6p
(58, 186). As a consequence, the question has to be addressed of how the AAA-peroxins can
CHAPTER 1. INTRODUCTION_____________________________________________ 18
distinguish Pex5p forms destined for dislocation from cargo-loaded Pex5p species destined
for cargo translocation.
A possible solution may arise from the crystal structure of Pex1p NTD, which displays
similarities to the corresponding adaptor-binding domains of other AAA proteins (193). Data
from p97 and Ufd1 have identified a double-ψ β-barrel fold as a ubiquitin-binding domain
with binding sites for both mono- and poly-ubiquitin (163). Most interestingly, the PTS
receptors Pex5p, Pex18p and Pex20p have been demonstrated to be ubiquitinated
(106, 128,
171, 174).
The PTS1 receptor Pex5p of S. cerevisiae is monoubiquitinated in wild-type cells
(116), whereas it has been shown to be polyubiquitinated in mutants of the proteasome or
cells affected in the AAA and Pex4p–Pex22p complexes of the peroxisomal protein-import
machinery (106, 171). Polyubiquitination of Pex5p, requiring the ubiquitin conjugating
enzymes Ubc4p and the partly redundant Ubc5p and Ubc1p, takes place exclusively at the
peroxisomal membrane and marks the receptor for proteasomal degradation as part of a
quality-control system (106, 116, 171). Alternatively, Pex5p is the specific molecular target
for mono-ubiquitination by Pex4p (Ubc10p) (169, 232), which is essential for peroxisomal
biogenesis (231) and is anchored via Pex22p to the peroxisomal membrane (113).
The functional role of ubiquitination in the dislocation process has been elucidated by
in vitro export assays, revealing that mono-ubiquitination of Pex5p constitute the export
signal under physiological conditions, whereas polyubiquitination seems to provide an export
signal for the release of dysfunctional PTS1 receptors from the membrane and proteasomal
degradation as part of the quality-control pathway (169).
The direct mechanistic influence of this modification on the export reaction remains to
be investigated. The AAA peroxins may interact directly or indirectly via putative adaptors
with the ubiquitin tag on Pex5p. Alternatively, the attachment of ubiquitin may induce local
conformational changes within Pex5p to expose hidden binding sites. This mode of
interaction is also discussed for Cdc48p (p97/VCP), which binds ubiquitin via adaptor
complexes such as Ufd1/Npl4 and via its N-terminal domain. This domain is capable of
recognizing ubiquitin chains and also non-modified segments of its substrates (208, 236).
Notably, the AAA complex displays significantly increased association with the importomer
in PEX4-deficient cells, indicating that the ATPase cycles of Pex1p and Pex6p are coupled to
the mono-ubiquitination-dependent receptor cycle of Pex5p (178).
CHAPTER 1. INTRODUCTION_____________________________________________ 19
1.2
Biology of lipid droplets
1.2.1 Structure and function of lipid droplets
Lipid droplets (LDs) are remarkable dynamic subcellular organelles of globular shape with a
size range from 20 to 100 µm, depending on the cell type (37, 50, 73, 201). LDs are depots of
neutral lipids with a complex biology that exist in virtually any kind of cell, ranging from
bacteria to yeasts, plants, and higher mammals (15, 55, 73). In many cells, LDs occupy a
considerable portion of the cell volume and weight (221). As the major intracellular storage
organelles, LDs were first described in the works of R. Altmann and E. B. Wilson in the 19th
century (2, 233) (Fig. 1.2.1.1).
Fig. 1.2.1.1 Lipid droplets in yeast S. cerevisiae. Localization and morphology of lipid
droplets in wild-type yeast strain BY4742. (A) Erg6p-RFP labeled lipid droplets; (B) Oil Red
O-stained lipid droplets; (C) Electron microscopy image of oleic acid induced yeast cell; C,
cytosol; ER, endoplasmic reticulum; L, lipid droplets; M, mitochondria; N, nucleus; P,
peroxisome.
In contrast to the vesicular organelles, which have the aqueous content enclosed by a
phospholipid bilayer membrane (50, 55), mature LDs have a unique physical structure: they
have a neutral lipid core consisting of triacylglycerols (TG) and sterol esters (SE) surrounded
by a phospholipid monolayer (15, 132, 239) that contains numerous peripheral or embedded
proteins (143, 207) (Fig. 1.2.1.2).
CHAPTER 1. INTRODUCTION_____________________________________________ 20
Fig. 1.2.1.2 Lipid droplets composition. Taken with modifications from (73).
TG, as well as SE, play a crucial role for the cell: TG is the main energy store, and
both TG and SE are depots of membrane lipid components (221). LDs can tightly regulate the
level of intracellular free cholesterol by hydrolyzing sterol ester (143). The LD core also
contains other endogenous neutral lipids, like monoacylglycerol, diacylglycerol, free
cholesterol, and retinol ester, and xenobiotic hydrophobic compounds, such as polycyclic
aromatic hydrocarbons (73, 94, 195, 205, 207). A number of proteins are specifically targeted
to the LD surface (95), where they can regulate LD dynamics and the turnover of stored lipids
(132). Lipid-metabolizing enzymes, including hydrolases and lipases, are the major classes of
LD enzymes (37). LDs play crucial roles in cellular energy homeostasis and lipid metabolism
(221). LDs can provide a rapidly mobilized lipid source for many important biological
processes. Neutral lipids may be mobilized for the generation of energy by β-oxidation (191,
219) or for the synthesis of membrane lipids and signalling molecules (37). It has been shown
that all cell types have the ability to generate LDs in response to elevated fatty acid levels and
to subsequently metabolize and disperse these LDs when conditions are reversed (143),
thereby providing an emergency energy pool for cell survival (15). Due to their unique
architecture, LDs can protect cells from the effects of potentially toxic lipid species, such as
unesterified lipids (117, 132) or toxic free fatty acids (15), by depositing them inside the LD’s
core. In addition to this lipid scavenging function, LDs can transiently store certain proteins,
which may be released or degraded at later time points (37, 55, 64, 230). LDs interact with
other organelles such as peroxisomes, endosomes, endoplasmatic reticulum (ER), plasma
membrane, mitochondria and caveolae (73). The obesity and type 2 diabetes mellitus are most
common lipid droplets-associated disorders caused by impairment of triacylglycerol (TAG)
metabolism (112). The key anabolic and catabolic enzymes involved in TAG metabolism are
conserved between yeast and mammals (8, 32, 175).
CHAPTER 1. INTRODUCTION_____________________________________________ 21
1.2
Biology of lipid droplets
1.2.2 Biogenesis of lipid droplets
Biogenesis of LDs is tightly connected to the ER (15, 37, 73) (Fig. 1.2.2.1). Several
models were recently proposed for description of LDs de novo biosynthesis. In the ERbudding model, the neutral lipids accumulate in the interspace between the bilayer leaflets of
the ER membrane that subsequently budding-out of the cytoplasm-oriented phospholipids
hemimembrane with formation of the nascent LDs (15, 73).
Fig. 1.2.2.1 Lipid droplets in adipocytes. (a) 3T3-L1 adipocytes that have been stimulated to
induce lipolysis and then labelled for Rab18 (red) and neutral lipids (green). Rab18 is
specifically recruited to the surface of a subset of lipid droplets (LDs). The scale bar
represents 10 µm. (b) High-pressure frozen 3T3-L1 adipocytes that were processed for
electron-microscopy observation after freeze substitution. Note the complexity of the
membranes that wrap around and associate with LDs (such complexity represent result of
interaction of lipid droplest with endoplasmic reticulum membranes). The scale bar represents
1 µm. Taken with modifications from (143).
In the ER-domain model, the LDs remain fused to the ER and are lipid-bearing
protrusions of the ER membrane, developing a specialized ER domain (73). In the bicelle
model, neutral lipids aggregate between the two leaflets of the ER membrane but, instead of
budding, nascent LDs are excised from the membrane, acquire phospholipids from both the
cytosolic and luminal leaflets (73, 173). In the vesicular-budding model, tiny immature
bilayer vesicles that remain attached to the ER membrane are exploited as a precursor for LDs
formation. Neutral lipids are supplied into the vesicle bilayer and blow up the intermembrane
volume, finally squeezing the vesicular lumen so that it becomes a tiny incorporation inside
the LDs (73, 221) (Fig. 1.2.2.2).
CHAPTER 1. INTRODUCTION_____________________________________________ 22
Fig. 1.2.2.2 Lipid droplets biogenesis models. Taken with modification from (73).
1.2
Biology of lipid droplets
1.2.3 Interactions between peroxisome and lipid droplets
Peroxisomes are frequently shown to be tightly associated to lipid droplets (18, 28, 64, 65, 78,
159). It was clearly demonstrated by J. Goodman that lipid droplets and peroxisomes have
tight physiological interconnections. It was shown that oleic acid induced peroxisomes of
yeast S. cerevisiae are stabily associated with lipid droplets by formation of tubular-shaped
protrusions into the lipid droplets cores (18). It was demonstrated that peroxisomes can invade
lipid droplets with pexopodia and establish peroxisome – lipid droplets synapses. Such close
contacts could facilitate lipid molecules bidirectional transport across two organelles (18). For
instance, ether lipids, which are normally synthesized in peroxisomes, were shown to be
highly enriched in the lipid droplets core of several cell types (13, 18). Some of the
peroxisomes inside of lipid droplets constellations are often shown to be dumbbell-shaped,
indicating a dependence of the peroxisomal fission (24, 66) on lipid droplets close physical
association (21). It was shown in plants that glyoxysomal (peroxisomal) membrane lipids of
germinating cotton seeds have exclusively lipid droplets but not endoplasmic reticulum origin
(28). In that case triacylglycerols as well as fatty acids were shown to be directly trafficking
from lipid droplets to glyoxysomes. Such an observation can indicate about requirements of
lipid droplets in peroxisomal maturation and/or fission (64) in contrary to known fact that
endoplasmic reticulum membranes are the source of pre-peroxisomal vesicles (84). Moreover,
CHAPTER 1. INTRODUCTION_____________________________________________ 23
it was shown in plant that cotyledons of a Δped1 strain (strains lacking peroxisomal fatty acid
β-oxidation pathway) have a substantial portion of tight physical contact of lipid droplets and
glyoxysomes, with tubular structures within the glyoxysomes that appear to be derived from
lipid droplets; possibly these formations are system of transportation of triacylglycerols for
glyoxysomal β-oxidation (78). It was demonstrated that yeast Saccharomyces cerevisiae can
form extensive long-term contacts between peroxisome and lipid droplets in case of their
culturing on medium containing oleic acid as a sole carbon source; in case of yeast culturing
on glucose medium only transient interactions were observed (18). Fungi commonly exhibit
peroxisome – lipid droplet intimae association. In yeast Yarrowia lipolytica grown in oleic
acid medium, many peroxisomes in a temperature-sensitive Δpex3 mutant strain (strain
partially deficient in pre-peroxisome budding from the ER) wrap around lipid droplets, as if
attempting to access core lipids for membrane assembly (14, 18). Furthermore, animal cells
also were shown to demonstrate an extensive association of peroxisomes with lipid droplets in
cultured COS-7 cells (18, 187).
CHAPTER 1. INTRODUCTION_____________________________________________ 24
1.3
Objectives
The goal of this work was to study the biogenesis of peroxisomes and lipid droplets in yeast S.
cerevisiae. In the first part of the thesis, the objectives were to characterize the Lpx1p protein:
(1) prove the localization of Lpx1p in the peroxisome; (2) show the role of the peroxisomal
targeting signal type 1 (PTS1) in the targeting of Lpx1p to the peroxisome; (3) demonstrate the
dependence of Lpx1p transport to the peroxisome on the peroxisomal shuttling receptor Pex5p;
(4) prove the existence of piggyback-transport of Lpx1p into the peroxisomes; (5) express the
recombinant Lpx1p in Escherichia coli; (6) prove the existence of the hydrolase and
triacylglycerol lipase activities for Lpx1p in vitro; (7) investigate the role of Lpx1p in the
peroxisome metabolism and/or the biogenesis.
In the second part of the thesis, the objectives were to characterize the peroxisomal
AAA (ATPases Associated with diverse cellular Activities) ATPase proteins Pex1p and
Pex6p. In the third part of the thesis, the objectives were to characterize Ubp15p protein: (1)
prove the partial localization of Ubp15p in the peroxisome; (2) express the recombinant Ubp15p
in Escherichia coli; (3) prove the existence of the ubiquitin hydrolase, monoUb-Pex5p and/or
polyUb-Pex5p deubiquitinating activities for Ubp15p in vitro; (4) demonstrate the role of
Ubp15p in peroxisome metabolism and/or biogenesis (show some Ubp15p specific
phenotype); (5) show physical interaction of Ubp15p with components of peroxisomal export
machinery (Pex6p); (6) prove the existence of Ub-Pex5p dislocase and deubiquitinating
activities in the purified from yeast AAA-ATPase complex in vitro (show association of
deubiquitinating activity with dislocase activity in the endogenously expressed AAA-ATPase
complex); (7) show the role of Ubp15p in the cycle of shuttling receptor Pex5p; (8) prove the
requirement of enzymatic deubiquitination of Ub-Pex5p in vivo; (9) show steady state level of
Ub-Pex5p in wild-type and Δubp15 yeast strains.
In the forth part of the thesis, the objectives were to characterize Ldh1p protein: (1)
show the localization of Ldh1p (it was shown localization the lipid droplets); (2) show the role of
the peroxisomal targeting signal type 1 (PTS1) in the targeting of Ldh1p to the lipid droplets;
(3) demonstrate the dependence of Ldh1p transport to the lipid droplets on the peroxisomal
shuttling receptor Pex5p; (4) express the recombinant Ldh1p in Escherichia coli; (5)
investigate the existence of the hydrolase and triacylglycerol lipase activities for Ldh1p in
vitro; (6) show the role of conserved serine in the hydrolase/lipase motif GXSXG for enzyme
activity; (7) elucidate the role of Ldh1p in the lipid droplets metabolism and/or the biogenesis
(show some Ldh1p specific phenotype).
Lpx1p is a peroxisomal lipase required for normal
peroxisome morphology
Sven Thoms1,*, Mykhaylo O. Debelyy1, Katja Nau1,†, Helmut E. Meyer2 and Ralf Erdmann1
1 Institut für Physiologische Chemie, Abteilung für Systembiochemie, Ruhr-Universität Bochum, Germany
2 Medizinisches Proteomcenter, Ruhr-Universität Bochum, Germany
Keywords
lipase; peroxin; peroxisome; proteomics;
PTS1
Correspondence
R. Erdmann, Abteilung für
Systembiochemie, Ruhr-Universität
Bochum, Universitätsstr. 150,
44780 Bochum, Germany
Fax: +49 234 32 14266
Tel: +49 234 322 4943
E-mail: [email protected]
Present address
*Universitätsmedizin Göttingen, Abteilung
für Pädiatrie und Neuropädiatrie, GeorgAugust-Universität, Germany
†Forschungszentrum Karlsruhe, Institut für
Toxikologie und Genetik, Germany
Lpx1p (systematic name: Yor084wp) is a peroxisomal protein from Saccharomyces cerevisiae with a peroxisomal targeting signal type 1 (PTS1) and a
lipase motif. Using mass spectrometry, we have identified Lpx1p as present
in peroxisomes, and show that Lpx1p import is dependent on the PTS1
receptor Pex5p. We provide evidence that Lpx1p is piggyback-transported
into peroxisomes. We have expressed the Lpx1p protein in Escherichia coli,
and show that the enzyme exerts acyl hydrolase and phospholipase A activity in vitro. However, the protein is not required for wild-type-like steadystate function of peroxisomes, which might be indicative of a metabolic
rather than a biogenetic role. Interestingly, peroxisomes in deletion mutants
of LPX1 have an aberrant morphology characterized by intraperoxisomal
vesicles or invaginations.
(Received 20 September 2007, revised 22
November 2007, accepted 30 November
2007)
doi:10.1111/j.1742-4658.2007.06217.x
Peroxisomes are ubiquitous eukaryotic organelles that
are involved in lipid and antioxidant metabolism.
They are versatile and dynamic organelles engaged in
the b-oxidation of long and very long chain fatty
acids, in a-oxidation, bile acid and ether lipid synthesis, and in amino acid and purine metabolism [1].
Peroxisomes are a source of reactive oxygen species,
and are involved in the synthesis of signalling molecules in plants. Remarkably, peroxisomes are the only
site of fatty acid b-oxidation in plants and fungi.
Human peroxisomal disorders can be categorized
as either single-enzyme disorders or peroxisomal
biogenetic defects [2]. Single-enzyme disorders, for
example Refsum disease caused by a defect of
phytanoyl CoA hydroxylase, or X-linked adrenoleukodystrophy caused by a defect in a peroxisomal
ATP-transporter. Biogenetic defects are mostly caused
by mutations in the peroxisomal biogenesis genes,
the PEX genes, that code for peroxins [3]. Peroxisomal disorders are associated with morphological
Abbreviations
BPC, 1,2-bis-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-sindacene-3-undecanoyl)-sn-glycero-3-phosphocholine (bis-BODIPY-FL C11-PC);
DGR, 1,2-O-dilauryl-rac-glycero-3-glutaric acid (6-methyl resorufin) ester; DPG, 1,2-dioleoyl-3-(pyren-1-yl)decanoyl-rac-glycerol;
PNB, p-nitrobutyrate.
504
FEBS Journal 275 (2008) 504–514 ª 2008 The Authors Journal compilation ª 2008 FEBS
S. Thoms et al.
peroxisomal defects such as inclusions or invaginations [4,5].
Peroxisomal import of most matrix proteins depends
on the PTS1 (peroxisomal targeting signal type 1)
receptor Pex5p, which recognizes the PTS1 localized at
the very C-terminus [6,7]. The three-amino-acid signal
SKL (serine–lysine–leucine) was the first PTS1 to be
discovered, and is in many cases sufficient for directing
a protein to peroxisomes. Most PTS1 are tripeptides of
the consensus [SAC][KRH][LM] located at the extreme
C-terminus.
A second matrix protein peroxisomal targeting signal (PTS2) is present in considerably fewer peroxisomal proteins. PTS2 is usually located within the first
20 amino acids of the protein, and has been defined
as [RK][LVIQ]XX[LVIHQ][LSGAK]X[HQ][LAF] [8].
PTS2-bearing proteins are recognized by the cytosolic
receptor Pex7p.
Systems biology approaches led to the identification
of Lpx1p as an oleic acid-inducible peroxisomal matrix
protein of unknown function [9,10]. The gene sequence
of LPX1 predicts a lipase motif of the GxSxG type
that is typical for a ⁄ b hydrolases [11,12]. Using mass
spectrometry, we identify Lpx1p as present in peroxisomes, and analyse its peroxisomal targeting. We show
that it acts as a phospholipase A, and, by electron
microscopy and morphometry, we provide the first evidence for an interesting peroxisomal phenotype of the
Dlpx1 deletion mutant.
Results
Identification of Lpx1p in peroxisomes by mass
spectrometry
We identified Lpx1p (lipase 1 of peroxisomes;
EC 3.1.1.x) in a follow-up study to an exhaustive proteomic characterization of peroxisomal proteins [13].
This involved purification of peroxisomes from oleicacid induced Saccharomyces cerevisiae, and subsequent
membrane extraction using low- and high-salt buffers.
Low-salt-extractable proteins were solubilized in SDS
buffer, and separated by RP-HPLC [14]. Proteins in
individual HPLC fractions were further separated by
SDS–PAGE, and protein bands were cut out and analysed by mass spectrometry. Lpx1p (systematic name:
Yor084wp) was extractable by low salt and identified
together with the peroxisomal aspartate aminotransferase Aat2p in HPLC fraction 7 at a molecular mass of
approximately 45 kDa (Fig. 1A) [15].
The predicted molecular mass of Lpx1p is 44 kDa.
It carries a peroxisomal targeting signal type 1, glutamine–lysine–leucine (QKL) (Fig. 1B,D). The amino
Peroxisomal lipase Lpx1p
acid sequence comprises the lipase motif GHSMG of
the general GxSxG type [11,16] with the central serine
being part of the catalytic triad. This lipase motif is
indicative of a ⁄ b hydrolase family members [12].
Hydrophobicity predictions [17] indicate a pronounced
hydrophobic region in the central domain, consisting
of amino acids 154–177 with the core region 164LLILIEPVVI173 (Fig. 1C).
By homology searches with other prokaryotic and
eukaryotic hydrolases (not shown) using profile hidden
Markov models [18], we identified a conserved histidine that is probably part of the catalytic triad of the
active site (Fig. 1B). The third member of the catalytic
triad could not be identified by sequence-based
searches.
PTS1-dependent targeting of Lpx1p
to peroxisomes
The majority of the Lpx1p in a cell homogenate was
pelleted at 25 000 g, consistent with an organellar
localization of the protein (Fig. 2A). In this experiment, more of the peroxisomal soluble thiolase Fox3p
(EC 2.3.1.x) than of Lpx1p appears to be present in
the supernatant. This is probably due to partial peroxisome rupture during preparation, and might indicate
that Lpx1p, in contrast to Fox3p, is loosely associated
with the peroxisomal membrane.
The peroxisomal localization of Lpx1p had been
demonstrated indirectly by immuno-colabelling of a
heterozygous C-terminally Protein A-tagged version
of Lpx1p in a diploid strain [10]. Peroxisomal localization under these conditions would depend on the
presence of copies of Lpx1p that are not blocked by
a C-terminal tag, and by the interaction of Lpx1p
with itself (piggyback import). We wished to analyse
whether Lpx1p directly localized to peroxisomes, and
cloned LPX1 for expression from a yeast shuttle
plasmid using an N-terminal GFP tag. This fusion
protein was localized to peroxisomes in a Dlpx1 deletion strain (Fig. 2B), indicating that Lpx1p by itself
targets to peroxisomes. Peroxisomal localization of
Lpx1p was abolished when Lpx1p was expressed with
a C-terminal tag (Fig. 2C), indicating that the
C-terminus has to be free for Pex5p-dependent
import. Peroxisomal localization was abolished in the
absence of Pex5p (Fig. 2C), and was not affected by
the absence of Pex7p (Fig. 2C), indicating that its
targeting to peroxisomes is dependent on the PTS1
pathway.
We confirmed the peroxisomal localization of Lpx1p
by subcellular fractionation. On a sucrose density gradient, GFP–Lpx1p co-migrated with Fox3p (alternative
FEBS Journal 275 (2008) 504–514 ª 2008 The Authors Journal compilation ª 2008 FEBS
505
Peroxisomal lipase Lpx1p
S. Thoms et al.
Fig. 1. Identification of Lpx1p from Saccharomyces cerevisiae
peroxisomes by proteomics. (A) Isolation of putative peroxisomal
proteins by preparative chromatographic separation. Low saltextractable peroxisomal proteins were solubilized by SDS and
separated by reverse phase HPLC. Polypeptides of selected fractions were separated by SDS–PAGE and visualized by Coomassie
blue staining. Only the first 13 lanes of the HPLC profile are shown
[15]. The band marked by an asterisk contains the peroxisomal
proteins Lpx1p (predicted molecular mass 44 kDa) and Aat2p (predicted molecular mass 44 kDa) in HPLC fraction 7 at a molecular
mass of approximately 45 kDa. (B) Alignment of the LPX1 gene
with a Mycoplasma genitale (Mg) gene encoding a putative esterase ⁄ lipase (AAC71532) and with the putative triacylglycerol lipase
AAB96044 from Mycoplasma pneumoniae (Mp). Identical amino
acids are indicated by an asterisk and similar amino acids are indicated by a colon and full point, depending on degree of similarity.
The conserved GxSxG lipase motif is shaded in grey. The lipase
motif contains the putative active-site serine. The arrowhead
indicates the probable active-site histidine, as determined from
alignments using eukaryotic esterase lipase family members (not
shown). The third member of the catalytic triad could not be identified by sequence-based analysis. (C) Hydropathy plot of Lpx1p.
A Kyte–Doolittle plot was calculated with window size of 11.
Values > 1.8 may be regarded as highly hydrophobic regions.
(D) Termini of all four QKL proteins from S. cerevisiae. Only Lpx1p
is predicted to target to peroxisomes. Positions relative to the
(putative) PTS1 are indicated. Grey boxes, lysine in position -1 and
valine in position -5 are probably required to target Lpx1p to
peroxisomes.
Lpx1p was identified from low-salt-extractable membranes (Fig. 1A), and the amount of Lpx1p that is not
membrane-associated or found in the non-peroxisomal
low-density fractions (Fig. 2D; fractions 19–29) is low
compared to Fox3p.
Although the QKL C-terminus of Lpx1p does not
match the PTS1 consensus [SAC][KRH][LM], a QKL
terminus is able to target a test substrate to peroxisomes [19]. Lpx1p is one of four S. cerevisiae proteins
that end in QKL (Fig. 1D), and is probably the only
one that is localized to peroxisomes.
Self-interaction of Lpx1p
name: Pot1p), with Pex11p, and with the catalase (EC
1.11.1.6) activity peak in the same density fraction at
about 1.225 gÆcm)3 (fraction 10) (Fig. 2D). The activity of the mitochondrial marker fumarase (EC 4.2.1.2)
together with the mitochondrial Mir1p showed a
clearly separate peak at a density of 1.192 gÆcm)3 in
fraction 14 (Fig. 2D).
506
C-terminally tagged Lpx1p localizes only to peroxisomes when endogenous copies of the protein are present [10]. This suggests piggyback import of Lpx1p,
which, in turn, would rely on self-interaction of Lpx1p.
We tested this hypothesis by two-hybrid analysis of
LPX1. Neither the fusion of Lpx1p with the GAL4
binding domain nor its fusion with the activation
domain were auto-activating (Fig. 3A). The strains
expressing both fusions exhibit a strong two-hybrid
interaction signal, exceeding that of the control PEX11
with PEX19 (Fig. 3A). Because complex formation
FEBS Journal 275 (2008) 504–514 ª 2008 The Authors Journal compilation ª 2008 FEBS
S. Thoms et al.
Peroxisomal lipase Lpx1p
Fig. 2. Localization and PTS1-dependent targeting of Lpx1p to peroxisomes. (A) Immunological detection of GFP–Lpx1p in a sedimentation
experiment. A cell-free homogenate (T) was separated into supernatant (S) and an organelle-containing pellet fraction (P) by centrifugation at
25 000 g (30 min). Amounts corresponding to equal T content of each fraction were analysed by SDS–PAGE and western blotting with
antibodies against GFP and the peroxisomal marker protein oxoacyl CoA thiolase, Fox3p (alternative name: Pot1p). (B) Lpx1p is localized to
peroxisomes. Coexpression of PTS2-dsRed and GFP–Lpx1p in yeast cells. Cells were grown on ethanol to induce the expression of PTS2dsRed. (C) Import of Lpx1p into peroxisomes is dependent on Pex5p and independent of Pex7p. Lpx1p was expressed as either a C-terminal
fusion (top images) or N-terminal fusion (bottom images) with GFP. In the Dpex5 deletion mutant, Lpx1p cannot be imported into peroxisomes, irrespective of the position of the tag (right). Deletion of PEX7 does not influence Lpx1p targeting if the PTS1 is not blocked by GFP
(top left). GFP fusion proteins that are not targeted to peroxisomes mislocalize to the cytosol. Bar = 2 lm. (D) Sucrose density gradient analysis of GFP–LPX1-transformed yeast. A cell-free organelle sediment from oleate induced cells was analysed on a density gradient with
sucrose concentrations form 32 to 54% w ⁄ v. Individual fractions were analysed for catalase activity (peroxisomal marker) and fumarase
activity (mitochondrial marker). In addition, the presence of GFP–Lpx1p, Fox3p, Pex11p (peroxisomal membrane protein) and Mir1p (mitochondrial phosphate carrier) was tested by western blotting and immunodetection.
might play a significant role in peroxisomal (piggyback)
protein import [20], we determined the size of the Lpx1p
complex by gel filtration of cell lysates of oleate-induced
cells on a Superdex 200 column. We found that the
majority of Lpx1p is not present in high-molecularmass complexes, but elutes at molecular masses corresponding to monomers, dimers and trimers (Fig 3B).
The two-hybrid interaction probably reflects the complex formation. However, our identification of lowmolecular-mass complexes of Lpx1 does not exclude
the possibility that higher-molecular-mass complexes
are transiently formed during topogenesis of the protein.
on oleate as the only carbon source (Fig. 4A). To
determine the influence of Lpx1p on peroxisome biogenesis in more detail, post-nuclear supernatants were
prepared from wild-type and Dlpx1 strains. The postnuclear supernatants were analysed by Optiprep gradient
analysis and subsequent tests of gradient fractions for
peroxisomal catalase and mitochondrial cytochrome c
oxidase (EC 1.9.3.l; Fig. 4B). None of these marker proteins indicated a significant change in the abundance or
density of peroxisomes or mitochondria, suggesting
that peroxisomal and mitochondrial biogenesis remain
functional after deletion of the LPX1 gene.
Lpx1p is not required for peroxisome biogenesis
Lipase activity of Lpx1p
Having shown that Lpx1p is targeted to peroxisomes
by the soluble PTS1 receptor, we wished to determine
whether Lpx1p is required for the biogenesis of peroxisomes. We first tested the Dlpx1 knockout for growth
on oleate. However, Lpx1p is dispensable for growth
Characteristic GxSxG motifs and similarities with
a ⁄ b hydrolases in the predicted protein sequence suggest that Lpx1p is an esterase, possibly a lipase
[11,12,16]. To directly investigate Lpx1p, we expressed
the full-length protein as a fusion protein with a C-ter-
FEBS Journal 275 (2008) 504–514 ª 2008 The Authors Journal compilation ª 2008 FEBS
507
Peroxisomal lipase Lpx1p
S. Thoms et al.
Fig. 3. Lpx1p interacts with itself. (A) Two-hybrid assay. Full-length
Lpx1p was fused to the GAL4 binding or activation domain and coexpressed in a yeast strain with Escherichia coli b-galactosidase
under the control of a GAL4-inducible promotor. b-galactosidase
activity was measured in lysates of doubly transformed strains. No
signal was obtained when LPX1 was combined with empty
vectors. Positive control: interaction of Pex19p with Pex11p.
(B) Size-exclusion chromatography of a wild-type cell lysate of
oleate-induced cells. The lysate was fractionated by gel filtration
on a Superdex 200 column and tested by immunoblotting with
anti-Lpx1p antiserum. The molecular masses indicated were
interpolated from a calibration curve and correspond well with
monomeric, dimeric and trimeric forms of Lpx1p. The relative
distribution of the three forms was quantified using NIH Image
(National Institutes of Health, Bethesda, MD, USA). The elution volume is indicated in millilitre.
minal hexahistidine tag in Escherichia coli and purified
the protein using immobilized metal-ion affinity chromatography (Fig. 5A). The protein was further purified by gel filtration on a Superdex 200 column
(Fig. 5B). Gel filtration indicated the propensity of
Lpx1p to oligomerize in vitro, albeit to a much lower
extent than in yeast whole-cell lysates (compare
Figs 3B and 5B).
Purified protein was used for the generation of polyclonal antibodies in rabbit. Antisera recognized a protein of about 43 kDa, indicating that the antiserum is
specific for Lpx1p. We used these antibodies to confirm that the endogenous yeast Lpx1p is induced by
oleic acid (Fig. 5A).
To analyse the enzyme activity of Lpx1p, we assayed
the E. coli-expressed protein for esterase activity, using
p-nitrophenyl butyrate (PNB) as the test substrate. PNB
can be hydrolysed by esterases, yielding free p-nitrophenol, which can be determined photometrically at
410 nm. Lpx1p hydrolysed the test substrate with a
KM of 6.3 lm and Vmax of 0.17 lmolÆs)1 (Table 1).
Lpx1p is strongly induced by oleic acid, regulated by
stress-associated transcription factors [21], and aligns
508
Fig. 4. Absence of pex phenotype in a Dlpx1 deletion. (A) Growth
on plates with oleate as the only carbon source. Wild-type, Dlpx1 or
Dpex1 control stains were spotted in equal cell numbers in series of
10-fold dilutions on oleate or ethanol plates. Absence of growth and
oleic acid consumption (halo formation) indicates a peroxisomal
defect. Control: growth assay on ethanol. (B) Optiprep density gradient centrifugation analysis of postnuclear supernatants prepared
from oleate-induced wild-type and Dlpx1 strains. All fractions were
analysed using catalase (peroxisome) and cytochrome c oxidase
(mitochondria) enzyme assays. The peroxisomal and mitochondrial
densities were not measurably altered by LPX1 deletion.
with human epoxide hydrolases (EC 1.14.99.x; not
shown). We found that Lpx1 hydrolysed the epoxide
hydrolase substrate [22] 4-nitrophenyl-trans-2,3-epoxy3-phenylpropyl carbonate (NEPC) (data not shown),
but we consider that this activity is non-specific,
because it could not be blocked by the specific epoxide
hydrolase inhibitor N,N’-dicyclohexylurea (DCU) (data
not shown).
To test for lipase activity, we used 1,2-dioleoyl-3(pyren-1-yl)decanoyl-rac-glycerol (DPG) as a substrate.
DPG contains the eximer-forming pyrene decanoic
acid as one of the acyl residues. Upon cleavage, the
free pyrene decanoic acid shows reduced eximer
fluorescence. Lpx1p exerts lipase activity towards
DPG of 5.6 pmolÆh)1Ælg)1 (Table 1). For comparison,
we measured the lipase activity of commercial yeast
Candida rugosa lipase towards DPG and found an
FEBS Journal 275 (2008) 504–514 ª 2008 The Authors Journal compilation ª 2008 FEBS
S. Thoms et al.
Peroxisomal lipase Lpx1p
Fig. 5. Protein expression, antibody generation and oleate induction of Lpx1p. Expression of Lpx1p in Escherichia coli. (A) Lpx1p
was expressed as a fusion protein with a
C-terminal hexahistidine tag and purified by
His-trap chromatography. The purified Lpx1p
(lane 1) was used to generate polyclonal
antibodies in rabbit that recognize the purified recombinant protein (lane 4). Endogenous Lpx1p in whole yeast lysates is
recognized only after induction of peroxisomes and Lpx1p by oleate (lane 2 versus
lane 3). Molecular masses are shown in
kDa. (B) Second purification step: gel filtration on Superdex 200 column. The elution
profile indicates that most of the protein
behaves as a monomer, but a small proportion forms dimers and trimers.
Table 1. Esterase, lipase, and phospholipase activity of Lpx1p.
Esterase activity was measured using PNB (p-nitrobutyrate) as a
substrate. KM and Vmax values were calculated using Michaelis–
Menten approximations. Lipase activity was determined using DPG
as a substrate. Activity was measured from two independent protein preparations in triplicate. Candida rugosa lipase (CRL) was used
as a positive control for lipase measurement. (Pancreas) lipase
activity assays used DGR in a coupled enzyme assay as a substrate. Phospholipase C and D (PLC and PLD) activities were measured in coupled enzyme assays using phosphatidylcholine (PC).
Phospholipase A measurements used BPC (bis-BODIPY-FL C11-PC)
as a test substrate. Porcine pancreas lipase (PPL) was used as a
control.
Enzyme
Substrate
Activity
Lpx1p
PNB
Acyl esterase
Lpx1p
DPG
CRL
DPG
Lpx1p
Lpx1p
Lpx1p
Lpx1p
PPL
DGR
PC
PC
BPC
BPC
(Triacylglycerol)
lipase
(Triacylglycerol)
lipase
(Pancreas) lipase
PLC
PLD
PLA
PLA
Activity parameters
(pmolÆh)1Ælg)1)
KM 6.3 lM;
Vmax 0.17 lmolÆs)1
5.6 ± 1.5
2.0 ± 0.1
Below detection limit
Below detection limit
Below detection limit
7.9
195
activity of 2.0 pmolÆh)1Ælg)1 under the same assay conditions (Table 1).
We sought to confirm lipase activity by testing
Lpx1p in a clinical assay for pancreatic lipase. The
assay uses the substrate 1,2-O-dilauryl-rac-glycero3-glutaric acid (6-methyl resorufin) ester (DGR) in a
desoxycholate-containing buffer. Lpx1p did not hydrolyse this substrate under the assay conditions (Table 1).
Next we tested for phospholipase C activity in a
coupled enzyme assay with phosphatidylcholine as the
substrate. In this assay, phospholipase C converts
phosphatidylcholine to phosphocholine and diacylglycerol. Alkaline phosphatase hydrolyses phosphocholine
to form choline, which is then oxidized by choline
oxidase to betaine and hydrogen peroxide. The latter,
in the presence of horseradish peroxidase, reacts with
10-acetyl-3,7-dihydrophenoxazine to form fluorescent
resorufin. This assay, as well as a similar assay for
phospholipase D, gave negative results for Lpx1p
(Table 1).
Finally, we tested phospholipase A (EC 3.1.1.4)
activity using the substrate 1,2-bis-(4,4-difluoro-5,7dimethyl-4-bora-3a,4a-diaza-sindacene-3-undecanoyl)sn-glycero-3-phosphocholine (bis-BODIPY-FL C11-PC,
BPC). BPC is a glycerophosphocholine with BODIPY
dye-labeled sn-1 and sn-2 C11 acyl chains. Cleavage
reduces dye quenching and leads to a fluorecence
increase at 530 nm upon excitation at 488 nm. Lpx1p
exerts phospholipase A activity of 7.9 pmolÆh)1Ælg)1.
As a control enzyme, we used commercial porcine
pancreas lipase, which hydrolysed 195 pmolÆh)1Ælg)1.
In summary, Lpx1p shows acyl esterase, lipase and
phospholipase A activity towards PNB, DPG and
BPC, respectively.
Altered peroxisome morphology in deletion
mutants of LPX1
Lastly, we analysed electron microscopic (EM) images
of knockouts of LPX1. To our surprise, a large
number of Dlpx1 peroxisomes showed an abnormal
morphology. The peroxisomes appear vesiculated
FEBS Journal 275 (2008) 504–514 ª 2008 The Authors Journal compilation ª 2008 FEBS
509
Peroxisomal lipase Lpx1p
S. Thoms et al.
(Fig. 6B), and either contain intraperoxisomal vesicles
or their membrane is grossly invaginated. On average,
one vesiculated peroxisome is visible in every fifth
mutant cell (Fig. 6E). When the average number of
altered peroxisomes is counted, we find that every
third peroxisome shows this vesiculation phenotype
(Fig. 6D). This is a high percentage, considering the
fact that the peroxisomes were viewed in thin microtome sections. In three dimensions, every single peroxisome might contain a vesicular membrane or
indentation that escapes notice in two-thirds of the
‘two-dimensional’ sections.
The average number of peroxisomes per cell is
insignificantly increased in Dlpx1 (2.95 versus 2.76,
Fig. 6C). Wild-type cells did not contain any vesiculated peroxisome (Fig. 6A,D,E). The drastic phenotype
of Dlpx1 is reminiscent of the peroxisomal morphology
found in peroxisomal disorders.
Discussion
Lpx1p is a peroxisomal protein with an unusual
PTS1
Fig. 6. Peroxisome morphology phenotype of the Dlpx1 deletion.
Absence of LPX1 leads to drastic peroxisomal vesiculation or invagination. Electron microscopic images of cells from (A) wild-type and
(B) Dlpx1. All cells were grown on medium with 0.1% oleic acid. Peroxisomes are marked by arrowheads. Bar = 2 lm. (C) Comparison of
per cell peroxisome numbers in wild-type and Dlpx1 strains. (D) Average number of vesicles per peroxisome (wild-type, n = 94; Dlpx1,
n = 142). In Dlpx1, about every third peroxisome contains a vesicle.
(E) Percentage of cells with vesicle-containing peroxisomes. Roughly
one in five Dlpx1 cells carries peroxisomes with a vesicle or invaginations (wild-type, n = 34; Dlpx1, n = 48). px, peroxisome(s).
510
LPX1 is one of the most strongly induced genes following a shift from glucose to oleate, as determined by
serial analysis of gene expression (SAGE) experiments
[9]. The oleate-induced increase in mRNA abundance
is abolished in the Dpip2 Doaf1 double deletion strain,
indicating that its induction is dependent on the transcription factor pair Pip2p and Oaf1p [9]. The Lpx1p
protein itself is induced by oleic acid as determined
using a Protein A tag [10] or by use of an antibody
raised against Lpx1p (see Results).
Lpx1p does not conform to the general PTS1 consensus. The other three QKL proteins in S. cerevisiae
are probably not peroxisomal (Fig. 1D): Efb1p
(systematic name: Yal003wp) is the elongation factor
EF-1b [23], Rpt4p (Yor259cp) is a mostly nuclear
19S proteasome cap AAA protein [24], and Tea1p
(Yor337wp) is a nuclear Ty1 enhancer activator [25].
However, QKL is sufficient to sponsor Pex5p binding
[19]. Why are these QKL proteins not imported into
peroxisomes? This is probably due to the upstream
sequences. Lpx1p has a lysine at position -1 (relative
to the PTS1 tripeptide) and a hydrophobic amino acid
at position -5 (Fig. 1D). These features promote Pex5p
binding and are not found in the other three QKL
proteins (Fig. 1D) [19]. Our views were confirmed
by applying a PTS1 prediction algorithm (http://
mendel.imp.ac.at/mendeljsp/sat/pts1/PTS1predictor.jsp)
[26], which predicted peroxisomal localization for
Lpx1p only of the four proteins listed in Fig. 1D.
FEBS Journal 275 (2008) 504–514 ª 2008 The Authors Journal compilation ª 2008 FEBS
S. Thoms et al.
Lipase activity and cellular function of Lpx1p
Lpx1p could be involved in various processes: (a)
detoxification and stress response, (b) lipid mobilization, or (c) peroxisome biogenesis. As Lpx1p expression may be regulated by Yrm1p and Yrr1p [21], a
transcription factor pair that mediates pleiotropic drug
resistance effects, we speculate that Lpx1p is required
for a multidrug resistance response that did not show
a phenotype in our experiments. We could, however,
exclude epoxide hydrolase activity for Lpx1p, because
hydrolysis of the epoxide hydrolase test substrate
was not affected by a specific epoxide hydrolase
inhibitor.
We investigated the dimerization of Lpx1p in the
context of piggyback protein import into peroxisomes.
Self-interaction (dimerization) is frequently found in
regulation of the enzymatic activity of other lipases
such as C. rugosa lipase or human lipoprotein lipase
[27,28]. The putative active-site serine of Lpx1p is
located next to the region of highest hydropathy, suggesting that Lpx1p is a membrane-active lipase that
contributes to metabolism or the membrane shaping of
peroxisomes.
Peroxisomes are sites of lipid metabolism. It is thus
not surprising to find a lipase associated with peroxisomes. Our experiments show that Lpx1p has triacylglycerol lipase activity; however, activities towards the
artificial test substrates DPG and DGR were low. Our
evidence for phospholipase A activity of the enzyme,
together with the EM phenotype, suggest that Lpx1
has a more specialized role in modifying membrane
phospholipids.
Recently, a mammalian group VIB calcium-independent phospholipase A2 (iPLA2c) was identified that
possesses a PTS1 SKL and a mitochondrial targeting
signal [29,30]. The enzyme is localized in peroxisomes
and mitochondria, and is involved, among others, in
arachinoic acid and cardiolipin metabolism [31,32].
Knockout mice of iPLA2c show mitochondrial ⁄ cardiological phenotypes [33]. It will be exciting to determine
whether human iPLA2c and yeast Lpx1p are functionally related.
We have provided evidence that peroxisomes are still
functional in the absence of LPX1. This suggests a
non-essential metabolic role for Lpx1p in peroxisome
function. The morphological defect found in electron
microscopic images of a deletion of Lpx1p
(peroxisomes containing inclusions or invaginations) is
symptomatic of a yeast peroxisomal mutant, and is
reminiscent of the phenotypes found in human peroxisomal disorders [4,5]. Out data suggest that Lpx1p is
required to determine the shape of peroxisomes.
Peroxisomal lipase Lpx1p
Experimental procedures
Strains and expression cloning
The S. cerevisiae strains BY4742, BY4742 Dyor084w,
BY4742 Dpex5, BY4742 Dpex7 and BY4742 Dpex1 were
obtained from EUROSCARF (Frankfurt, Germany). S. cerevisiae strain BJ1991 (Mata leu2 trp1 ura3-251 prb1-1122
pep4-3) has been described previously [34].
Genomic S. cerevisiae DNA was used as a PCR template
for PCR. For construction of pUG35-LPX1 (LPX1–GFP),
PCR-amplified YOR084w (primers 5¢-GCTCTAGAATG
GAACAGAACAGGTTCAAG-3¢ and 5¢-CGGAATTCCA
GTTTTTGTTTAGTCGTTTTAAC-3¢) was subcloned into
EcoRV-digested pBluescript SK+ (Stratagene, La Jolla,
CA, USA), and then introduced into the XbaI and EcoRI
sites of pUG35 (HJ Hegemann, Düsseldorf, Germany). For
construction of pUG36-LPX1 (GFP–LPX1), PCR-amplified
YOR084w (primers 5¢-GAGGATCCATGGAACAGAACA
GGTTCAAG-3¢ and 5¢-CGGAATTCTTACAGTTTTTGT
TTAGTCGTTTTAAC-3¢) was subcloned into EcoRVdigested pBluescript SK+, and then cloned into the BamHI
and EcoRI sites of pUG36 (HJ Hegemann).
pET21d-LPX1 was constructed by introducing PCRamplified YOR084w (primers 5¢-GAATCCATGGAACAG
AACAGGTTCAA-3¢ and 5¢-CGGTACCGCGGCCGCCA
GTTTTTGTTTAGTCGTTTT-3¢) into the NcoI and NotI
sites of pET21d (EMD Chemicals, Darmstadt, Germany).
For construction of pPC86-LPX1 and pPC97-LPX1,
YOR084w was amplified using primers 5¢-CCCGGGAAT
GGAACAGAACAGGTTCAAG-3¢ and 5¢-AGATCTTTA
CAGTTTTTGTTTAGTCGTTTT-3¢, and introduced into
pGEM-T (Promega, Mannheim, Germany). The ORF was
excised using XmaI and BglII, and introduced into pPC86
and pPC97 [35]. All constructs were confirmed by DNA sequencing. pPTS2-DsRed has been described previously [36].
Image acquisition
Samples were fixed with 0.5% w ⁄ v agarose on microscopic
slides. Fluorescence microscopic images were recorded on
an Axioplan2 microscope (Zeiss, Köln, Germany) equipped
with an aPlan-FLUAR 100 x ⁄ 1.45 oil objective and an
AxioCam MRm camera (Zeiss) at room temperature. If
necessary, contrast was linearly adjusted using the image
acquisition software Axiovision 4.2 (Zeiss).
Protein purification and antibody generation
Lpx1p was expressed from pET21d-LPX1 in BL21(DE3)
E. coli. Cells were harvested by centrifugation (SLA3000,
4000 g, 15 mins), and resuspended in buffer P (1.7 mm
potassium dihydrogen phosphate, 5.2 mm disodium hydrogen phosphate, pH 7.5, 150 mm sodium chloride) containing
FEBS Journal 275 (2008) 504–514 ª 2008 The Authors Journal compilation ª 2008 FEBS
511
Peroxisomal lipase Lpx1p
S. Thoms et al.
a protease inhibitor mix (8 lm antipain-dihydrochloride,
0.3 lm aprotinin, 1 lm bestatin, 10 lm chymostatin, 5 lm
leupeptin, 1.5 lm pepstatin, 1 mm benzamidin, and 1 mm
phenylmethane sulfonylfluoride) and 50 lgÆmL)1 lysozyme,
22.5 lgÆmL)1 DNAse I and 40 mm imidazole. Cells were
sonicated 20 times for 20 s each using a 250D Branson
digital sonifier (Danbury, CT, USA) with an amplitude
setting of 25%. After removal of cell debris (SS34,
27 000 g, 45 min) the supernatant was clarified by 0.22 lm
filtration (Sarstedt, Nümbrecht, Germany) and loaded
on Ni-Sepharose columns (GE Healthcare, Munich,
Germany) equilibrated with buffer W (buffer P containing
300 mm sodium chloride, 1 mm dithiothreitol, 40 mm
imidazole). The column was washed in buffer W until no
further protein was eluted. Recombinant Lpx1p was eluted
by a continuous 40–500 mm imidazole gradient based on
buffer W. Peak fractions (identified by SDS–PAGE) were
pooled and concentrated using VivaSpin concentrators
(30 kDa cutoff, Sartorius, Göttingen, Germany). Lpx1p
was further purified by gel-filtration chromatography.
Protein was stored at 0 C. For the production of polyclonal antibodies, gel bands corresponding to 150 lg
protein were excised and used for rabbit immunization
(Eurogentec, Seraing, Belgium).
of 200 lL at 37 C. Hydrolysis of DPG was followed in
96-well plates at 460 nm with 360 nm excitation using
a Sirius HT fluorescence plate reader (MWG Biotech,
Ebersberg, Germany). Lipase activity towards DPG was
measured in assay setups containing 2–10 lg Lpx1p (from
two independent protein preparations), with C. rugosa
triacylglycerol lipase (Lipase AT30 Amano, 1440 UÆmg)1,
Sigma-Aldrich) as a control.
Phospholipase A activity was measured using bisBODIPY FL C11-PC (Molecular Probes ⁄ Invitrogen,
Eugene, OR, USA) as the substrate. The assay setup contained 70 lg Lpx1p in 50 lL assay buffer (50 mm Tris,
100 mm sodium chloride, 1 mm calcium carbonate, pH 8.9)
together with 50 lL substrate-loaded liposomes. Liposomes
were prepared by injecting 90 lL of an ethanolic mixture of
3.3 mm dioleyl phosphatidylcholine (Avanti Polar Lipids,
Alabaster, AL, USA), 3.3 mm dioleyl phosphatidylglycerol
(Avanti Polar Lipids) and 0.33 mm bis-BODIPY FL C11PC into 5 ml assay buffer. Substrate turnover was measured at 528 nm emission after 488 nm excitation. Activity
was calculated from the initial velocity. Porcine pancreas
phospholipase A2 (Fluka ⁄ Sigma-Aldrich, Buchs, Swizerland) was used as a control.
Density gradient centrifugation
Size-exclusion chromatography
For analysis of endogenous Lpx1p by gel filtration, 5 mL of
a glass bead lysate of oleate-induced BY4742 wild-type cells
in buffer A (buffer P, pH 7.3, 300 mm sodium chloride) with
a protease inhibitor mix were injected into a HiLoad 16 ⁄ 60
Superdex 200 prepgrade column (GE Healthcare) and eluted
using buffer A at a flow rate of 1 mL)1Æmin and a fraction
size of 2 mL. Fractions were analysed by SDS–PAGE and
Western blotting. A 500 lL aliquot of the concentrated
Ni-Sepharose eluate of Lpx1p from E. coli expression was
purified in the same buffer under the same conditions. For
estimation of Lpx1p complex sizes, molecular masses were
interpolated from a calibration curve generated using
ovalbumin (45 kDa), carboanhydrase (29 kDa), trypsin
inhibitor (20.1 kDa), lactalbumin (14.2 kDa) and aprotinin
(6.5 kDa) as molecular mass standards.
Enzyme assays
Esterase activity was determined using 0.5 mm p-nitrophenyl butyrate (Sigma-Aldrich, Seelze, Germany) in NaCl ⁄ Pi
(pH 7.4) in a total volume of 200 lL at 37 C. The amount
of free p-nitrophenol was determined at 410 nm in 96-well
plates. Michaelis–Menten kinetics were analysed using
GraphPad Prism4 (Graph Pad Software, San Diego, CA,
USA).
Lipase activity was determined using 0.5 mm DPG (Marker Gene Technologies, Eugene, OR, USA) in 0.1 m glycine, 19 mm sodium deoxicholate, pH 9.5, in a total volume
512
Gradient centrifugation was carried out essentially as
described previously [37]. Briefly, oleate-induced yeast cells
were converted to spheroblasts using 25 UÆg)1 Zymolyase 100T (MP Biomedicals, Illkirch, France). Spheroblasts
were gently ruptured by Potter–Elvehjem homogenization,
and centrifuged at low speed (3 · 10 min at 600 g) to
generate postnuclear supernatants. These supernatants, containing 5 mg protein, were loaded on a 32–54% sucrose
gradient (Fig. 2D) or an Optiprep gradient (Fig. 4B) and
centrifuged for 3 h at 19 000 g (Sorvall SV288, 19 000 rpm,
4 C). The gradient was fractionated into about 29 fractions of 1.2 mL. Fractions were analysed using enzyme
assays for oxoacyl CoA thiolase, catalase, fumarase and
cytochrome c oxidase [37].
Other methods
Mass spectrometry and high-pressure lipid chromatography
have been described previously [14,15,38,39]. Subcellular
fractionation, yeast two-hybrid assays and electron microscopy were carried out as described previously [37].
Acknowledgements
We thank Elisabeth Becker, Monika Bürger and Uta
Ricken for technical assistance. We thank Sabine Weller and Hartmut Niemann for reading the manuscript.
We extend our thanks to three anonymous reviewers
FEBS Journal 275 (2008) 504–514 ª 2008 The Authors Journal compilation ª 2008 FEBS
S. Thoms et al.
who helped to improve the manuscript. This work
was supported by the Deutsche Forschungsgemeinschaft (Er178 ⁄ 2-4) and by the Fonds der Chemischen
Industrie.
References
1 Wanders RJ & Waterham HR (2006) Biochemistry of
mammalian peroxisomes revisited. Annu Rev Biochem
75, 295–332.
2 Weller S, Gould SJ & Valle D (2003) Peroxisome biogenesis disorders. Annu Rev Genomics Hum Genet 4,
165–211.
3 Thoms S & Erdmann R (2005) Import of proteins into
peroxisomes. In Protein Movement Across Membranes
(Eichler J, ed.), pp. 125–134. Landes Bioscience ⁄
Springer, New York, NY.
4 Motley A, Hettema E, Distel B & Tabak H (1994)
Differential protein import deficiencies in human
peroxisome assembly disorders. J Cell Biol 125, 755–767.
5 Funato M, Shimozawa N, Nagase T, Takemoto Y,
Suzuki Y, Imamura Y, Matsumoto T, Tsukamoto T,
Kojidani T, Osumi T et al. (2006) Aberrant peroxisome
morphology in peroxisomal b-oxidation enzyme
deficiencies. Brain Dev 28, 287–292.
6 Thoms S & Erdmann R (2006) Peroxisomal matrix
protein receptor ubiquitination and recycling. Biochim
Biophys Acta 1763, 1620–1628.
7 Platta HW & Erdmann R (2007) The peroxisomal
protein import machinery. FEBS Lett 581, 2811–2819.
8 Petriv OI, Tang L, Titorenko VI & Rachubinski RA
(2004) A new definition for the consensus sequence of
the peroxisome targeting signal type 2. J Mol Biol 341,
119–134.
9 Kal AJ, van Zonneveld AJ, Benes V, van den Berg M,
Koerkamp MG, Albermann K, Strack N, Ruijter JM,
Richter A, Dujon B et al. (1999) Dynamics of gene
expression revealed by comparison of serial analysis of
gene expression transcript profiles from yeast grown on
two different carbon sources. Mol Biol Cell 10, 1859–
1872.
10 Smith JJ, Marelli M, Christmas RH, Vizeacoumar FJ,
Dilworth DJ, Ideker T, Galitski T, Dimitrov K, Rachubinski RA & Aitchison JD (2002) Transcriptome profiling to identify genes involved in peroxisome assembly
and function. J Cell Biol 158, 259–271.
11 Voss H, Benes V, Andrade MA, Valencia A, Rechmann
S, Teodoru C, Schwager C, Paces V, Sander C &
Ansorge W (1997) DNA sequencing and analysis of
130 kb from yeast chromosome XV. Yeast 13, 655–672.
12 Schrag JD & Cygler M (1997) Lipases and a ⁄ b hydrolase fold. Methods Enzymol 284, 85–107.
13 Schafer H, Nau K, Sickmann A, Erdmann R & Meyer
HE (2001) Identification of peroxisomal membrane
Peroxisomal lipase Lpx1p
14
15
16
17
18
19
20
21
22
23
24
25
26
27
proteins of Saccharomyces cerevisiae by mass spectrometry. Electrophoresis 22, 2955–2968.
Erdmann R & Blobel G (1995) Giant peroxisomes in
oleic acid-induced Saccharomyces cerevisiae lacking the
peroxisomal membrane protein Pmp27p. J Cell Biol
128, 509–523.
Geisbrecht BV, Schulz K, Nau K, Geraghty MT,
Schulz H, Erdmann R & Gould SJ (1999) Preliminary
characterization of Yor180Cp: identification of a novel
peroxisomal protein of Saccharomyces cerevisiae
involved in fatty acid metabolism. Biochem Biophys Res
Commun 260, 28–34.
Brenner S (1988) The molecular evolution of genes and
proteins: a tale of two serines. Nature 334, 528–530.
Kyte J & Doolittle RF (1982) A simple method for displaying the hydropathic character of a protein. J Mol
Biol 157, 105–132.
Soding J (2005) Protein homology detection by HMM–
HMM comparison. Bioinformatics 21, 951–960.
Lametschwandtner G, Brocard C, Fransen M, Van
Veldhoven P, Berger J & Hartig A (1998) The difference
in recognition of terminal tripeptides as peroxisomal
targeting signal 1 between yeast and human is due to
different affinities of their receptor Pex5p to the cognate
signal and to residues adjacent to it. J Biol Chem 273,
33635–33643.
Gould SJ & Collins CS (2002) Opinion: peroxisomalprotein import: is it really that complex? Nat Rev Mol
Cell Biol 3, 382–389.
Lucau-Danila A, Delaveau T, Lelandais G, Devaux F
& Jacq C (2003) Competitive promoter occupancy by
two yeast paralogous transcription factors controlling
the multidrug resistance phenomenon. J Biol Chem 278,
52641–52650.
Mateo C, Archelas A & Furstoss R (2003) A spectrophotometric assay for measuring and detecting an epoxide hydrolase activity. Anal Biochem 314, 135–141.
Hiraga K, Suzuki K, Tsuchiya E & Miyakawa T (1993)
Cloning and characterization of the elongation factor
EF-1b homologue of Saccharomyces cerevisiae. EF-1b is
essential for growth. FEBS Lett 316, 165–169.
McDonald HB & Byers B (1997) A proteasome cap
subunit required for spindle pole body duplication in
yeast. J Cell Biol 137, 539–553.
Gray WM & Fassler JS (1996) Isolation and analysis
of the yeast TEA1 gene, which encodes a zinc cluster
Ty enhancer-binding protein. Mol Cell Biol 16, 347–
358.
Neuberger G, Maurer-Stroh S, Eisenhaber B, Hartig A
& Eisenhaber F (2003) Prediction of peroxisomal targeting signal 1 containing proteins from amino acid
sequence. J Mol Biol 328, 581–592.
Pernas MA, Lopez C, Pastrana L & Rua ML (2001)
Purification and characterization of Lip2 and Lip3
FEBS Journal 275 (2008) 504–514 ª 2008 The Authors Journal compilation ª 2008 FEBS
513
Peroxisomal lipase Lpx1p
28
29
30
31
32
33
514
S. Thoms et al.
isoenzymes from a Candida rugosa pilot-plant scale fedbatch fermentation. J Biotechnol 84, 163–174.
Goldberg IJ & Merkel M (2001) Lipoprotein lipase:
physiology, biochemistry, and molecular biology. Front
Biosci 6, D388–D405.
Yang J, Han X & Gross RW (2003) Identification of
hepatic peroxisomal phospholipase A(2) and characterization of arachidonic acid-containing choline glycerophospholipids in hepatic peroxisomes. FEBS Lett 546,
247–250.
Mancuso DJ, Jenkins CM, Sims HF, Cohen JM, Yang
J & Gross RW (2004) Complex transcriptional and
translational regulation of iPLAc resulting in multiple
gene products containing dual competing sites for mitochondrial or peroxisomal localization. Eur J Biochem
271, 4709–4724.
Murakami M, Masuda S, Ueda-Semmyo K, Yoda E,
Kuwata H, Takanezawa Y, Aoki J, Arai H, Sumimoto
H, Ishikawa Y et al. (2005) Group VIB Ca2+-independent phospholipase A2c promotes cellular membrane
hydrolysis and prostaglandin production in a manner
distinct from other intracellular phospholipases A2.
J Biol Chem 280, 14028–14041.
Mancuso DJ, Han X, Jenkins CM, Lehman JJ, Sambandam N, Sims HF, Yang J, Yan W, Yang K, Green
K et al. (2007) Dramatic accumulation of triglycerides
and precipitation of cardiac hemodynamic dysfunction
during brief caloric restriction in transgenic myocardium expressing human calcium-independent phospholipase A2gamma. J Biol Chem 282, 9216–9227.
Mancuso DJ, Sims HF, Han X, Jenkins CM, Guan SP,
Yang K, Moon SH, Pietka T, Abumrad NA, Schlesinger PH et al. (2007) Genetic ablation of calcium-independent phospholipase A2c leads to alterations in
34
35
36
37
38
39
mitochondrial lipid metabolism and function resulting
in a deficient mitochondrial bioenergetic phenotype.
J Biol Chem 232, 34611–34622.
Woolford CA, Noble JA, Garman JD, Tam MF, Innis
MA & Jones EW (1993) Phenotypic analysis of proteinase A mutants. Implications for autoactivation and the
maturation pathway of the vacuolar hydrolases of Saccharomyces cerevisiae. J Biol Chem 268, 8990–8998.
Chevray PM & Nathans D (1992) Protein interaction
cloning in yeast: identification of mammalian proteins
that react with the leucine zipper of Jun. Proc Natl
Acad Sci USA 89, 5789–5793.
Stein K, Schell-Steven A, Erdmann R & Rottensteiner
H (2002) Interactions of Pex7p and Pex18p ⁄ Pex21p
with the peroxisomal docking machinery: implications
for the first steps in PTS2 protein import. Mol Cell Biol
22, 6056–6069.
Schafer A, Kerssen D, Veenhuis M, Kunau WH &
Schliebs W (2004) Functional similarity between the
peroxisomal PTS2 receptor binding protein Pex18p and
the N-terminal half of the PTS1 receptor Pex5p. Mol
Cell Biol 24, 8895–8906.
Schäfer H, Nau K, Sickmann A, Erdmann R & Meyer
HE (2001) Identification of peroxisomal membrane proteins of Saccharomyces cerevisiae by mass spectrometry.
Electrophoresis 22, 2955–2968.
Immler D, Gremm D, Kirsch D, Spengler B, Presek P
& Meyer HE (1998) Identification of phosphorylated
proteins from thrombin-activated human platelets
isolated by two-dimensional gel electrophoresis by
electrospray ionization–tandem mass spectrometry
(ESI-MS ⁄ MS) and liquid chromatography–electrospray
ionization–mass spectrometry (LC-ESI-MS). Electrophoresis 19, 1015–1023.
FEBS Journal 275 (2008) 504–514 ª 2008 The Authors Journal compilation ª 2008 FEBS
Seventh International Meeting on AAA Proteins
The AAA peroxins Pex1p and Pex6p function as
dislocases for the ubiquitinated peroxisomal
import receptor Pex5p
Harald W. Platta, Mykhaylo O. Debelyy, Fouzi El Magraoui and Ralf Erdmann1
Abteilung für Systembiochemie, Medizinische Fakultät der Ruhr-Universität Bochum, D-44780 Bochum, Germany
Biochemical Society Transactions
www.biochemsoctrans.org
Abstract
The discovery of the peroxisomal ATPase Pex1p triggered the beginning of the research on AAA (ATPase
associated with various cellular activities) proteins and the genetic dissection of peroxisome biogenesis.
Peroxisomes are virtually ubiquitous organelles, which are connected to diverse cellular functions. The
highly diverse and adaptive character of peroxisomes is accomplished by modulation of their enzyme
content, which is mediated by dynamically operating protein-import machineries. The import of matrix
proteins into the peroxisomal lumen has been described as the ATP-consuming step, but the corresponding
reaction, as well as the ATPase responsible, had been obscure for nearly 15 years. Recent work using
yeast and human fibroblast cells has identified the peroxisomal AAA proteins Pex1p and Pex6p as
mechano-enzymes and core components of a complex which dislocates the cycling import receptor
Pex5p from the peroxisomal membrane back to the cytosol. This AAA-mediated process is regulated by
the ubiquitination status of the receptor. Pex4p [Ubc10p (ubiquitin-conjugating enzyme 10)]-catalysed
mono-ubiquitination of Pex5p primes the receptor for recycling, thereby enabling further rounds of matrix
protein import, whereas Ubc4p-catalysed polyubiquitination targets Pex5p to proteasomal degradation.
Introduction
Pex1p (formerly Pas1p), Sec18p [NSF (N-ethylmaleimidesensitive factor)] and Cdc48p (cell division cycle 48 protein)
[p97/VCP (valosin-containing protein)] represent the first
proteins that were recognized as belonging to a novel family
of ATPases [1], the AAA (ATPase associated with various
cellular activities) family [2], which later was extended to
the family of AAA+ proteins [3]. Belonging to the class of
P-loop (phosphate-binding) NTPases, the AAA+ proteins
are especially distinguished by the presence of at least one
evolutionarily conserved 200–250-amino-acid ATP-binding
domain that contains Walker A and B motifs in addition
to other structural features, such as the SRH (second
region of homology), which distinguishes AAA proteins
from other AAA+ proteins [4]. Although the members of
the AAA+ family display a high functional diversity, the
common function of all seems to be the ability to catalyse
reactions that are associated with significant conformational
remodelling of substrate proteins or nucleic acids [5].
A lot of detailed information regarding the structure and
molecular mechanism of AAA proteins has been accumulated, but our understanding of the molecular function of
Key words: ATPase associated with various cellular activities (AAA), peroxin, PEX, protein
transport, ubiquitination.
Abbreviations used: AAA, ATPase associated with various cellular activities; Cdc48p, cell
division cycle 48 protein; NSF, N-ethylmaleimide-sensitive factor; NTD, N-terminal domain;
PTS, peroxisomal targeting signal; SRH, second region of homology; Ubc, ubiquitin-conjugating
enzyme; VCP, valosin-containing protein.
1
To whom correspondence should be addressed (email [email protected]).
Biochem. Soc. Trans. (2008) 36, 99–104; doi:10.1042/BST0360099
Pex1p and Pex6p, the second AAA peroxin in peroxisomal
biogenesis [6], remained incomplete for many years.
Peroxisomes are single-membrane-bound organelles of
virtually all eukaryotic cells, which display a unique variability in their enzyme content and metabolic functions that
are adjusted according to the cellular needs. Their matrix
harbours at least 50 different enzymes that are linked to
diverse biochemical pathways. The β-oxidation of fatty
acids and the detoxification of hydrogen peroxide are
regarded as the central function of peroxisomes. They
are the source of signalling molecules such as jasmonates
in plants or lipid-derived ligands for PPARs (peroxisomeproliferator-activated receptors) in humans. Other functions
of peroxisomes include the final steps of penicillin biosynthesis in some filamentous fungi, the main reactions of photorespiration in leaf peroxisomes and the synthesis of bile acid
and ether lipids such as plasmalogens in mammals, which
contribute more than 80 % of the phospholipid content of
the white matter in the brain [7].
Because of the central role of peroxisomes in lipid metabolism, they are essential for normal human development
and physiology. This is emphasized by a group of genetic
disorders collectively referred to as the peroxisome disorders,
which, in most cases, lead to death in early infancy [8].
Detailed analysis of the complementation groups finally revealed that the most common cause of peroxisomal biogenesis
disorders are mutations in Pex1p [9]. More than 80 % of all
patients with Zellweger syndrome, the most severe peroxisome biogenesis disorder, carry mutations in Pex1p or Pex6p
[10].
C The
C 2008 Biochemical Society
Authors Journal compilation 99
100
Biochemical Society Transactions (2008) Volume 36, part 1
Molecular architecture of the peroxisomal
AAA complex
AAA proteins are characterized by a typical modular
architecture as they contain an N-terminal non-ATPase domain which is followed by at least one conserved AAA
domain. Each AAA cassette usually contains an ATP-binding
site (Walker A) and an ATP-hydrolysis site (Walker B) along
with other motifs, such as the SRH [4].
Pex1p and Pex6p are type II AAA proteins, which are
characterized by two AAA domains (Figure 1). In both AAA
peroxins, the second AAA domain is more conserved than
the first one. Interaction and subsequent oligomerization of
Pex1p and Pex6p is believed to be initiated in the cytosol and
involves their first less conserved AAA domains (D1) [11,12].
Although neither binding nor hydrolysis of ATP at D1 seems
to be essential for functionality in both yeast and humans,
the interaction of human Pex1p and Pex6p is stimulated by
binding of ATP to D1 of human Pex1p and Pex6p [12,13].
Furthermore, ATP binding, but not hydrolysis, at the second
AAA cassette (D2) of Pex1p is required for the Pex1p–Pex6p
interaction in both systems [11,12].
Pex1p and Pex6p are believed to form heterohexameric
structures in the cytosol and at the peroxisomal membrane
[12,14–16]. However, it is not clear whether formation of a
heteromeric assembly of the AAA peroxins is a prerequisite
for their function, as one population of Pex1p does not
co-localize with Pex6p in mammalian cells [12,17]. Although
the formation of hexameric structures is common to AAA
proteins, the formation of heterohexamers has been found in
few other cases, such as the m-AAA (matrix AAA) complex,
consisting of Yta10p and Yta12p, which is active at the
matrix site of the inner mitochondrial membrane, [18] or
the six different Rpt ATPases from the 19S proteasome
[19].
The recruitment of AAA complexes to peroxisomes
is mediated by the tail-anchored peroxisomal membrane
proteins Pex15p in Saccharomyces cerevisiae or its functional
orthologue Pex26p in human cells via binding of the
N-terminal domain of Pex6p, stimulated by ATP binding
to the Walker A motif of Pex6p D1 [20,21]. In contrast,
the Walker A and B motifs of Pex6p D2 are required for
an efficient detachment from Pex15p/Pex26p [12,20,22].
Although Pex15p and Pex26p have been described as adaptor
proteins for the N-terminal part of Pex6p, no adaptor has
yet been identified for Pex1p.
The NTD (N-terminal domain) of murine Pex1p represents the only available crystal structure of the AAA peroxins
[23]. The NTD folds into two structurally independent
globular subdomains (N- and C-lobe), which comprise
an N-terminal double-ψ fold and a C-terminal β-barrel,
separated by a shallow groove. Similar grooves were found in
the adaptor-binding sites within the NTDs of VCP, NSF and
VAT (VCP-like ATPase from Thermoplasma), suggesting
functional similarity [23].
The Pex15p-anchored AAA complex itself is part of an
even larger protein complex at the peroxisomal membrane,
C The
C 2008 Biochemical Society
Authors Journal compilation the peroxisomal matrix protein import machinery called the
importomer (Figure 1) [15].
To conclude, at least in S. cerevisiae, the Pex1p-bound
nucleotides seem to influence the Pex1p–Pex6p interaction,
while the different nucleotide states of Pex6p regulate
the dynamic Pex6p–Pex15p/Pex26p association. The nonconserved domains are responsible for oligomerization, while
the conserved domains exhibit the main ATPase activity.
Pex1p and Pex6p: peroxins associated
with diverse cellular activities?
Besides their involvement in peroxisomal biogenesis, the
AAA peroxins have been suggested to carry out other functions as well. Human Pex6p has been reported to interact specifically with the nucleocytoplasmatic transcriptional regulators Smad2, Smad3, Smad4 and Smad7 [24]. These proteins are
involved in the signalling pathway of the plasma membrane
receptor TGFβ (transforming growth factor β), which regulates apoptosis. Furthermore, a suppressor screen for aging
defects in mitochondria revealed that Pex6p, but not Pex1p,
complements an ATP2-caused import defect into mitochondria, indicating a novel, yet not understood, function of this
peroxin in mitochondrial inheritance and senescence [25].
In the context of peroxisomal biogenesis, the different
functions discussed are mostly linked to the modulation
of membrane dynamics. On the basis of the finding that
Pex1p and Pex6p can associate with membranous subcellular
structures distinct from mature peroxisomes in the yeasts
Pichia pastoris and Yarrowia lipolytica, these peroxins were
thought to play a role in lipid or membrane transport [14,26].
Utilizing in vitro fusion experiments, Pex1p and Pex6p
were shown to be required for the fusion of five different
premature peroxisomal vesicle species in Y. lipolytica [26],
a process which might play a role during the maturation
of endoplasmic reticulum-derived peroxisomal structures
during de novo synthesis of peroxisomes [27]. The still
putative functional relevance of the observed phospholipidbinding activity of the murine Pex1p NTD, which has
also been described for VCP and NSF, might be linked
to this process [28]. Furthermore, the presence of Pex6p
and Pex15p is required for peroxisomal localization of the
GTPase Rho1p, which is thought to organize actin filaments
on peroxisomes during proliferation [29].
The existence of a link between the AAA peroxins and
matrix protein import has been proposed previously [30],
but has remained elusive for many years. Recently, their
functional role in peroxisomal protein import was discovered.
The AAA peroxins are required for the dislocation of the
cycling peroxisomal import receptors Pex5p and Pex20p
from the peroxisomal membrane back to the cytosol in order
to complete their receptor cycle [31–34].
The AAA peroxins function as dislocases for
the ubiquitinated PTS1 (peroxisomal
targeting signal 1) receptor Pex5p
Import of folded proteins into peroxisomes occurs in a
post-translational manner and depends on ATP. The soluble
Seventh International Meeting on AAA Proteins
Figure 1 Molecular organization of the AAA complex in S. cerevisiae
The AAA peroxins Pex1p and Pex6p are composed of an NTD, a non-conserved AAA domain (D1) and a conserved AAA
domain (D2). The AAA domains contain ATP-binding sites (A) and, with the exception of D1 of Pex6p, also ATP-hydrolysis
sites (B). Pex1p and Pex6p form a heteromeric complex, and oligomerization requires the presence of the D1 domains and
is stimulated by ATP binding to Pex1p D2. Recruitment of the AAA complex to peroxisomes occurs via binding of Pex6p NTD
to Pex15p and requires ATP binding at Pex6p D1, while detachment from Pex15p needs ATP binding and hydrolysis at Pex6p
D2. The peroxisomal AAA complex dynamically associates with the functional matrix protein-import machinery (importomer)
and Pex4p (Ubc10p) is supposed to be required for the disconnection of the AAA complex from the importomer.
PTS1 receptor Pex5p is the major signal-recognition factor
of proteins destined for the peroxisomal matrix. The receptor
cycle of Pex5p involves cargo recognition in the cytosol,
docking of the receptor–cargo complex to the peroxisomal
membrane, translocation of the receptor–cargo complex to
the luminal side of the membrane, followed by release of the
cargo into the matrix and retrotranslocation of the receptor
back to the cytosol (Figure 2) [7].
Permeabilized cell systems of human fibroblasts provided
the first evidence that Pex5p accumulated reversibly at the
peroxisomal membrane under ATP-modulated conditions
[30]. Detailed in vitro studies revealed that the binding and
translocation of Pex5p itself is ATP-independent while the
export of Pex5p back to the cytosol requires ATP [35]. The
identity of the corresponding ATPase remained a matter of
debate until in vitro systems in S. cerevisiae [34] and human
fibroblast cells [32] identified Pex1p and Pex6p as the motor
proteins of Pex5p export. Their function in this process
requires the presence of their membrane-anchor proteins,
Pex15p or Pex26p. The in vitro reconstitution of the complete
Pex5p cycle revealed that ATP binding and hydrolysis at both
Pex1p D2 and Pex6p D2 is needed for receptor dislocation
[34]. Interestingly, the Walker B motif of Pex1p D2 seems
to have no function in formation or targeting of the AAA
complexes [11,12] and thus may be exclusively required for
handling of the substrate. The binding and consumption of
ATP is believed to induce conformational changes within
the AAA peroxins that generate the driving force to
pull the receptor out of the membrane by a mechanism
possibly similar to the one of Cdc48p (p97/VCP) in ERAD
(endoplasmic reticulum-associated degradation) [36].
The mechanism of substrate recognition by the AAA peroxins is not understood. Although Pex5p and the AAA
proteins form a complex at the peroxisomal membrane
[15,32,34], no direct interaction of the PTS1 receptor with
either Pex1p or Pex6p has been reported. This interaction
seems to be regulated or mediated by a third factor, which
could represent an unknown adaptor protein of the AAA
peroxins or post-translational modification of the substrate.
It is well known that both processes play a central role in
the function of Cdc48p (p97/VCP) [37,38], which is the
closest evolutionary relative of Pex1p and Pex6p [39,40].
C The
C 2008 Biochemical Society
Authors Journal compilation 101
102
Biochemical Society Transactions (2008) Volume 36, part 1
Figure 2 Peroxisomal matrix protein import
The AAA peroxins export the ubiquitinated PTS1 receptor back to the cytosol. The PTS1-recognition factor Pex5p binds newly
synthesized PTS1-harbouring cargo proteins in the cytosol and ferries them to the docking complex (Pex13p, Pex14p, Pex17p)
at the peroxisomal membrane. The receptor–cargo complex reaches the luminal side of the membrane, where the cargo is
released in a process that possibly involves Pex8p. ATP-dependent retrotranslocation of the membrane-integrated Pex5p is
mediated by the Pex15p-anchored AAA complex consisting of Pex1p and Pex6p. Pex5p can either be mono-ubiquitinated
by the Pex22p-anchored Pex4p in order to be recycled (recycling pathway) or it can be polyubiquitinated by Ubc4p, Ubc5p
and Ubc1p, resulting in proteasomal degradation (proteolytic pathway). Both pathways rely on ATP-dependent activation of
ubiquitin by E1 and possibly require the RING (really interesting new gene) peroxins Pex2p, Pex10p and Pex12p as putative
E3 enzymes.
As a consequence, the question has to be addressed of how
the AAA peroxins can distinguish Pex5p forms destined
for dislocation from cargo-loaded Pex5p species destined for
cargo translocation. A possible solution may arise from the
crystal structure of Pex1p NTD, which displays similarities
to the corresponding adaptor-binding domains of other
AAA proteins [23]. Data from p97 and Ufd1 have identified
a double-ψ β-barrel fold as a ubiquitin-binding domain with
binding sites for both mono- and poly-ubiquitin [41].
Most interestingly, the PTS receptors Pex5p, Pex18p
and Pex20p have been demonstrated to be ubiquitinated
[31,42–44]. The PTS1 receptor Pex5p of S. cerevisiae is monoubiquitinated in wild-type cells [45], whereas it has been
shown to be polyubiquitinated in mutants of the proteasome or cells affected in the AAA and Pex4p–Pex22p
complexes of the peroxisomal protein-import machinery
[42,43]. Polyubiquitination of Pex5p, requiring the ubiquitinconjugating enzymes Ubc4p and the partly redun
C The
C 2008 Biochemical Society
Authors Journal compilation dant Ubc5p and Ubc1p, takes place exclusively at the
peroxisomal membrane and marks the receptor for
proteasomal degradation as part of a quality-control system
[42,43,45]. Alternatively, Pex5p is the specific molecular
target for mono-ubiquitination by Pex4p (Ubc10p) [33,46],
which is essential for peroxisomal biogenesis [47] and is
anchored via Pex22p to the peroxisomal membrane [48].
The functional role of ubiquitination in the dislocation
process has been elucidated by in vitro export assays,
revealing that mono-ubiquitination of Pex5p constitutes
the export signal under physiological conditions, whereas
polyubiquitination seems to provide an export signal for the
release of dysfunctional PTS1 receptors from the membrane
and proteasomal degradation as part of the quality-control
pathway [33].
The direct mechanistic influence of this modification on
the export reaction remains to be investigated. The AAA
peroxins may interact directly or indirectly via putative
Seventh International Meeting on AAA Proteins
adaptors with the ubiquitin tag on Pex5p. Alternatively, the
attachment of ubiquitin may induce local conformational
changes within Pex5p to expose hidden binding sites. This
mode of interaction is also discussed for Cdc48p (p97/VCP),
which binds ubiquitin via adaptor complexes such as Ufd1/
Npl4 and via its N-terminal domain. This domain is capable
of recognizing ubiquitin chains and also non-modified
segments of its substrates [49,50].
Notably, the AAA complex displays significantly increased association with the importomer in PEX4-deficient
cells, indicating that the ATPase cycles of Pex1p and Pex6p
are coupled to the mono-ubiquitination-dependent receptor
cycle of Pex5p (Figure 1) [15].
Conclusions
Peroxisomes exhibit unique dynamics in their enzyme
content and metabolic functions. The accompanied changes
are accomplished by elaborate protein-transport machineries.
The energy requirement for peroxisomal protein import is
determined by the ATP-dependent dislocation of the import
receptors, which probably represents the rate-limiting step.
The energy is utilized by two enzyme activities: (i) monoubiquitination by Pex4p (recycling pathway) or polyubiquitination by Ubc4p (proteolytic pathway), as ubiquitin first
has to be activated by E1; and (ii) ATP hydrolysis in the
conserved AAA domains of Pex1p and Pex6p in order to pull
the primed PTS receptor out of the membrane.
These results bring together the previously disparate roles
of Pex4p and the AAA peroxins in one concerted reaction sequence. For future research, it will be a challenge to elucidate
how AAA-mediated receptor dislocation is mechanistically
linked to the peroxisomal import of folded proteins.
Note added in proof (received 13
December 2007)
After submission of the present paper, an article appeared
concerning the ubiquitination of mammalian Pex5p [51].
This study demonstrates that this modification is required
for recycling and thus reveals that the mechanism of AAA
peroxin function is highly censerved in evolution.
We apologize to those scientists whose work could not be cited due
to space limitations. We are grateful to Sigrid Wüthrich for technical
assistance and Wolfgang Girzalsky and Marion Witt-Reinhardt for
the reading of the manuscript. This work was supported by the
Deutsche Forschungsgemeinschaft (SFB642, Er178/2-4), the FP6
European Union Project ‘Peroxisome’ (LSHG-CT-2004-512018) and
by the Fonds der Chemischen Industrie.
References
1 Erdmann, R., Wiebel, F.F., Flessau, A., Rytka, J., Beyer, A., Fröhlich, K.U.
and Kunau, W.-H. (1991) PAS1, a yeast gene required for peroxisome
biogenesis, encodes a member of a novel family of putative ATPases.
Cell 64, 499–510
2 Kunau, W.-H., Beyer, A., Franken, T., Götte, K., Marzioch, M., Saidowsky,
J., Skaletz-Rorowski, A. and Wiebel, F.F. (1993) Two complementary
approaches to study peroxisome biogenesis in Saccharomyces
cerevisiae: forward and reversed genetics. Biochimie 75, 209–224
3 Neuwald, A.F., Aravind, L., Spouge, J.L. and Koonin, E.V. (1999) AAA+: a
class of chaperone-like ATPases associated with the assembly, operation
and disassembly of protein complexes. Genome Res. 9, 27–43
4 Erzberger, J.P. and Berger, J.M. (2006) Evolutionary relationships and
structural mechanisms of AAA+ proteins. Annu. Rev. Biophys.
Biomol. Struct. 35, 93–114
5 Hanson, P.I. and Whiteheart, S.W. (2005) AAA+ proteins: have engine,
will work. Nat. Rev. Mol. Cell Biol. 6, 519–529
6 Voorn-Brouwer, T., van der Leij, I., Hemrika, W., Distel, B. and Tabak, H.F.
(1993) Sequence of the PAS8 gene, the product of which is essential for
biogenesis of peroxisomes in Saccharomyces cerevisiae.
Biochem. Biophys. Acta 1216, 325–328
7 Erdmann, R. and Schliebs, W. (2005) Peroxisomal matrix protein import:
the transient pore model. Nat. Rev. Mol. Cell Biol. 6, 738–742
8 Wanders, R.J. (2004) Metabolic and molecular basis of peroxisomal
disorders: a review. Am. J. Med. Genet. 126A, 355–375
9 Reuber, B.E., Germain-Lee, E., Collins, C.S., Morrell, J.C., Ameritunga, R.,
Moser, H.W., Valle, D. and Gould, S.J. (1997) Mutations in PEX1 are the
most common cause of peroxisome biogenesis disorders. Nat. Genet.
17, 445–448
10 Geisbrecht, B.V., Collins, C.S., Reuber, B.E. and Gould, S.J. (1998)
Disruption of a PEX1–PEX6 interaction is the most common cause of the
neurologic disorders Zellweger syndrome, neonatal
adrenoleukodystrophy, and infantile Refsum disease. Proc. Natl. Acad.
Sci. U.S.A. 95, 8630–8635
11 Birschmann, I., Rosenkranz, K., Erdmann, R. and Kunau, W.-H. (2005)
Structural and functional analysis of the interaction of the AAA-peroxins
Pex1p and Pex6p. FEBS J. 272, 47–58
12 Tamura, S., Yasutake, S., Matsumoto, N. and Fujiki, Y. (2006) Dynamic
and functional assembly of the AAA peroxins, Pex1p and Pex6p,
and their membrane receptor Pex26p. J. Biol. Chem. 281,
27693–27704
13 Fan, W. and Fujiki, Y. (2006) A temperature-sensitive CHO pex1 mutant
with a novel mutation in the AAA Walker A1 motif. Biochem. Biophys.
Res. Commun. 345, 1434–1439
14 Faber, K.N., Heyman, J.A. and Subramani, S. (1998) Two AAA family
peroxins, PpPex1p and PpPex6p, interact with each other in an
ATP-dependent manner and are associated with different subcellular
membranous structures distinct from peroxisomes. Mol. Cell. Biol. 18,
936–943
15 Rosenkranz, K., Birschmann, I., Grunau, S., Girzalsky, W., Kunau, W.-H.
and Erdmann, R. (2006) Functional association of the AAA-complex and
the peroxisomal importomer. FEBS J. 273, 3804–3815
16 Tamura, S., Shimozawa, N., Suzuki, Y., Tsukamoto, T., Osumi, T. and
Fujiki, Y. (1998) A cytoplasmic AAA family peroxin, Pex1p, interacts with
Pex6p. Biochem. Biophys. Res. Commun. 245, 883–886
17 Weller, S., Cajigas, I., Morrell, J., Obie, C., Steel, G., Gould, S.J. and
Valle, D. (2005) Alternative splicing suggests extended function of PEX26
in peroxisome biogenesis. Am. J. Hum. Genet. 76, 987–1007
18 Arlt, H., Tauer, R., Feldmann, H., Neupert, W. and Langer, T. (1996) The
YTA10–12 complex, an AAA protease with chaperone-like activity in
the inner membrane of mitochondria. Cell 85, 875–885
19 Glickman, M.H., Rubin, D.M., Fried, V.A. and Finley, D. (1998) The
regulatory particle of the S. cerevisiae proteasome. Mol. Cell. Biol. 18,
3149–3162
20 Birschmann, I., Stroobants, A.K., Van Den Berg, M., Schäfer, A.,
Rosenkranz, K., Kunau, W.H. and Tabak, H.F. (2003) Pex15p of
Saccharomyces cerevisiae provides a molecular basis for recruitment of
the AAA peroxin Pex6p to peroxisomal membranes. Mol. Biol. Cell 14,
2226–2236
21 Matsumoto, N., Tamura, S. and Fujiki, Y. (2003) The pathogenic peroxin
Pex26p recruits the Pex1p–Pex6p AAA ATPase complexes to
peroxisomes. Nat. Cell Biol. 5, 454–460
22 Furuki, S., Tamura, S., Matsumoto, N., Miyata, N., Moser, A., Moser, H.W.
and Fujiki, Y. (2006) Mutations in the peroxin Pex26p responsible for
peroxisome biogenesis disorders of complementation group 8 impair its
stability, peroxisomal localization, and interaction with Pex1p–Pex6p
complex. J. Biol. Chem. 281, 1317–1323
23 Shiozawa, K., Maita, N., Tomii, K., Seto, A., Goda, N., Akiyama, Y.,
Shimizu, T., Shirakawa, M. and Hiroaki, H. (2004) Structure of the
N-terminal domain of PEX1 AAA-ATPase: characterization of a putative
adaptor-binding domain. J. Biol. Chem. 279, 50060–50068
C The
C 2008 Biochemical Society
Authors Journal compilation 103
104
Biochemical Society Transactions (2008) Volume 36, part 1
24 Warner, D.R., Roberts, E.A., Greene, R.M. and Pisano, M.M. (2003)
Identification of novel Smad binding proteins. Biochem. Biophys. Res.
Commun. 312, 1185–1190
25 Seo, J.G., Lai, C.Y., Miceli, M.V. and Jazwinski, S.M. (2007) A novel role of
peroxin PEX6: suppression of aging defects in mitochondria. Aging Cell 6,
405–413
26 Titorenko, V.I. and Rachubinski, R.A. (2000) Peroxisomal membrane
fusion requires two AAA family ATPases, Pex1p and Pex6p. J. Cell Biol.
150, 881–886
27 Titorenko, V.I. and Mullen, R.T. (2006) Peroxisome biogenesis: the
peroxisomal endomembrane system and the role of the ER. J. Cell Biol.
174, 11–17
28 Shiozawa, K., Goda, N., Shimizu, T., Mizuguchi, K., Kondo, N.,
Shimozawa, N., Shirakawa, M. and Hiroaki, H. (2006) The common
phospholipid-binding activity of the N-terminal domains of PEX1 and
VCP/p97. FEBS J. 273, 4959–4971
29 Marelli, M., Smith, J.J., Jung, S., Yi, E., Nesvizhskii, A.I., Christmas, R.H.,
Saleem, R.A., Tam, Y.Y., Fagarasanu, A., Goodlett, D.R. et al. (2004)
Quantitative mass spectrometry reveals a role for the GTPase Rho1p in
actin organization on the peroxisome membrane. J. Cell Biol. 167,
1099–1112
30 Dodt, G. and Gould, S.J. (1996) Multiple PEX genes are required for
proper subcellular distribution and stability of Pex5p, the PTS1 receptor:
evidence that PTS1 protein import is mediated by a cycling receptor.
J. Cell Biol. 135, 1763–1774
31 Leon, S., Zhang, L., McDonald, W.H., Yates, 3rd, J., Cregg, J.M. and
Subramani, S. (2006) Dynamics of the peroxisomal import cycle of
PpPex20p: ubiquitin-dependent localization and regulation. J. Cell Biol.
172, 67–78
32 Miyata, N. and Fujiki, Y. (2005) Shuttling mechanism of peroxisome
targeting signal type 1 receptor Pex5: ATP-independent import and
ATP-dependent export. Mol. Cell. Biol. 25, 10822–10832
33 Platta, H.W., El Magraoui, F., Schlee, D., Grunau, S., Girzalsky, W. and
Erdmann, R. (2007) Ubiquitination of the peroxisomal import receptor
Pex5p is required for its recycling. J. Cell Biol. 177, 197–204
34 Platta, H.W., Grunau, S., Rosenkranz, K., Girzalsky, W. and Erdmann, R.
(2005) Functional role of the AAA peroxins in dislocation of the cycling
PTS1 receptor back to the cytosol. Nat. Cell Biol. 7, 817–822
35 Gouveia, A.M., Guimaraes, C.P., Oliveira, M.E., Reguenga, C., Sa-Miranda,
C. and Azevedo, J.E. (2002) Characterization of the peroxisomal cycling
receptor, Pex5p, using a cell-free in vitro import system. J. Biol. Chem.
278, 226–232
36 Pye, V.E., Dreveny, I., Briggs, L.C., Sands, C., Beuron, F., Zhang, X. and
Freemont, P.S. (2006) Going through the motions: the ATPase cycle of
p97. J. Struct. Biol. 156, 12–28
37 Jentsch, S. and Rumpf, S. (2007) Cdc48 (p97): a “molecular gearbox” in
the ubiquitin pathway? Trends Biochem. Sci. 32, 6–11
C The
C 2008 Biochemical Society
Authors Journal compilation 38 Welchman, R.L., Gordon, C. and Mayer, R.J. (2005) Ubiquitin and
ubiquitin-like proteins as multifunctional signals. Nat. Rev. Mol. Cell Biol.
6, 599–609
39 Gabaldon, T., Snel, B., van Zimmeren, F., Hemrika, W., Tabak, H.F. and
Huynen, M.A. (2006) Origin and evolution of the peroxisomal proteome.
Biol. Direct 1, 1–14
40 Schluter, A., Fourcade, S., Ripp, R., Mandel, J.L., Poch, O. and Pujol, A.
(2006) The evolutionary origin of peroxisomes: an ER–peroxisome
connection. Mol. Biol. Evol. 23, 838–845
41 Park, S., Isaacson, R., Kim, H.T., Silver, P.A. and Wagner, G. (2005) Ufd1
exhibits the AAA-ATPase fold with two distinct ubiquitin interaction sites.
Structure 13, 995–1005
42 Kiel, J.A., Emmrich, K., Meyer, H.E. and Kunau, W.H. (2005) Ubiquitination
of the PTS1 receptor, Pex5p, suggests the presence of a quality control
mechanism during peroxisomal matrix protein import. J. Biol. Chem.
280, 1921–1930
43 Platta, H.W., Girzalsky, W. and Erdmann, R. (2004) Ubiquitination of the
peroxisomal import receptor Pex5p. Biochem. J. 384, 37–45
44 Purdue, P.E. and Lazarow, P.B. (2001) Pex18p is constitutively degraded
during peroxisome biogenesis. J. Biol. Chem. 276, 47684–47689
45 Kragt, A., Voorn-Brouwer, T.M., Van den Berg, M. and Distel, B. (2005)
The Saccharomyces cerevisiae peroxisomal import receptor Pex5p is
monoubiquitinated in wild type cells. J. Biol. Chem. 280, 7867–7874
46 Williams, C., van den Berg, M., Sprenger, R.R. and Distel, B. (2007) A
conserved cysteine is essential for Pex4p-dependent ubiquitination of
the peroxisomal import receptor Pex5p. J. Biol. Chem. 282,
22534–22543
47 Wiebel, F.F. and Kunau, W.-H. (1992) The PAS2 protein essential for
peroxisome biogenesis is related to ubiquitin-conjugating enzymes.
Nature 359, 73–76
48 Koller, A., Snyder, W.B., Faber, K.N., Wenzel, T.J., Rangell, L., Keller, G.A.
and Subramani, S. (1999) Pex22p of Pichia pastoris, essential for
peroxisomal matrix protein import, anchors the ubiquitin-conjugating
enzyme, Pex4p, on the peroxisomal membrane. J. Cell Biol. 146, 99–112
49 Thoms, S. (2002) Cdc48 can distinguish between native and non-native
proteins in the absence of cofactors. FEBS Lett. 520, 107–110
50 Ye, Y., Meyer, H.H. and Rapoport, T.A. (2003) Function of the
p97–Ufd1–Npl4 complex in retrotranslocation from the ER to the cytosol:
dual recognition of nonubiquitinated polypeptide segments and
polyubiquitin chains. J. Cell Biol. 162, 71–84
51 Carvalho, A.F., Pinto, M.P., Grou, C.P., Alencastre, I.S., Fransen, M.,
Sá-Miranda, C. and Azevedo, J.F. (2007) Ubiquitination of mammalian
Pex5p, the peroxisomal import receptor. J. Biol. Chem. 282,
31267–31272
Received 28 August 2007
doi:10.1042/BST0360099
JBC Papers in Press. Published on June 10, 2011 as Manuscript M111.238600
The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M111.238600
Ubp15p, an ubiquitin hydrolase associated with the peroxisomal
export machinery
Mykhaylo O. Debelyy1, Harald W. Platta1,2, Delia Saffian1, Astrid Hensel1, Sven
Thoms1,3, Helmut E. Meyer4, Bettina Warscheid4,5, Wolfgang Girzalsky1 and
Ralf Erdmann1§
1
Running head: A role for Ubp15p in Peroxisome Biogenesis
Correspondence to: Dr. Ralf Erdmann, Institut für Physiologische Chemie, Ruhr-Universität
Bochum, Universitätsstr. 150, D-44780 Bochum, Tel.
49-234-322-4943, Fax.
49234-321-4266, email. [email protected]
§
The peroxisomal matrix protein import is
facilitated by cycling receptors shuttling
between the cytosol and the peroxisomal
membrane. One crucial step in this cycle is
the ATP-dependent release of the receptors
from the peroxisomal membrane. This step
is facilitated by the peroxisomal AAAproteins
Pex1p
and
Pex6p
with
ubiquitination of the receptor being the
main signal for its export. Here we report
that the AAA-complex contains dislocase as
well as deubiquitinating activity. Ubp15p,
an ubiquitin hydrolase, was identified as
novel constituent of the complex. Ubp15p
partially localizes to peroxisomes and is
capable to cleave off ubiquitin-moieties
from
the
PTS1-receptor
Pex5p.
Furthermore, Ubp15p-deficient cells are
characterized by a stress related PTS1import defect. The results merge to a
picture in which removal of ubiquitin of the
PTS1-receptor Pex5p is a specific event and
might represent a vital step in receptor
recycling.
Peroxisomes are organelles which carry out a
wide variety of metabolic processes in
eukaryotic organisms. As peroxisomes do not
contain genetic material, their protein content
is determined by the import of nuclear encoded
proteins. Peroxisomes can multiply by division
(1) or de novo by budding from the ER (2,3).
Without exception, peroxisomal matrix
proteins are synthesized on free ribosomes and
are subsequently imported in a posttranslational manner (4,5). Like the sorting of
proteins to other cellular compartments,
protein targeting to peroxisomes depends on
signal sequences. Peroxisomal matrix proteins
contain a C-terminal type I peroxisomal
targeting sequence (PTS1) or an N-terminal
PTS2 (4). These PTSs are recognized by
conserved receptors, Pex5p and Pex7p,
respectively. Based on the concept of cycling
receptors (6,7), the matrix protein import can
be divided into four steps: 1) receptor-cargo
recognition in the cytosol, 2) docking at the
peroxisomal membrane, 3) cargo-translocation
and release, and 4) receptor release from the
membrane and recycling.
With respect to the PTS1-receptor Pex5p,
recent reports demonstrated that its dislocation
from the peroxisomal membrane to the cytosol
at the end of the receptor cycle is ATPdependent and catalyzed by the AAA-peroxins
Pex1p and Pex6p (8,9). The main signal for the
export process is the attachment of a
monoubiquitin moiety or, alternatively, the
anchoring of a polyubiquitin chain (10,11).
While receptor monoubiquitination occurs on a
conserved cysteine, polyubiquitin chains are
Copyright 2011 by The American Society for Biochemistry and Molecular Biology, Inc.
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
Abteilung für Systembiochemie, Medizinische Fakultät der Ruhr-Universität
Bochum, D-44780 Bochum, Germany
2
Current address: Department of Biochemistry, Institute for Cancer Research,
The Norwegian Radium Hospital, Montebello, N-0310 Oslo, Norway
3
Current address: Universitätsmedizin Göttingen, Abteilung für Pädiatrie und
Neuropädiatrie, Georg-August-Universität, D-37099 Göttingen, Germany
4
Medizinisches Proteom-Center, Ruhr-Universität Bochum, Universitätsstrasse
150, D-44780 Bochum, Germany
5
Current address: Faculty of Biology and BIOSS Centre for Biological
Signalling Systems, University of Freiburg, 79104 Freiburg, Germany
Here we report on the correlation of the ATPdependent export of Pex5p and ubiquitin
cleavage. The AAA-complex of the
peroxisomal protein import machinery turned
out to possess export as well as
deubiquitinating activity. Ubp15p was
identified as novel constituent of the complex
which binds to the first AAA domain of Pex6p
(D1 domain). Ubp15p exhibits ubiquitin
hydrolase activity and is capable to cleave off
ubiquitin-moieties from the PTS1-receptor
Pex5p. The function of Ubp15p in peroxisome
biogenesis is supported by a stress related
PTS1-import defect of ubp15Δ cells. A
scenario
evolves
in
which
receptor
deubiquitination might be functionally linked
to its AAA-peroxin mediated export and
represents an important step in the receptor
cycle which makes Pex5p available for a new
round of matrix protein import.
EXPERIMENTAL PROCEDURES
Yeast strains and culture conditions - The
Saccharomyces cerevisiae strain UTL-7A
(MATa, ura3-52, trp1, leu2-3/112) was used as
wild-type strain for the generation of several
isogenic deletion strains by the `short flanking
homology` method as described previously
(28). The resulting deletion strains were pex5Δ
(29)
ubp14Δ, ubp15Δ, ubp14Δ/ubp15Δ, doa4Δdoa
4Δ/ubp15Δ (this study). cl3-ABYS-86 (30)
served as wild-type strain for isolation of His6Pex6p- and His6-GST-Ubp15p-complex. The
yeast reporter strain L40 (MATa trp1 leu2 his3
LYS2::lexA-HIS3, URA3::lexA-lacZ) (31)
was used for two-hybrid assays. Yeast media
have been described previously (32). Inhibit of
proteasomal degradation by the addition of
MG132 to liquid cultures was performed
according to (33)
Plasmids and cloning strategies - Sequences of
oligonucleotides available upon request. Twohybrid plasmids expressing Gal4p-fusions with
Pex1p, Pex6p or variants thereof were
described previously (34). For expression of
His6-Ubp15p in bakers yeast, two overlapping
PCRs were performed using genomic S.
cerevisiae DNA as template. PCRI (primers
RE1813/ RE1749) amplified the 5`- half of
UBP15 (NTP-UBP15) introducing an NcoI site
to the 5`end. PCRII (primers RE1746/RE1730)
amplified the 3`-half of UBP15 (CTP-UBP15)
introducing an XhoI site to the 3`-end. Both
PCR-products were subcloned into EcoRV
2
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
attached to two lysine residues (10,12). In
general, conjugation of ubiquitin to a target
protein or to itself is regulated by the
sequential activity of ubiquitin-activating (E1),
ubiquitin-conjugating (E2) and ubiquitinligating (E3) enzymes, and it typically results
in the addition of an ubiquitin moiety either to
the ε-amino group of a Lys residue or to the
extreme amino terminus of a polypeptide (13).
In a very few cases, including Pex5p, also
attachment to a Cys residue has been reported
(12,14). Whereas the addition of a single
ubiquitin to a target protein can alter protein
activity and localization, the formation of a
diverse array of ubiquitin chains is implicated
as targeting to the 26S proteasome (15).
In line with these findings, polyubiquitination
of Pex5p makes the receptor available for
proteasomal degradation as part of a quality
control system for the disposal of
dysfunctional Pex5p (16-18). Modification of
Pex5p by a single ubiquitin on a conserved Cys
residue provides the signal for the AAAperoxin mediated release of the receptor from
the peroxisomal membrane (10,11,19). This is
of special importance as this ATP-dependent
dislocation of the receptor is supposed to be
responsible for the overall energy-requirement
of the protein import cascade and thus might
be mechanistically linked to the cargo
translocation as proposed by the export-driven
import model (20).
The ubiquitination-cascade acting on Pex5p
has been elucidated with the identification of
Pex4p and the Ubc1p/Ubc4p/Ubc5p-family as
responsible E2s (10,12,17,18,21). The
peroxisomal RING-finger peroxins Pex2p,
Pex10p and Pex12p have been identified as
E3-enzymes responsible for the poly- and
monoubiquitination of Pex5p (22,23).
After export of the functional receptor to the
cytosol, the ubiquitin-moiety has to be
removed. This cleavage of ubiquitin from a
substrate protein is generally carried out by
ubiquitin hydrolases also known as
deubiquitinating enzymes (DUBs) (24).
S. cerevisiae contains genes coding for 18
DUBs (25,26). Recent in vitro data obtained
from rat indicated that the monoUb moiety of
Pex5p might be cleaved off in two different
ways. A minor portion of the thioester-bound
monoUb could be released in a non-enzymatic
manner by a nucleophilic attack of glutathione
while the major fraction of monoUb-Pex5p is
deubiquitinylated enzymatically by a still to be
identified ubiquitin hydrolase (27).
Two-hybrid assay - The yeast reporter strain
L40 was transformed with two-hybrid
plasmids pPC86 and pPC97 (40) or derivates
thereof and grown on synthetic medium
lacking tryptophane and leucine for 3 days at
30 °C. Obtained double transformants were
grown at 30 °C for 8 h in liquid synthetic
medium. Lysates from these cells were
prepared and subsequently subjected to ßgalactosidase assays as described by (41).
Purification of Pex6p from S. cerevisiae cells Recombinant His-tagged Pex6p or Ubp15p
were expressed in S. cerevisiae strain cl3ABYS-86 (30) transformed with pJK-5 or
pYES263-UBP15, respectively. Galactosegrown cells were harvested, resuspended in
lyses buffer (1.7 mM KH2PO4, 5.2 mM
Na2HPO4, 300 mM NaCl, 1 mM DTT, 22.5
µg/ml DNase I) with protease inhibitors
cocktail (8 µM antipain, 0.3 µM aprotinin, 1
µM bestatin, 10 µM chymostatin, 5 µM
leupeptin, 1.5 µM pepstatin (Roche
Diagnostics, Mannheim, Germany), 1 mM
benzamidine, 1 mM phenylmethylsulfonyl
fluoride, and 5 mM NaF). Cells were disrupted
by glass bead lyses. Lysate was cleared by
centrifugation and 0.22 µm filtration and
loaded on Ni-Sepharose (GE Healthcare,
Munich, Germany) columns equilibrated with
washing buffer (1.7 mM KH2PO4, 5.2 mM
Na2HPO4, 300 mM NaCl, 1 mM DTT, 40 mM
imidazol).The column was washed until no
more protein eluted. Pex6p was then eluted by
a continuous imidazol gradient up to 500 mM
imidazol in elution buffer (1.7 mM KH2PO4,
5.2 mM Na2HPO4, 300 mM NaCl, and 1 mM
DTT, 500 mM imidazol). Fractions containing
high protein concentration were combined and
concentrated by VivaSpin concentrators
(10,000 MWCO) (Sigma, Munich, Germany).
Isolation of peroxisomes-Preparation of yeast
spheroplasts, cell homogenization, preparation
of post-nuclear supernatants and determination
of the suborganellar localization of proteins
were performed according to (42). Density
gradient centrifugation was essentially
performed as described (43), in particular,
postnuclear supernatants (10 mg protein) were
prepared and loaded onto preformed 2.25-24%
(w/v)
Optiprep
(Iodixanol)
gradients.
Peroxisomes were separated from other
organelles in a vertical rotor (Sorvall TV 860,
1.5 h at 48,000xg, 4°C). Fractions were
collected from the bottom and subjected to
enzyme and refractive index measurements as
well as immunoblot analysis.
Gel filtration of cell lysates and purified
proteins - Analytical gel filtration was carried
3
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
digested
vector
pGEM®-T
(Promega,
Mannheim, Germany) resulting in vectors
pGEM®-T-NTP-UBP15 and pGEM®-T-CTPUBP15, respectively. Next, the introduced
fragments were cut out of the pGEM® vectors
(pGEM®-T-NTP-UBP15,
NcoI/BamHI
pGEM®-T-CTP-UBP15, BamHI/XhoI) and
cloned together into NcoI/XhoI sites of
pYES263 (35) leading to pYES263-UBP15.
For the expression of GST-fusions of Ubp15p
in E. coli, the vector pGEX-4T-2 (GE
Healthcare, Freiburg, Germany) was digested
with BamHI followed by a Klenow-refill
reaction and the subsequent cleavage with
XhoI. The Ubp15p coding region was obtained
by cleaving pYES263-UBP15 with NcoI,
Klenow-based refilling and subsequent XhoI
treatment. The UBP15 fragment was then
cloned into equally treated pGEX-4T-2
resulting in pGEX-4T-2-UBP15. In order to
introduce a C214A amino-acid residue
substitution into Ubp15p, the QuickChange
mutagenesis kit (Agilent Technologies,
Waldbronn, Germany) was used combined
with pGEX-4T2-UBP15 as template and
primers RE2274/RE2275 for the reaction.
GFP-Ubp15p expression plasmid pUG36UBP15 was constructed as follows. UBP15
was amplified by PCR using primers
RE3196/RE3198 and plasmid pYES263UBP15 as template. The SpeI/SalI digested
PCR product was cloned into SpeI/SalI site of
pUG36 (36).
To obtain N-terminal His6-TEV-tagged Pex6p
under the control of the GAL1-promotor for
expression in yeast, the coding region for the
N-terminal half of Pex6p was amplified by
PCR using primers KU1549/KU1550 and
plasmid pMB34 (37) as template. In a second
step, PEX6 was amplified by PCR (primers
KU1339/KU698, plasmid pMB34) and cloned
into NcoI/SpeI site of pYES2.1V5-His-TOPO
(Invitrogen, Darmstadt, Germany) leading to
vector pYQ6/1. Finally, the first PCR (Nterminal Pex6p half) was digested with
PvuII/SacI and the fragment was introduced
into PvuII/SacI digested vector pYQ6/1,
leading to pJK-5. Plasmids for expression of
PTS2-dsRed or high expression of Pex15p
were described elsewhere (38,39).
out on a SMART System (Amersham
Pharmacia Biotech, Uppsala, Sweden)
equipped with a Superose6 PC 3.2/30 column
in running buffer (50 mM Tris/HCl pH 7.4,
150 mM NaCl, 5 mM MgCl2, 1 mM βmercaptoethanol, 2 mM ATP). Samples were
cleared by centrifugation (15 min, 20,000g)
and aliquots of 50 µl purified protein were
separated at 40 µl/min. Fractions of 80 µl were
collected form 0.8 to 1.6 ml after injection.
The column was calibrated using ferritin (440
kDa), aldolase (158 kDa), and BSA (66 kDa)
as markers.
Deubiquitination assay - Deubiquitinating
activity of Ubp15p was analyzed according to
(44). In detail, 1 µg of Ubp15p/Ubp15pC214A
and 250 ng of appropriate polyUb(K63)-chains
(Biomol, Loerrach, Germany) were diluted in
reaction buffer (50 mM Tris-HCl, pH 7.4, and
300 mM NaCl) to a total volume of 30 µl.
Reactions were incubated for 2 h at 37 °C.
Before and after reaction, 15 µl of each sample
were charged with 3x SDS sample buffer and
boiled for 5 min for further analysis. Five µl of
each reaction were loaded onto a 15 % trisglycin gel and subsequently subjected to
immunoblot analysis.
Protein Identification by Mass Spectrometry Proteins in polyacrylamide gels were
visualized by Coomassie staining according to
(45). Destaining of proteins, in-gel tryptic
digestion and subsequent peptide extraction
was performed as described (46). Peptide
samples were separated by online reversedphase nano-HPLC using the Dionex LC
Miscellaneous - Immunopurification of ProtAtagged Pex1p/Pex6p-complexes from yeast
cells using IgG-Sepharose was described in
(47). Immunoprecipitation of denatured
proteins was carried out according to (22).
Membranes containing monoubiquitinylated
Pex5p were prepared according to (22) and
incubated with purified yeast AAA-complex
according to (8). Recombinant GST-fusionproteins were expressed in E. coli BL21 (DE3)
according to manufactures protocols (GE
Healthcare, Freiburg, Germany). Immunoreactive complexes were visualized using antirabbit or anti-mouse IgG-coupled horseradish
peroxidase in combination with the ECL™
system from Amersham Pharmacia Biotech
(Uppsala, Sweden). Alternatively, primary
antibody was detected with a IRDye 800CW
goat anti-rabbit IgG secondary antibody (LICOR Bioscience, Bad Homburg, Germany)
followed by a detection using the “Infrarot
Imaging System“ (LI-COR Bioscience, Bad
Homburg, Germany). Polyclonal rabbit
antibodies were raised against Pex5p (48),
Pex13p (29), and ubiquitin (Sigma, Munich,
Germany). Monoclonal mouse antibodies were
raised against GST (Sigma, Munich, Germany)
and ubiquitin (clone FK2, Biomol, Hamburg,
Germany). GFP- and dsRed-tagged proteins
were monitored by life cell imaging with a
Zeiss Axioplan 2 fluorescence microscope and
AxioVision 4.8 software (Zeiss, Jena,
Germany). Electron transmission microscopy,
spheroplasting of yeast cells, homogenization
and differential centrifugation at 25,000 x g of
homogenates were performed as described
previously (8,42,49).
RESULTS
The peroxisomal AAA-complex exhibits
deubiquitinating activity
Dislocation of the PTS1 receptor Pex5p from
the peroxisomal membrane to the cytosol
depends on the peroxisomal AAA-proteins
Pex1p and Pex6p (8,9) and ubiquitination of
Pex5p is a prerequisite for this process (10).
4
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
In vivo ubiquitination assays - Oleate-induced
yeast cells were harvested, washed twice and
resuspended in lysis-buffer (0.2 M HEPES, 1
M potassium acetate and 50 mM magnesium
acetate, pH 7.5) and protease inhibitors
cocktail (see above), 1 mM benzamidine, 1
mM phenylmethylsulfonyl fluoride, and 5 mM
NaF). To accumulate monoubiquitinated
Pex5p from wild-type cells, 20 mM NEM
(Sigma, Munich, Germany) was added. Cells
were disrupted by glass bead lysis and
centrifuged at 1,500xg (Eppendorf rotor A-481) for 10 min. Supernatants were normalized
for protein and volume, and membranes were
sedimented by centrifugation at 100,000xg,
(30 min, Sorvall AH650 rotor) followed by
trichloroacetic acid precipitation and sample
preparation (18).
Packings HPLC systems (Dionex LC Packings,
Idstein, Germany). Electrospray ionization
tandem mass spectrometry (ESI-MS/MS) on a
Bruker Daltonics HCTplus ion trap instrument
(Bremen, Germany) and subsequent protein
identification by bioinformatics using the yeast
NCBI database was performed as described
(46).
Ubp15p is associated with the AAA-complex
The data described above indicate that the
isolated AAA-complex contains export- and
deubiquitinating activity also in the absence of
the cytosol. Thus, the suspected additional
factor is supposed to be part of the yeast AAAcomplex. To identify the unknown factor, we
isolated the cytosolic AAA-complex with
Pex6p as overexpressed bait protein. For this
purpose, a plasmid encoding N-terminal His6tagged Pex6p under the inducible GAL1promotor was transformed into the protease
deficient yeast strain cl3-ABYS-86 (30).
Transformants were precultured on glucose
rich media and expression of the tagged Pex6p
was induced by shifting to galactose media.
His-Pex6p
was
isolated
by
affinity
chromatography on NiNTA and analyzed by
SDS-PAGE followed by silver stain. Two
dominant protein bands were visible (Fig. 2A)
which have been excised and analysed by mass
spectrometry. The fast migrating protein was
identified as the bait protein Pex6p. The band
with an approximate size of 140kDa consisted
of three proteins, Clu1p, Ubp15p and Ecm21p.
Clu1p is a subunit of translation initiation
factor eIF3 that functions in AUG scanning in
translation which is also required to maintain
the morphology of mitochondria (51,52).
Ubp15p is an ubiquitin-specific processing
protease (53). Ecm21p is an arrestin-related
protein which acts as an adaptor in ubiquitin
ligation (54). As a second approach to identify
AAA-peroxin
associated
proteins,
we
genomically tagged Pex1p with Protein A,
isolated the complex as previously described
(8), separated proteins of the isolated complex
by SDS-PAGE and subjected selected protein
bands to mass spectrometric analysis. The
band marked in Fig. 2B contained Ubp15p,
which indicated its association with the AAAcomplex and moved the protein into the focus
of our interest. To validate the Pex6p-Ubp15pinteraction, the complex isolation was
performed vice versa using Ubp15p as bait.
His6-GST-tagged Ubp15p was expressed in
wild-type cl3-ABYS-86 strain, isolated by
immuno-purification and the constituents of
the
complex
were
analyzed
by
immunoblotting. Pex6p was identified as a
component of the Ubp15p-complex (Fig. 2C)
and a minor portion of the PTS1-receptor
Pex5p also co-eluted with the Ubp15pcomplex.
The
soluble
fructose
1,6bisphosphatase (Fbp1p, (55)) was not retained
by the chromatography, an indication for the
specificity of the isolation procedure (Fig. 2C).
A portion of the ubiquitin hydrolase Ubp15p
localizes to peroxisomes
Our results demonstrate that yeast Ubp15p
possesses the ability to interact with Pex6p. As
Pex6p is localized in the cytosol and at
peroxisomes, the subcellular localization of
Ubp15p was analyzed under peroxisomeinducing conditions. To this end, a cell free
homogenate of oleic acid-induced wild-type
cells expressing a genomically tagged UBP15
gene coding for a Ubp15p-protein A fusion
protein (Ubp15p-TEV-ProtA) was prepared
and organelles were separated by density
gradient centrifugation (Fig. 3A). The presence
of organelle marker proteins in fractions was
assayed either by determination of enzyme
activities or by immunoblotting. As indicated
by the segregation behaviour of the
peroxisomal membrane marker Pex13p and
activity measurements of the peroxisomal
5
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
The main signal for the export process is the
attachment of a monoubiquitin moiety (10,11).
In order to gain more insight into the principal
export mechanism of monoubiquitinated
Pex5p, membranes were prepared from wildtype cells in the presence of NEM (N-ethylmaleimid), which is a suitable inhibitor of deubiquitinating enzymes (DUBs) (50) and
results
in
the
accumulation
of
monoubiquitinated Pex5p at the peroxisomal
membrane (Kragt et al., 2005; Platta et al.,
2007). As NEM proved to be a competent
inhibitor of the export machinery, membranes
were washed extensively and NEM was
avoided upon purification of the AAAcomplexes. The membranes containing monoubiquitinated Pex5p were incubated with
buffer alone or buffer containing purified
cytosolic AAA-complex of S. cerevisiae in the
presence of an ATP-regenerating system
(ARS, (8)) for 30 min at 37 °C. Interestingly,
the presence of the AAA-complex did result in
the disappearance of the monoUb-Pex5p
(Fig. 1, lanes 1 and 2) indicating that the
peroxisomal AAA-complex does not only
harbor the known dislocase activity of
Pex1p/Pex6p but is also capable to facilitate
receptor deubiquitination in addition. This
assumption is supported by the result that
incubation of the AAA-complex with DUBinhibitors NEM (Fig. 1, lane 3) or ubiquitinaldehyde (Fig. 1, lane 4) prior the assay blocks
Pex5p deubiquitination.
Ubp15p interacts with the first AAA-domain of
Pex6p
In order to analyze the Ubp15p-interaction
with the peroxisomal AAA-complex in more
detail, we applied the yeast two-hybrid system.
Plasmids expressing full-length Pex1p, Pex6p
or ubiquitin fused to the Gal4p activation
domain or the Gal4p-DNA-binding domain
were transformed in the S. cerevisiae strain
L40, and reporter gene expression was
analyzed by assaying β-galactosidase activity.
In line with previous findings (57), coexpression of Ubp15p with ubiquitin leads to
significant reporter-gene activity as judged by
determined ß-galactosidase activity, which
indicated the known Ubp15p-ubiquitin
interaction (Fig. 4). The enzyme activities
differed in dependence of whether Ubp15p was
fused to the DNA-binding or trans-activation
domain of Gal4p, however, in case of an
interaction the enzyme activity was
significantly higher than the controls of the
empty vector versus bait plasmids. Comparison
of the different assays revealed that Pex6p
interacts with Ubp15p while the monitored βgalactosidase activity was only slightly above
the control level when Pex1p was tested for
interaction with Ubp15p. To determine the
Pex6p-region that contributes to the Ubp15p
interaction, we analyzed the interaction of
Ubp15p with the N-terminal region (N, aa1–
428), the first AAA-cassette (D1, aa421–716)
and the second AAA-cassette (D2, aa704–
1030) of Pex6p and combinations thereof. As
shown in Fig. 3, neither the N-domain nor the
second AAA-domain is capable to interact
with Ubp15p. In contrast, the first AAAdomain of Pex6p alone or fused to the Ndomain led to ß-galactosidase activity in the
same range as observe with full-length Pex6p.
Thus, the first AAA-domain of Pex6p is
involved in the interaction with Pex1p (34,58)
as well as with Ubp15p.
Ubp15p facilitates deubiquitination of Pex5p
in vitro
UBPs represent a subclass of the
deubiquitinating enzymes (DUB) comprising
18 putative members in S. cerevisiae, including
Ubp15p (53). The UBP-family is highly
divergent, but all members contain several
short consensus sequences, the Cys- and the
His- boxes that are likely to form a part of the
active site (59). Within Ubp15p, the Cys-box
covers the amino acids 206 to 223, whereas the
His-box is localized between amino acids 449
and 533 (60). Sequence alignment of Ubp15p
with other UBPs indicated that Cys214 of
Ubp15p most likely represents an amino acid
residue
which
is
crucial
for
the
deubiquitinating activity (60). Accordingly, a
Cys214 to Ala substitution was introduced into
the full-length protein by site directed
mutagenesis and recombinant wild-type or
mutant Ubp15p (Ubp15pC214A) fused to GST
were expressed in E. coli and isolated by
affinity chromatography. The tag was removed
by thrombin cleavage. To demonstrate that
recombinant Ubp15p exhibits deubiquitinating
activity and is thus biologically active, in vitro
ubiquitin-cleavage assays were performed. To
6
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
catalase, peroxisomes migrated to the bottom
fractions and showed a clear peak in fractions
3, clearly separated from the mitochondrial
marker (porin). In line with the reported
cytosolic localization (56), the majority of
Ubp15p remained in the top gradient fractions.
However, a significant portion of Ubp15p is
detected at a higher density, co-localizing with
peroxisomal marker proteins (Fig. 3A, lane 3).
To support this finding, we monitored
localization of GFP-tagged Ubp15p by
fluorescence microscopy. GFP-Ubp15p was
co-expressed with the synthetic peroxisomal
marker protein PTS2-dsRed in wild-type cells.
PTS2-dsRed exhibits punctate fluorescence
pattern, typically for a peroxisomal localization
(Fig. 3B, (38)). In line with our results
obtained by cell fractionation (Fig. 3A), GFPUbp15p was predominantly localized to the
cytosol which leads to overall cellular
fluorescence (Fig. 3B). However, a portion of
GFP-Ubp15p co-stained with PTS2-dsRed
positive
structures
demonstrating
its
peroxisomal localization. Next we tried to
increase the amount of peroxisomal Ubp15p by
overexpression of Pex15p. The overexpression
of this peroxisomal membrane protein leads to
an increased recruitment of Pex6p to
peroxisomes (37). We assumed that the
consequence thereof should be an increased
amount of Ubp15p bound to the peroxisomal
membrane, as it is a binding partner of the
Pex6p-complex. Indeed, upon Pex15poverexpression only a small portion of GFPUbp15p was found cytosolic, whereas the
major fraction was found co-localized with
peroxisomal marker PTS2-dsRed (Fig. 3B).
Taken together, the localization studies
indicate that a portion of Ubp15p is associated
with peroxisomes.
together,
the
data
demonstrate
that
recombinant Ubp15p exhibits ubiquitin
hydrolase
activity
and
facilitates
deubiquitination of mono- and poyUb-Pex5p.
Clustered peroxisomes in ubp15∆ cells
Ubp15p is a cytosolic protein, which is
associated with the yeast AAA-complex.
Pex1p and Pex6p are both required for
peroxisomal matrix protein import, leading to
the question whether also Ubp15p contributes
to peroxisomal function in vivo. To address
this question, growth test were performed on
plates containing oleic acid as sole carbon
source, which will support cell growth only if
peroxisomal ß-oxidation is functional, which
requires an intact organelle biogenesis. In
contrast to wild-type, PEX5-deficient cells are
unable to grow on this medium, which is in
accordance with the literature (62) and typical
for peroxisomal mutant strains of S. cerevisiae
(42). Cells deficient in Ubp15p did not exhibit
a growth defect on oleic acid medium
(Fig. 6A). As a partial defect in peroxisome
biogenesis does not inevitably lead to a
complete destruction of peroxisome function,
we analyzed the matrix protein import in wildtype and mutants in more detail. To this end,
the subcellular localization of GFP fused to the
peroxisomal targeting signal 1 (GFP-PTS1) as
marker for the Pex5p dependent import, and
PTS2-dsRed, an artificial substrate for the
Pex7p dependent matrix protein import were
monitored by live cell imaging. Fluorescence
microscopy inspection of oleic acid-induced
wild-type cells revealed a punctuate staining
pattern for both marker proteins, typical for a
peroxisomal labeling (Fig. 6B). Mutant pex5Δ
cells that are affected in peroxisomal protein
import of PTS1-proteins (62) exhibited a
cytosolic fluorescence pattern for GFP-PTS1
as typical for these cells. In contrast, the PTS2pathway is not affected in pex5Δ cells which
results in a punctuate staining pattern for
PTS2-dsRed. The fluorescence microscopy
pattern observed for the ubp15∆ strain was
similar to the one visible in the wild-type strain
(Fig. 6B), suggesting that ubp15Δ cells are still
able to import both, PTS1- and PTS2containing peroxisomal matrix proteins.
Interestingly, in contrast to wild-type
peroxisomes, which are well separated,
peroxisomes of ubp15Δ cells appeared to form
clusters (Fig. 6B). This observation was
corroborated
by
electron
microscopic
7
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
this end, the isolated proteins were incubated
with Ub-chains and the reaction was stopped
after zero (control) or 120 min by adding SDSsample buffer and subsequent boiling.
Cleavage of the Ub-chain was monitored by
immunoblot analysis with an antiserum against
ubiquitin. Incubation of the Ub-chain with
wild-type Ubp15p resulted in a decrease of
higher molecular Ub-species and accumulation
of monoUb as cleavage product (Fig. 5A, lane
2). When the assay was performed with
mutated Ubp15p, no difference between the
control sample and the sample incubated for
120 min (Fig. 5A, lanes 3 and 4) was
observed. Thus, our data are clear in that
Ubp15p acts as ubiquitin hydrolase on Ubchains and that an enzyme harboring the
Cys214Ala replacement is enzymatically
inactive. This finding is not due to a dramatic
influence of the mutation on the structure of
the protein as both wild-type as well as
mutated Ubp15p exhibit same behavior when
analyzed by size exclusion chromatography
(data not shown).
Pex5p can be monoubiquitinated (21) or
polyubiquitinated (17,18). In Fig. 1, we
showed that the AAA-peroxin complex
harbors deubiquitinating activity. Now, we
addressed the question whether mono- or
polyubiquitinated Pex5p can function as
molecular target for deubiquitination by
Ubp15p. To this end, we prepared membranes
from wild-type cells in the presence of NEM
which results in the accumulation of monoUbPex5p. These membranes were incubated with
recombinant Ubp15p, followed by co-immunoisolation of Pex5p. MonoUb-Pex5p was visible
when the membranes were incubated with
buffer alone but disappeared upon incubation
with Ubp15p (Fig. 5B).
Next, we assayed whether Ubp15p also acts on
polyubiquitinated Pex5p. We isolated whole
cell membranes from a pex1Δpex6Δ strain.
These membranes show accumulation of
polyUb-Pex5p species (17,18), Fig. 5C,
lane 1). Incubation of these membranes with
recombinant Ubp15p resulted in disappearance
of modified Pex5p, indicating that Ubp15p can
also cleave off ubiquitin from polyUb-Pex5p
(Fig. 5C, lane 4). In line with this finding, no
cleavage of Pex5p was observed when Ubp15p
activity was blocked by NEM or Ub-aldehyde
(Fig. 5C, lanes 2 and 3). Ub-aldehyde inhibits
ubiquitin hydrolases by the formation of an
extremely tight complex, in which the inhibitor
is bound to the active site of DUBs (61). Taken
of ubiquitin chains (59). Doa4p is required for
turnover of the PTS2-co-receptor Pex18p,
which also is ubiquitinated (63). Interestingly,
Doa4p interacts with Ubp15p as well as
Ubp14p (64,65). Thus, Ubp15p might be part
of a ternary complex of ubiquitin hydrolases
with overlapping functions. For this reason, we
analyzed single mutants of UBP15, UBP14
and DOA4 as well as combination thereof for
their capacity to import GFP-PTS1. As judged
by fluorescence microscopy, neither the singlenor the double deletion strains exhibited an
import deficiency for GFP-PTS1 (Fig. 8A, left
panel). In all strains tested, the GFP-SKL
exhibited a clear punctuate staining,
demonstrating its localization in the
peroxisomal matrix.
It is well known that the function of redundant
protein sometimes becomes essential when
cells are under stress (66). To test for this
possibility, we examined oleic acid induced
wild-type and mutant cells for matrix protein
import upon oxidative-stress conditions (0.2
mM H2O2 (67)). Under this condition, neither
wild-type nor ubp14Δ cells showed an import
defect for GFP-SKL as indicated by the clear
punctuate staining with no background
labeling (Fig. 8A, right panel). In contrast,
doa4Δ and ubp15Δ cells showed a punctuate
staining of peroxisomal matrix marker GFPSKL but also a background labeling indicative
for a partial mislocalization of the marker
protein to the cytosol. This finding indicated
that these mutants exhibit a partial peroxisomal
protein import defect upon oxidative-stress. In
this respect, it is worth to note that expression
of Ubp15p and Dao4p but not of Ubp14p is
induced by oleic acid (68). Moreover,
induction of Doa4p and Ubp15p is also
induced upon oxidative-stress by H2O2 (69).
Our data indicate that deficiency in both,
Ubp15p or Doa4p, affects proper peroxisomal
protein
import
under
oxidative-stress
condition.
To support this observation of an impaired
peroxisomal function under oxidative-stress,
we monitored the growth behaviour of UBP15affected cells in comparison with wild-type
and doa4Δ-cells. Cells were grown on either
glucose or oleic acid as sole carbon source in
the absence or presence of 0.2 mM H2O2. As
judged by optical density measurements, wildtype as well as ubp15Δ cells exhibit similar
growth rates when glucose served as energy
source (Fig. 8B, lower panel). When H2O2 was
added to the media, growth rates of these
8
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
inspection of wild-type and mutant cells
(Fig. 6C).
ubp15Δ-cells exhibit lower steady state
concentration of Pex5p but higher rate of
ubiquitinated Pex5p.
To investigate the consequence of a deletion of
UBP15 on turnover of Pex5p, we estimated
Pex5p steady state concentration in wild-type
and ubp15Δ-cells. Whole cell lysates of oleicacid induced wild-type and ubp15Δ-cells were
subjected to immunoblot analysis with
mitochondrial porin as loading control.
Although porin concentration was same in both
strains, Pex5p level differed (Figure 7A, left
panel). For quantification of the observed
difference, the signal intensity was analyzed by
densitometry. It turned out that the Pex5p
amount in ubp15Δ cells is reduced to
approximately half of the wild-type level
(Figure 7A, right panel). Next we analyzed
whether the lower amount of Pex5p in
ubp15Δ-cells is accompanied by a higher
ubiquitination rate. To this end, we monitored
receptor ubiquitination in cells treated with the
MG132, which inhibits proteasomal protein
degradation and leads to accumulation of
ubiquitinated Pex5p (22). Accordingly, ,
ubiquitinated Pex5p was visible in both
MG132-treated wild-type and ubp15Δ-cells
(Figure 7B, left panel). However, while the
level of unmodified Pex5p in ubp15Δ cells was
half of wild-type level as described before
(Figure 7B), ubp15Δ exhibits three times more
polyubiquitinated Pex5p than the wild-type
strain. Taken together, our results indicate a
higher polyubiquitination rate of Pex5p in
stains lacking Ubp15p which most likely
causes a reduced steady state concentration of
the PTS1-receptor.
ubp15Δ-cells exhibit oxidative-stress related
import deficiencies and growth on oleic acid
None of the genes encoding ubiquitin
hydrolases are essential for viability,
suggesting that many of these enzymes have
overlapping functions (53). As ubp15Δ
exhibits normal growth and matrix protein
import under oleic acid conditions, we
suspected such a redundancy and tested
double-deletion strains for growth on oleic acid
medium and peroxisomal protein import. Cells
lacking Doa4p are characterized by decreased
free ubiquitin levels and these mutants display
a strongly reduced turnover of several proteins
that are targeted to degradation via
ubiquitination. In line with this observation,
Doa4p was shown the be involved in cleavage
DISCUSSION
The AAA-complex of Pex1p and Pex6p is
responsible for the release of the ubiquitinated
PTS1-receptor Pex5p from the peroxisomal
membrane, which has been regarded as the
final step of the peroxisomal protein import
cascade. In this work, we show that the AAAcomplex is also responsible for receptor
deubiquitination, which is supposed to be an
important step in receptor recycling. We have
identified
the
corresponding
ubiquitin
hydrolase Ubp15p as a novel factor that
accompanies
the
AAA-complex
in
peroxisomal protein import.
PolyUb-Pex5p (17,18) as well as monoUbPex5p (21,27) are solely found at the
peroxisomal membrane fraction in wild-type
yeast and rat liver cells, indicating that Pex5p
ubiquitination exclusively takes place at the
peroxisomal membrane. Interestingly, exported
Pex5p appears to be unmodified, indicating
that the Ub-moiety is removed during or
directly after receptor export (10,11,21).
However,
published
data
on
the
deubiquitination of Pex5p so far have focused
on in vitro assays with mammalian Pex5p.
Soluble monoUb-Pex5p is formed when the in
vitro export reaction is performed in presence
of DUB inhibitors (11,27). Accordingly, it was
concluded that deubiquitination of Pex5p
occurs predominantly in the cytosol after
release from the membrane. It also was
suggested that a small fraction of the
dislocated Ub-Pex5p in vitro can already be
deubiquitinated by reducing reagents like
glutathione, while most of the Ub-Pex5p is
deubiquitinated via an enzymatic pathway
(27). However, cleavage of the Ub-moiety
from mammalian Pex5p was thought to be
catalyzed by an unspecific reaction that could
be carried out by any DUB in the cytosol or
may even function via a non-enzymatic
reaction.
Our
data
indicate
that
deubiquitination of yeast Pex5p represents a
specific and important event for the optimal
functionality of the export machinery. With
Ubp15p, we have identified a deubiquitinating
enzyme that is dedicated for this
deubiquitination event in baker`s yeast. The
deubiquitinating activity found to be associated
with the endogenous AAA-complex was the
first indication for the presence of such an
enzyme. Mass spectrometry analysis of the
AAA-complex derived from endogenous
proteins as well as overexpressed Pex6p
revealed a stable association of Ubp15p. The
interaction with Pex6p was confirmed by yeast
two-hybrid analysis and the interaction site
could be mapped to the D1 domain of Pex6p.
While the evolutionarily related AAA-protein
Cdc48p(p97/VCP) utilizes several co-factors
(71), Ubp15p is only the second known cofactor that accompanies the function of Pex6p,
with its membrane-anchor Pex15p (Pex26p in
mammals) being the first one (37). Pex6p acts
in concert with Pex1p as dislocase complex for
the ubiquitinated Pex5p in order to facilitate
the export of the PTS1-receptor back to the
cytosol (8,9). This leads to the intriguing
question, how the activity of the
deubiquitinating
enzyme
Ubp15p
is
coordinated with the Ub-dependent dislocation
of Pex5p from the membrane and release into
the cytosol. The finding that the deletion of
UBP15 does not result in a complete
peroxisomal biogenesis defect, can either be
explained by the model, that deubiquitination
has only modulating activity or it may indicate
the existence of additional factors which may
accompany the AAA-complex in its function.
This situation could well be explained by
redundant DUBs acting on Ub-Pex5p. Possible
candidates are the known Ubp15p-binding
partners Ubp14p and Doa4p (Ubp4p) (64,65).
However, the characterization of the single
deletion strains suggested that these two DUBs
do not have a peroxisome-specific function
9
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
strains were nearly the same as without
oxidative-stress. In contrast, doa4Δ cells
showed the lowest growth rate of monitored
strains already without H2O2, but growth was
significantly delayed in the presence of H2O2.
When cells were cultured on oleic acid
medium, growth of doa4Δ cells was drastically
reduced (Fig. 8B, lower panel), which is in
line with known pleiotropic effects of the
deletion of this protein as Doa4p is involved in
many Ub-dependent processes in the cell (70).
The growth rate of wild-type and ubp15Δ cells
was similar on glucose medium also under
oxidative-stress conditions. Both strains also
grew equally well on oleic acid medium
without H2O2. However, oxidative-stress
affected growth on oleic acid medium of both
wild-type and ubp15Δ cells but while the wildtype still did grow reasonable well, growth of
the ubp15Δ cells was severely affected
(Fig. 8B, lower panel). Taken together,
analysis of the mutant phenotypes disclosed a
peroxisome- and stress-related defect of
ubp15Δ cells.
Although Ubp15p is not essential for
peroxisomal
biogenesis
under
normal
conditions, its regulative function gains
significantly more weight when the cells are
stressed with H2O2 and require an efficient
import of matrix proteins into peroxisomes.
Thus, the findings that 1) Ubp15p is stably
associated with the export machinery by
interacting with Pex6p, 2) the fact that a small
portion of the protein is associated with
peroxisomes, and 3) the partial protein import
defect for PTS1 proteins observed in ubp15Δ
cells upon oxidative stress suggest that the
deubiquitination, at least in bakers yeast, is not
an unspecific event that takes place at any
location in the cytosol, as suggested by the
mammalian study (27), but supports the notion
that the detachment of the Ub-moiety is a
regulated event.
Ubiquitination of the receptor is a precondition
for its export (10,11). In this respect, it is likely
that the Pex1p/Pex6p-complex recognizes the
Ub-moiety. This, however, still needs to be
shown. The in vitro data demonstrate that the
exported import receptor is deubiquitinated.
This reflects the in vivo situation which is clear
in that the cytosolic receptor is not
ubiquitinated. Thus, the accumulating evidence
indicates that the ubiquitin moiety is cleaved
off from the import receptor during or shortly
after export. There are several possible
advantages to favor a peroxisome-associated
deubiquitination of Ub-Pex5p. This could
protect Pex5p from unspecific ubiquitination
by detaching Ub-moieties from lysine residues
or preventing the formation of a poly-ubiquitin
chain at the crucial cysteine residue dedicated
to mono-ubiquitination. This function would
ensure an optimal protection and presentation
of monoUb-Pex5p to the export machinery.
Another possible explanation might be that the
deubiquitination step may trigger the efficient
release of Pex5p from the export-machinery by
cleavage of the complex-bound Ub-moiety.
Furthermore, this mechanism could prevent the
monoUb-Pex5p to be recognized by the
proteasome system to ensure an efficient
recycling of the receptor for new matrix
protein import cycles.
The finding that both ubiquitinating and
deubiquitinating activities are required for the
transport of proteins from a membrane to the
cytosol finds an examples in the ERAD
pathway.
The
AAA-type
ATPase
p97(Cdc48/VCP) is evolutionary related to the
peroxisomal AAA-proteins Pex1p and Pex6p
(76). Most interestingly, among the growing
number of known co-factors and adaptor
proteins that p97 utilizes to carry out its
different
functions
are
also
several
deubiquitinating
enzymes
(71).
The
mammalian deubiquitinating enzymes YOD1
and Ataxin-3 are p97-associated proteins and
function in the ERAD pathway (77-79). Most
of the published literature defines both DUBs
as a positive regulator of the p97-driven
dislocation of the ERAD-substrates, most
likely by editing the poly-Ub chains on the
10
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
similar to Ubp15p. The single deletion strain of
Ubp14p had no significant effect on
peroxisome morphology or cargo import, both
under oleate as well as under H2O2 stress
conditions. Previous studies have suggested a
role for Ubp14p in the disassembly of
unanchored polyubiquitin chains (64). The
deletion of Doa4p had an effect on the
efficiency of peroxisomal cargo import.
However, it has to be taken into account that
the deletion of Doa4p is known to result in
pleiotropic effects on many Ub-dependent
processes in the cell, as Doa4p influences the
homeostasis of free ubiquitin (70). Possibly
related to this function, DOA4 is a stress
regulated gene, giving an alternative
explanation for the oleate induction reported
by (68). Thus, although we cannot fully
exclude that Doa4p exhibits a peroxisomerelated overlapping function with Ubp15p, the
partial import defect observed for the doa4Δ
strain might well be explained by the
pleiotropic phenotype of this mutant.
The observation that ubp15Δ cells contain
more clustered peroxisomes than wild-type
cells is puzzling. Earlier work correlated a
reduced level of imported matrix proteins such
as catalase and the occurrence of clustered
peroxisomes (72). Slowing of Pex5p cycling is
most certainly associated with reduced import
rates. Interestingly, induction of oxidative
stress by treating cells with hydrogen peroxide
causes Pex5p to amass on the organelle
membrane and significantly reduces PTS1
protein import (73-75). As our data are clear in
that Ubp15p can deubiquitinate Pex5p and as
the ubiquitination status of the PTS1-receptor
directly influences its cycling (10,11), it is
conceivable that the deletion of Ubp15p
influences the import process of PTS1-proteins
like catalase and thus possibly also
morphology and clustering of peroxisomes.
substrates themselves in order to ensure the
best fit to downstream Ub-receptor proteins.
Ubp15p acts in concert with the AAA-peroxins
in the matrix protein import cycle of the PTS1receptor. Pex5p deubiquitination occurs as a
highly specific event in yeast and removal of
ubiquitin of the PTS1-receptor Pex5p turns out
to be a vital step in the receptor cycle in its
own right. Thus, removal of the ubiquitin
seems to complete the receptor cycle of Pex5p
in order to make the receptor available for
another round of matrix protein import.
ACKNOWLEDGMENTS
We are grateful to Ulrike Freimann for
technical assistance and to Wolfgang Schliebs
for the reading of the manuscript. This work
was
supported
by
the
Deutsche
Forschungsgemeinschaft (SFB642). H.W.P
was supported by an EMBO Long term
Fellowship.
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Motley, A. M., and Hettema, E. H. (2007) J. Cell Biol. 178(3), 399-410
Hoepfner, D., Schildknegt, D., Braakman, I., Philippsen, P., and Tabak, H. F. (2005)
Cell 122(1), 89-95
Lam, S. K., Yoda, N., and Schekman, R. (2010) Proceedings of the National Academy
of Sciences of the United States of America Doi: 10.1073/pnas.1013397107
Schrader, M., and Fahimi, H. D. (2008) Histochem. Cell. Biol. 129(4), 421-440
Ma, C., and Subramani, S. (2009) IUBMB life 61(7), 713-722
Dodt, G., and Gould, S. J. (1996) J. Cell Biol. 135, 1763-1774
Marzioch, M., Erdmann, R., Veenhuis, M., and Kunau, W.-H. (1994) EMBO J.
13(30), 4908-4918
Platta, H. W., Grunau, S., Rosenkranz, K., Girzalsky, W., and Erdmann, R. (2005)
Nat. Cell Biol. 7(8), 817-822
Miyata, N., and Fujiki, Y. (2005) Mol. Cell. Biol. 25(24), 10822-10832
Platta, H. W., El Magraoui, F., Schlee, D., Grunau, S., Girzalsky, W., and Erdmann,
R. (2007) J. Cell Biol. 177(2), 197-204.
Carvalho, A. F., Pinto, M. P., Grou, C. P., Alencastre, I. S., Fransen, M., Sá-Miranda,
C., and Azevedo, J. E. (2007) J. Biol. Chem. 282(43), 31267-31272
Williams, C., van den Berg, M., Sprenger, R. R., and Distel, B. (2007) J. Biol. Chem.
282(31), 22534-22543
Hicke, L., Schubert, H. L., and Hill, C. P. (2005) Nat. Rev. Mol. Cell Biol. 6(8), 610621
Cadwell, K., and Coscoy, L. (2005) Science 309(5731), 127-130
Dikic, I., Wakatsuki, S., and Walters, K. J. (2009) Nat. Rev. Mol. Cell Biol. 10(10),
659-671
Erdmann, R., and Schliebs, W. (2005) Nat. Rev. Mol. Cell Biol. 6(9), 738-742
Kiel, J. A., Emmrich, K., Meyer, H. E., and Kunau, W. H. (2005) J. Biol. Chem.
280(3), 1921-1930
Platta, H. W., Girzalsky, W., and Erdmann, R. (2004) Biochem. J. 384, 37-45
Grou, C. P., Carvalho, A. F., Pinto, M. P., Wiese, S., Piechura, H., Meyer, H. E.,
Warscheid, B., Sa-Miranda, C., and Azevedo, J. E. (2008) J. Biol. Chem. 283(21),
14190-14197
Schliebs, W., Girzalsky, W., and Erdmann, R. (2010) Nat. Rev. Mol. Cell Biol. 11(12),
885-890
Kragt, A., Voorn-Brouwer, T. M., Van den Berg, M., and Distel, B. (2005) J. Biol.
Chem. 280(8), 7867-7874
Platta, H. W., El Magraoui, F., Bäumer, B. E., Schlee, D., Girzalsky, W., and
Erdmann, R. (2009) Mol. Cell. Biol. 29(20), 5505-5516
11
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
References
23.
24.
25.
26.
27.
28.
29.
30.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
12
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
31.
32.
Williams, C., van den Berg, M., Geers, E., and Distel, B. (2008) Biochem. Biophys.
Res. Commun. 374(4), 620-624
Komander, D., Clague, M. J., and Urbe, S. (2009) Nat. Rev. Mol. Cell. Biol. 10(8),
550-563
Wilkinson, K. D. (1997) Faseb J 11(14), 1245-1256
Rumpf, S., and Jentsch, S. (2006) Mol. Cell. 21(2), 261-269
Grou, C. P., Carvalho, A. F., Pinto, M. P., Huybrechts, S. J., Sa-Miranda, C., Fransen,
M., and Azevedo, J. E. (2009) J. Biol. Chem. 284(16), 10504-10513
Güldener, U., Heck, S., Fiedler, T., Beinhauer, J., and Hegemann, J. H. (1996) Nucleic
Acids Res. 24(13), 2519-2524
Girzalsky, W., Rehling , P., Stein, K., Kipper, J., Blank, L., Kunau, W.-H., and
Erdmann, R. (1999) J. Cell Biol. 144(6), 1151-1162
Heinemeyer, W., Kleinschmidt, J. A., Saidowsky, J., Escher, C., and Wolf, D. H.
(1991) The EMBO journal 10(3), 555-562
Vojtek, A. B., Hollenberg, S. M., and Cooper, J. A. (1993) Cell 74(1), 205-214
Erdmann, R., Wiebel, F. F., Flessau, A., Rytka, J., Beyer, A., Fröhlich, K. U., and
Kunau, W.-H. (1991) Cell 64(3), 499-510
Liu, C., Apodaca, J., Davis, L. E., and Rao, H. (2007) BioTechniques 42(2), 158, 160,
162
Birschmann, I., Rosenkranz, K., Erdmann, R., and Kunau, W.-H. (2005) FEBS J.
272(1), 47-58
Melcher, K. (2000) Analytical biochemistry 277(1), 109-120
Niedenthal, R. K., Riles, L., Johnston, M., and Hegemann, J. H. (1996) Yeast 12(8),
773-786
Birschmann, I., Stroobants, A. K., Van Den Berg, M., Schäfer, A., Rosenkranz, K.,
Kunau, W. H., and Tabak, H. F. (2003) Mol. Biol. Cell. 14(6), 2226-2236
Stein, K., Schell-Steven, A., Erdmann, R., and Rottensteiner, H. (2002) Mol. Cell.
Biol. 22(17), 6059-6069
Elgersma, Y., Kwast, L., van den Berg, M., Snyder, W. B., Distel, B., Subramani, S.,
and Tabak, H. F. (1997) EMBO J. 16(24), 7326-7341
Chevray, P. M., and Nathans, D. (1992) Proc. Natl. Acad. Sci. USA 89(13), 5789-5793
Guarente, L. (1983) Methods Enzymol. 101, 181-189
Erdmann, R., Veenhuis, M., Mertens, D., and Kunau, W.-H. (1989) Proc. Natl. Acad.
Sci. USA 86(14), 5419-5423
Grunau, S., Lay, D., Mindthoff, S., Platta, H. W., Girzalsky, W., Just, W., and
Erdmann, R. (2011) Biochem. J. 434(1), 161-170
Messick, T. E., Russell, N. S., Iwata, A. J., Sarachan, K. L., Shiekhattar, R., Shanks, J.
R., Reyes-Turcu, F. E., Wilkinson, K. D., and Marmorstein, R. (2008) J. Biol. Chem.
283(16), 11038-11049
Neuhoff, V., Stamm, R., Pardowitz, I., Arold, N., Ehrhardt, W., and Taube, D. (1990)
Electrophoresis 11(2), 101-117
Wiese, S., Gronemeyer, T., Ofman, R., Kunze, M., Grou, C. P., Almeida, J. A.,
Eisenacher, M., Stephan, C., Hayen, H., Schollenberger, L., Korosec, T., Waterham,
H. R., Schliebs, W., Erdmann, R., Berger, J., Meyer, H. E., Just, W., Azevedo, J. E.,
Wanders, R. J., and Warscheid, B. (2007) Mol. Cell. Proteomics. 6(12), 2045-2057
Agne, B., Meindl, N. M., Niederhoff, K., Einwächter, H., Rehling, P., Sickmann, A.,
Meyer, H. E., Girzalsky, W., and Kunau, W. H. (2003) Mol. Cell 11(3), 635-646
Albertini, M., Rehling, P., Erdmann, R., Girzalsky, W., Kiel, J. A. K. W., Veenhuis,
M., and Kunau, W.-H. (1997) Cell 89(1), 83-92
Rottensteiner, H., Stein, K., Sonnenhol, E., and Erdmann, R. (2003) Mol. Biol. Cell.
14(10), 4316-4328
50.
51.
52.
53.
54.
55.
56.
57.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
13
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
58.
Ellison, M. J., and Hochstrasser, M. (1991) J. Biol. Chem. 266(31), 21150-21157
Zhu, Q., Hulen, D., Liu, T., and Clarke, M. (1997) Proc. Natl. Acad. Sci. U.S.A.
94(14), 7308-7313
Vornlocher, H. P., Hanachi, P., Ribeiro, S., and Hershey, J. W. (1999) J. Biol. Chem.
274(24), 16802-16812
Amerik, A. Y., Li, S. J., and Hochstrasser, M. (2000) Biological chemistry 381(9-10),
981-992
Lin, C. H., MacGurn, J. A., Chu, T., Stefan, C. J., and Emr, S. D. (2008) Cell 135(4),
714-725
Entian, K. D., Vogel, R. F., Rose, M., Hofmann, L., and Mecke, D. (1988) FEBS Lett.
236(1), 195-200
Huh, W. K., Falvo, J. V., Gerke, L. C., Carroll, A. S., Howson, R. W., Weissman, J.
S., and O'Shea, E. K. (2003) Nature 425, 686-691
Peng, J., Schwartz, D., Elias, J. E., Thoreen, C. C., Cheng, D., Marsischky, G.,
Roelofs, J., Finley, D., and Gygi, S. P. (2003) Nat. Biotechnol. 21(8), 921-926
Tamura, S., Yasutake, S., Matsumoto, N., and Fujiki, Y. (2006) J. Biol. Chem., in
press
Papa, F. R., and Hochstrasser, M. (1993) Nature 366(6453), 313-319
Hochstrasser, M. (1996) Annu. Rev. Genet. 30(405-439)
Hershko, A., and Rose, I. A. (1987) Proceedings of the National Academy of Sciences
of the United States of America 84(7), 1829-1833
van der Leij, I., Franse, M. M., Elgersma, Y., Distel, B., and Tabak, H. F. (1993) Proc.
Natl. Acad. Sci. USA 90(24), 11782-11786
Purdue, P. E., and Lazarow, P. B. (2001) J. Biol. Chem. 276(50), 47684-47689
Amerik, A., Swaminathan, S., Krantz, B. A., Wilkinson, K. D., and Hochstrasser, M.
(1997) The EMBO journal 16(16), 4826-4838
Krogan, N. J., Cagney, G., Yu, H., Zhong, G., Guo, X., Ignatchenko, A., Li, J., Pu, S.,
Datta, N., Tikuisis, A. P., Punna, T., Peregrin-Alvarez, J. M., Shales, M., Zhang, X.,
Davey, M., Robinson, M. D., Paccanaro, A., Bray, J. E., Sheung, A., Beattie, B.,
Richards, D. P., Canadien, V., Lalev, A., Mena, F., Wong, P., Starostine, A., Canete,
M. M., Vlasblom, J., Wu, S., Orsi, C., Collins, S. R., Chandran, S., Haw, R., Rilstone,
J. J., Gandi, K., Thompson, N. J., Musso, G., St Onge, P., Ghanny, S., Lam, M. H.,
Butland, G., Altaf-Ul, A. M., Kanaya, S., Shilatifard, A., O'Shea, E., Weissman, J. S.,
Ingles, C. J., Hughes, T. R., Parkinson, J., Gerstein, M., Wodak, S. J., Emili, A., and
Greenblatt, J. F. (2006) Nature 440(7084), 637-643
Jamieson, D. J. (1998) Yeast 14(16), 1511-1527
Izawa, S., Inoue, Y., and Kimura, A. (1995) FEBS Lett. 368(1), 73-76
Smith, J. J., Ramsey, S. A., Marelli, M., Marzolf, B., Hwang, D., Saleem, R. A.,
Rachubinski, R. A., and Aitchison, J. D. (2007) Mol. Syst. Biol. 3, 115
Gasch, A. P., Spellman, P. T., Kao, C. M., Carmel-Harel, O., Eisen, M. B., Storz, G.,
Botstein, D., and Brown, P. O. (2000) Molecular biology of the cell 11(12), 4241-4257
Swaminathan, S., Amerik, A. Y., and Hochstrasser, M. (1999) Mol. Biol. Cell 10(8),
2583-2594
Jentsch, S., and Rumpf, S. (2007) Trends Biochem. Sci. 32(1), 6-11
Zhang, J. W., Han, Y., and Lazarow, P. B. (1993b) J. Cell. Biol. 123(5), 1133-1147
Legakis, J. E., Koepke, J. I., Jedeszko, C., Barlaskar, F., Terlecky, L. J., Edwards, H.
J., Walton, P. A., and Terlecky, S. R. (2002) Mol. Biol. Cell 13(12), 4243-4255
Terlecky, S. R., Koepke, J. I., and Walton, P. A. (2006) Biochimica et biophysica acta
1763(12), 1749-1754
Petriv, O. I., and Rachubinski, R. A. (2004) J Biol Chem 279(19), 19996-20001
76.
77.
78.
79.
Gabaldon, T., Snel, B., van Zimmeren, F., Hemrika, W., Tabak, H., and Huynen, M.
A. (2006) Biology direct 1, 8
Doss-Pepe, E. W., Stenroos, E. S., Johnson, W. G., and Madura, K. (2003) Mol. Cell.
Biol. 23(18), 6469-6483
Wang, Q., Li, L., and Ye, Y. (2008) J. Biol. Chem. 283(12), 7445-7454
Ernst, R., Mueller, B., Ploegh, H. L., and Schlieker, C. (2009) Mol. Cell 36(1), 28-38
FIGURE LEGENDS
Figure 1. The yeast AAA-complex possesses ubiquitin hydrolase activity. MonoUb-Pex5pcontaining wild-type membranes were incubated with the AAA-complex purified from a cytosolic
fraction of pex5Δ cells using the TEV-ProtA tag. Where indicated, the AAA-complex was preincubated with NEM or with Ub-aldehyde to inhibit the observed ubiquitin hydrolase activity.
Figure 3. Ubp15p is partially localized to peroxisomes. (A) A cell-free extract of oleate-induced
wild-type cells expressing genomically tagged Ubp15p (Ubp15p-TEV-ProtA) was separated by
density gradient centrifugation (2.25%-24% Optiprep, 18% sucrose). Fractions were subjected to
measurements of the activity of catalase and cytochrom c oxidase as peroxisomal or mitochondrial
marker, respectively (upper panel). Equal portions of fractions were probed by immunoblotting (lower
panel) with antibodies against the protein A tag, Pex13p (peroxisomes); Porin (mitochondria) as well
as Fbp1p (cytosol). (B) Wild-type cells expressing both the PTS2 marker protein PTS2-dsRed as well
as GFP-Ubp15p, with and without overexpression of Pex15p, were grown on oleic acid plates for
two days and examined by fluorescence microscopy. While only a small portion of GFP-Ubp15p is
localized to peroxisomes in cells containing normal levels of Pex15p, a higher fraction of the fusion
protein was recruited to peroxisomes upon overexpression of Pex15p, indicated by the co-localization
of GFP-Ubp15p and the peroxisomal dsRed-marker.
Figure 4. The first AAA-domain of Pex6p mediates the Ubp15p-interaction. The L40 reporter
yeast cells were cotransformed with empty two-hybrid plasmids pPC86 and pPC97 (~) or plasmids
expressing indicated proteins. Double-transformants were lysed and subjected to liquid ßgalactosidase assay. ß-galactosidase activities (expressed in arbitrary units) indicate binding and are
represented as mean values of three independent experiments performed in duplicate. Error bars
denote SEM (standard error of the mean). Abbreviations: Ub= ubiquitin; N= amino-terminal domain;
D1= first AAA domain; D2= second AAA domain.
Figure 5. Ubp15p is an ubiquitin hydrolase acting on poly- as well as monoubiquitinated Pex5p.
(A) PolyUb-chains were incubated with recombinant wild-type Ubp15p or mutant Ubp15p(C214)
harbouring a substitution of the supposedly active site cysteine. At indicated time-points reactions
were stopped by adding SDS-sample buffer. Equal amounts of the samples were subjected to SDSPAGE. The presence of the indicated proteins was monitored by immunoblotting with antibodies
against ubiquitin or Ubp15p as indicated. Membranes isolated from (B) NEM-treated wild-type cells
which harbour monoubiquitinated Pex5p were incubated with recombinant Ubp15p followed by
Pex5p-immunoisolation or (C) pex1Δpex6Δ cells which contain poly-ubiquitinated Pex5p were
incubated with recombinant Ubp15p without further purification steps. The presence of either NEM or
14
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
Figure 2. Ubp15p forms a complex with the AAA-peroxins. Protein complexes were isolated by
affinity chromatography from soluble fractions of (A) protease deficient yeast strain cl3-ABYS-86
with His6-Pex6p or (B) from UTL-7A strain with endogenously encoded Pex1p fused to TEV-ProtA
tag. For the latter, the untransformed strain served as control for the specificity of the isolation.
Isolated proteins were visualized by silver stain or colloidal Coomassie as indicated. (C) His6-GSTUbp15p was isolated form soluble fraction of cl3-ABYS-86 strain and analyzed by immunoblotting.
Equal volumes of load and the 100 x-concentrated eluate fractions were probed with antibodies raised
against indicated proteins. The detection of cytosolic fructose1,6-bisphosphatase (Fbp1p) served as
control for unspecific binding.
Ub-aldehyde inhibits hydrolase activity of Ubp15p and serves as control. Samples were subjected to
SDS-PAGE and immunoblot analysis and with antibodies against ubiquitin or Pex5p-specific
antibodies as indicated to monitor the presence of ubiquitinated Pex5p.
Figure 7. ubp15Δ-cells exhibit a lower steady state concentration of Pex5p but higher rate of
ubiquitinated Pex5p. (A) Whole cell lysates of oleic acid-induced wild-type as well as ubp15Δ cells
were prepared and subjected to immunoblot analysis with antibodies specific for Pex5p and
mitochondrial porin, which served as loading control (left). Signal intensity was estimated by
densitometric analysis (right). (B) Indicated strains were grown for 10h under oleic-acid conditions
and for additional 4 h under same conditions in the presence of MG132 to inhibit proteasomal
degradation. Whole cell lysates were prepared and equal portion were subjected to immunoblot
analyses with Pex5p antibodies (left). Signal intensity of modified Pex5p in ubp15pΔ cells and
unmodified Pex5p in wild-type was quantified by densitometry (right).
Figure 8. ubp15Δ-cells exhibit oxidative-stress related protein import deficiencies and defective
growth on oleic acid (A) The PTS1 marker protein GFP-PTS1 was transformed into wild-type and
indicated mutant strains. The transformed strains were grown in liquid oleic acid media in the absence
or presence of 0.2 mM H2O2. All strains exhibit normal import of the marker protein GFP-PTS1 on
oleic acid medium without oxidative stress. Upon supplementation of the oleic acid medium with
H2O2, the marker protein was partially mislocalized to the cytosol in both doa4∆ and upb15Δ cells
whereas wild-type and ubp14∆ remained unaffected.
(B) Indicated strains were cultured in either oleic acid or glucose as sole carbon source in the absence
(closed symbols) and presence (open symbols) of 0.2 mM H2O2. At different time points samples were
taken and optical density was estimated at 600 nm.
15
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
Figure 6. ubp15Δ-cells contain functional but clustered peroxisomes (A) Indicated strains were
spotted as a series of 10-fold dilutions on media containing oleic acid as sole carbon source and
incubated for 5 days at 30°C. In contrast to pex5Δ, ubp15Δ grew at wild-type rate, suggesting that the
cells are not affected in peroxisome function. (B) The PTS1 marker protein GFP-SKL and the PTS2
marker protein PTS2-dsRed were co-transformed in wild-type, pex5∆ and ubp15∆-cells. The
transformed strains were grown on oleic acid plates for two days and examined by fluorescence
microscopy. Mutant pex5∆ cells are capable to import PTS2-proteins properly (indicated by the
punctuate pattern) but are impaired in PTS1-dependent matrix protein import and accordingly
mislocalize the marker protein to the cytosol. Both wild-type and ubp15∆ exhibit a punctuate
congruent staining for both peroxisomal markers, indicative for normal peroxisomal protein import.
The peroxisomes of ubp15∆ cells form clusters. (C) Ultrastructural appearance of clustered
peroxisomes in ubp15Δ cells. Wild-type and ubp15∆-mutant cells were grown on oleic acid medium
and analyzed by electron microscopy. In wild-type cells, peroxisomes are separated and distributed
within the cell, whereas the ubp15Δ mutant cells are characterized by peroxisome clusters.
Peroxisomes are marked with an asterisk. Size bar: 2.5 µm.
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
16
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
17
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
18
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
19
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
20
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
21
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
22
Downloaded from www.jbc.org at MEDIZINISCHE EINRICHTUNGE, on June 10, 2011
23
EUKARYOTIC CELL, June 2011, p. 770–775
1535-9778/11/$12.00 doi:10.1128/EC.05038-11
Copyright © 2011, American Society for Microbiology. All Rights Reserved.
Vol. 10, No. 6
The Putative Saccharomyces cerevisiae Hydrolase Ldh1p
Is Localized to Lipid Droplets䌤
Sven Thoms,1† Mykhaylo O. Debelyy,1 Melanie Connerth,2 Günther Daum,2 and Ralf Erdmann1*
Abteilung für Systembiochemie, Institut für Physiologische Chemie, Medizinische Fakultät der Ruhr-Universität Bochum,
D-44780 Bochum, Germany,1 and Institute of Biochemistry, Graz University of Technology, A-8010 Graz, Austria2
Received 18 March 2011/Accepted 30 March 2011
Here, we report the identification of a novel hydrolase in Saccharomyces cerevisiae. Ldh1p (systematic name,
Ybr204cp) comprises the typical GXSXG-type lipase motif of members of the ␣/␤-hydrolase family and shares
some features with the peroxisomal lipase Lpx1p. Both proteins carry a putative peroxisomal targeting signal
type1 (PTS1) and can be aligned with two regions of homology. While Lpx1p is known as a peroxisomal enzyme,
subcellular localization studies revealed that Ldh1p is predominantly localized to lipid droplets, the storage
compartment of nonpolar lipids. Ldh1p is not required for the function and biogenesis of peroxisomes, and
targeting of Ldh1p to lipid droplets occurs independently of the PTS1 receptor Pex5p.
prevents peroxisomal localization (40). A peroxisomal targeting signal type 2 (PTS2) is located within the first 20 amino
acids of the N terminus of some peroxisomal proteins. Peroxisomal proteins with a PTS2 are recognized by the import
receptor Pex7p (20, 21, 42).
Here, we report the identification of a novel hydrolase in S.
cerevisiae. The gene sequence of LDH1 predicts a GXSXGtype motif that is typical of ␣/␤-hydrolases and/or lipases (31).
Bioinformatics analysis suggests that LDH1 (YBR204C) encodes a novel peroxisomal protein, due to its putative PTS1
(17). In the present study, however, we show that Ldh1p is not
required for the function and biogenesis of peroxisomes and
that Ldh1p primarily localizes to LDs, independently of the
peroxisomal protein import machinery.
Peroxisomes and lipid droplets (LDs) are ubiquitous eukaryotic organelles involved in lipid metabolism. LDs appear as
oleosomes in plants, as adiposomes in mammals, or as lipid
particles/bodies/droplets in yeasts and constitute a family of
morphologically and biogenetically similar organelles (19).
LDs are bound by a phospholipid monolayer and serve as the
main storage sites for nonpolar lipids, mainly triacylglycerols
(TAG) and cholesteryl ester (CE) (6, 7). LDs derive from the
endoplasmic reticulum (ER), possibly by inclusion of nonpolar
lipids between the two ER leaflets, eventually leading to the
budding of nascent LDs (1, 6, 24, 27, 36). A large number of
LD proteins have been identified by proteomic studies (12). In
recent years, it has become evident that LDs, rather than being
solely lipid storage sites, play a dynamic role in lipid biosynthesis, metabolism, degradation, and trafficking (6). Peroxisomes are particularly engaged in the ␤-oxidation of long- and
very long-chain fatty acids (16). Notably, in yeast, peroxisomes
are the only site of fatty acid ␤-oxidation (37). In mammals,
peroxisomes are also involved in bile acid and plasmalogen
synthesis, as well as amino acid metabolism (37, 38). Defective
peroxisome biogenesis can lead to severe heritable diseases in
humans (32). Such biogenesis defects are caused by mutations
in PEX genes coding for proteins required for peroxisome
biogenesis, collectively called peroxins (25, 34). The majority of
peroxisomal matrix proteins are directed to peroxisomes by a
peroxisomal targeting signal type1 (PTS1). The three amino
acids SKL (serine-lysine-leucine) at the very C terminus of a
protein represent the first PTS1 discovered. Generally, PTS1
comprises tripeptides with the consensus sequence [SAC]
[KRH][LM]. The PTS1 is recognized in the cytosol by the
cycling import receptor Pex5p (8). Masking of the PTS1 by the
addition of protein tags interrupts PTS1-Pex5p association and
MATERIALS AND METHODS
Strains and plasmids. S. cerevisiae strains BY4742, BY4742 ⌬yor084w,
BY4742 ⌬ybr204c, BY4742 ⌬pex5, and BY4742 ⌬pex1 were obtained from EUROSCARF (Frankfurt). BY4742 ERG6-RFP was obtained from W. K. Huh
(San Francisco, CA). BY4742 ERG6-RFP ⌬ybr204c was constructed by gene
replacement using kanMX6 from pUG6 and primers 5⬘-CTAGAAGAGATTG
TTCAAAATGCAGAAAATGCAGCTGATTTGGTCGTACGCTGCAGGTC
GAC-3⬘ and 5⬘-GCACGAAAATCTAGTTACGCAATGTGAAATCTAGAAA
ACCTTCTAATCGATGAATTCGAGCTCG-3⬘. BY4742 ⌬pex5⌬ldh1 and
BY4742 ⌬pex1⌬ldh1 were constructed from BY4742 ⌬pex5 and BY4742 ⌬pex1 by
gene replacement using a pUG6 vector and primers 5⬘-GCTAGAAGAGATTG
TTCAAAATGCAGAAAATGCAGCTGATTTGGTCGTACGCTGCAGGTC
GAC-3⬘ and 5⬘-GCACGAAAATCTAGTTACGCAATGTGAAATCTAGAAA
ACCTTCTAATCGATGAATTCGAGCTCG-3⬘ after removal of loxPkanMX6-loxP marker cassettes (13, 14). The yeast media have been described
previously (9, 10). For construction of pUG35-LDH1 (Ldh1p-GFP), PCR-amplified YBR204c (primers RE2444 [5⬘-GCGCGGATCCATGAATATGGCAG
AACGTGCA-3⬘] and RE2445 [5⬘-GCGCAAGCTTCAATTTGGAATTATCA
ATCAC-3⬘]) was introduced into BamH I and HindIII sites of pUG35. For
construction of pUG36-LDH1 (GFP-Ldh1p), PCR-amplified YBR204C (primers RE2444 [5⬘-GCGCGGATCCATGAATATGGCAGAACGTGCA-3⬘] and
RE2446 [5⬘-GCGCAAGCTTCTACAATTTGGAATTATCAATCAC-3⬘]) was
introduced into BamHI and HindIII sites of pUG36. All constructs were confirmed by DNA sequencing. The GFP-SKL plasmid has been described previously (29).
Nile Red and Oil Red O staining. For Nile Red staining (39), yeast cells in
stationary phase were washed and resuspended in phosphate-buffered saline
(PBS) (150 mM NaCl, 1.7 mM KH2PO4, 5.2 mM Na2HPO4). The cells were
stained with Nile Red solution (0.0005% in PBS, diluted from a 0.01% stock
solution in acetone) for 15 min at room temperature in the dark. The cells were
* Corresponding author. Mailing address: Institut für Physiologische
Chemie, Ruhr-Universität Bochum, Universitätsstr. 150, D-44780 Bochum, Germany. Phone: 49 234 322 4943. Fax: 49 234 321 4266. E-mail:
[email protected].
† Present address: Universitätsmedizin Göttingen, Abteilung für Pädiatrie und pädiatrische Neurologie, Georg-August-Universität Göttingen, D-37099 Göttingen, Germany.
䌤
Published ahead of print on 8 April 2011.
770
VOL. 10, 2011
PUTATIVE YEAST HYDROLASE Ldh1p IS LOCALIZED TO LIPID DROPLETS
771
FIG. 1. Ldh1p and Lpx1p from S. cerevisiae are similar proteins with a hydrolase/lipase motif. (A) Similarities between Lpx1p (predicted mass,
43.7 kDa; 387 amino acids; theoretical pI, 8.16) and Ldh1p (predicted mass, 43.3 kDa; 375 amino acids; theoretical pI, 6.36) are indicated: two
regions of homology, the first of which contains the GHSMG hydrolase/lipase motif of the GXSXG consensus. Both proteins carry a (putative)
PTS1, QKL, or SKL. (B) Alignment of the two regions of homology of Lpx1p and Ldh1p exhibiting 28% (region A) and 27% (region B) amino
acid identities. Asterisk, histidine of the probable catalytic triad; arrowhead, aspartate of the probable catalytic triad in Ldh1p. The GXSXG
hydrolase/lipase motif is underlined; similar amino acids are indicated by a plus symbol. (C) Hydropathy plots of Ldh1p. The Kyte-Doolittle plot
was calculated with a window size of 11. Values greater than 1.8 indicate very hydrophobic regions. (D) C terminus of Ldh1p. The amino acids
in positions ⫺2 and ⫺5 are likely to interfere with peroxisomal targeting.
then washed six times with PBS to remove surplus dye. For Oil Red O staining
(26, 39), yeast cells in stationary phase were washed twice, fixed by 4% formaldehyde in PBS for 20 min, and washed twice again. The cells were then stained
with Oil Red O (0.2% in a water-isopopanol [1:1] mixture) for 15 min at room
temperature in the dark and washed six times before microscopic analysis.
Image acquisition. Samples were fixed with 0.5% (wt/vol) agarose on microscope slides. Fluorescence microscopic images were recorded on an AxioPlan 2
microscope (Zeiss) equipped with a ␣Plan-FLUAR 100⫻/1.45 oil objective and
an AxioCam MRm camera (Zeiss) at room temperature. If necessary, contrast
was linearly adjusted using the image acquisition software AxioVision 4.8
(Zeiss).
Subcellular fractionation and organelle isolation. Subcellular fractionation
and gradient centrifugation for the analysis of peroxisomes and mitochondria of
⌬ldh1 were carried out as described previously (29, 33). Cell fractionation and
LD isolation for the subcellular localization of Ldh1p have been described
previously (5, 11, 28).
RESULTS
Ldh1p and Lpx1p: two similar hydrolases. Ldh1p shares
some features with the peroxisomal lipase Lpx1p (33) (Fig. 1).
Both proteins have almost the same predicted molecular mass,
namely, 43 kDa for Ldh1p and 44 kDa for Lpx1p. Both proteins carry a putative PTS1, the prototypical SKL in Ldh1p,
and glutamine-lysine-leucine (QKL) in Lpx1p (Fig. 1A). Furthermore, both proteins can be aligned with two regions of
homology (Fig. 1A and B), with one in the central domain,
comprising the lipase motif GHSMG (4, 35), indicative of
members of the ␣/␤-hydrolase family. In the case of Ldh1p, the
amino acids adjacent to the active-site serine are identical in
the two proteins, namely, histidine (H) and methionine (M).
Hydropathy plots indicated a pronounced hydrophobic region
in the centers of both proteins. Amino acids 130 to 154 of
Ldh1p comprise a hydrophobic core region, 138VVELIFVLV
146, and amino acids 154 to 177 of Lpx1p comprise the core
region, 164LLILIEPVVI173 (Fig. 1C).
Absence of a synthetic phenotype of ⌬ldh1 and ⌬lpx1 in
peroxisome biogenesis. Ldh1p carries the prototypical yet putative PTS1 and has been speculated to be a peroxisomal matrix protein (17). Therefore, we first tested the effect of an
LDH1 deletion on peroxisome biogenesis. Postnuclear supernatants (PNS) were prepared from wild-type and ⌬ldh1 strains
and analyzed by density gradient centrifugation. The gradient
fractions were assayed for peroxisomal catalase and mitochondrial cytochrome c oxidase activity (Fig. 2A). The distribution
of neither of these proteins indicated a significant change in
the abundance or density of peroxisomes or mitochondria,
suggesting that peroxisomal and mitochondrial biogenesis remain functional after deletion of LDH1. As a defect in peroxisome biogenesis would affect peroxisome presence or density,
we conclude that Ldh1p is not a peroxin. Altogether, the avail-
772
EUKARYOT. CELL
THOMS ET AL.
FIG. 2. Ldh1p is dispensable for peroxisome biogenesis and function. (A) Postnuclear supernatants prepared from oleate-induced wildtype and ⌬ldh1 strains were fractionated by density gradient centrifugation, and each fraction was analyzed for catalase (peroxisome) and
cytochrome c oxidase (mitochondria) activities. The absence of Ldh1p
has no influence on the apparent densities of peroxisomes and mitochondria. (B) Growth on oleate is not affected by deletion of the lipase
gene LDH1 or LPX1 or both. Single or double deletions of LDH1 and
LPX1 were spotted on oleate and ethanol plates with equal cell numbers in a series of 10-fold dilutions and grown for 3 days at 30°C.
able evidence suggested that Lpx1p and Ldh1p might be proteins exerting similar or redundant functions. Most mutants
whose peroxisome biogenesis or functions are affected are
characterized by a growth defect on oleic acid (9). We therefore tested the single and double knockouts of LPX1 and
LDH1 for growth on oleate as the only carbon source (Fig. 2B).
Neither of these knockouts had its growth on oleic acid affected, suggesting that Lpx1p and Ldh1p do not form a redundant pair in peroxisome function.
Ldh1p localizes to the lipid droplet membrane. Next, we
investigated the subcellular distribution of Ldh1p. Ldh1p was
expressed from a plasmid as N-terminally or C-terminally
tagged green fluorescent protein (GFP) fusion proteins that
localized to a particular organelle about 1 to 2 ␮m in diameter
with several copies in a cell (Fig. 3A). Ldh1p specifically local-
ized to the surface membranes of these organelles. We reasoned that the organelles were fragmented vacuoles, endosomes, or LDs. Thus, we coexpressed marker proteins for the
organelles together with the Ldh1p fusion proteins and found
that Ldh1p perfectly colocalized with Erg6p, the ␦(24)-sterol
methyl transferase (Fig. 3A, top), which is a major and prominent LD protein (18). Both proteins localize to the surface membrane of LDs. Ldh1p colocalized with Erg6p when GFP was
localized at the N terminus or the C terminus of the protein (Fig.
3A). Localization of Ldh1p in LDs was also confirmed by Oil Red
O staining (Fig. 3B). Ldh1p contains a perfect consensus for a
PTS1 at its extreme C terminus. The fact that some LD proteins
contain a C-terminal localization signal (22) and the possibility of
a common origin of peroxisomes and LD encouraged us to test
whether the PTS1 of Ldh1p is required for LD targeting. We
found that neither masking of the SKL by expression of the GFP
at the C terminus of Ldh1p nor deletion of the PTS1 receptor
protein Pex5p interfered with targeting of Ldh1p (Fig. 3C). Thus,
the PTS1-like C terminus of Ldh1p does not function as a classical peroxisomal targeting signal, nor does it interfere with targeting of the polypeptide to LD.
To verify the localization of Ldh1p, we performed cell fractionation analysis with a yeast strain that expressed plasmidencoded Ldh1p-GFP. LDs were isolated by flotation on a
density gradient (5, 28). Subcellular fractions of the gradient
were analyzed by immunoblotting with polyclonal antibodies
against GFP and organelle-specific marker enzymes (Fig. 4).
These data revealed that Ldh1p-GFP was highly enriched in
LD, as represented by the LD marker proteins Erg1p
(squalene epoxidase) and Erg6p, but Ldh1p-GFP also cofractionated to some extent with the peroxisomal marker protein
Fox1p (fatty-acyl coenzyme A oxidase) and the mitochondrial
marker protein Por1p (mitochondrial porin) (Fig. 4). It has
been shown that some LD proteins are not exclusively found in
this compartment but also localize to the ER; in contrast,
Ldh1p appears to localize to LD and, possibly to a lesser
extent, to mitochondria and peroxisomes.
The biogenesis of peroxisomes and lipid droplets does not
require LDH1. To test whether deletion of LDH1 influences
the intracellular distribution or morphology of peroxisomes,
we analyzed wild-type and ⌬ldh1 strains expressing the peroxisomal marker protein GFP-SKL by fluorescence microscopy.
Microscopic inspection of the LD was performed by Oil Red O
staining (Fig. 5). These results showed that the morphological
appearance of peroxisomes, as well as the frequently observed
proximity to LD, was not affected by deletion of LDH1. Having
shown that Ldh1p is targeted to LD independently of the
soluble PTS1 receptor, we investigated whether Ldh1p is required for the biogenesis of LDs. After introducing a ⌬ldh1
knockout into the genomically tagged ERG6-red fluorescent
protein (RFP) marker strain for LD, we found that LD could
still be formed in the absence of Ldh1p (Fig. 6A). We confirmed these findings by LD staining with Nile Red (Fig. 6B)
and Oil Red O (Fig. 6C). Taking these data together, it appears that Ldh1p is not required for the formation of LD.
DISCUSSION
Ldh1p is a lipid droplet hydrolase with an SKL terminus.
Ldh1p contains the consensus sequence for a classical peroxi-
VOL. 10, 2011
PUTATIVE YEAST HYDROLASE Ldh1p IS LOCALIZED TO LIPID DROPLETS
773
FIG. 3. Ldh1p primarily localizes to lipid droplets, and its localization is independent of the peroxisomal import receptor Pex5p. (A) Ldh1p
colocalizes with the LD marker protein Erg6p [␦(24)-sterol methyl transferase]. GFP-Ldh1p and Ldh1p-GFP were coexpressed in a yeast strain
with genomically tagged Erg6p-RFP. Bar, 1 ␮m. (B) Ldh1p colocalizes with the LD marker dye Oil Red O. GFP-Ldh1p and Ldh1p-GFP were
coexpressed in a wild-type yeast strain. Bar, 1 ␮m. (C) Ldh1p localization is independent of the peroxisomal PTS1 pathway. GFP was fused to either
the C terminus (top images) or the N terminus (bottom images) of Ldh1p. Also, in a ⌬pex5 deletion mutant, Ldh1p localization to LD was not
compromised (right). In both cases Ldh1p colocalizes with the LD marker dye Oil Red O.
somal targeting signal, but the protein is primarily targeted to
LD and not to peroxisomes. Peroxisomal exclusion of Ldh1p is
likely due to the upstream sequences with charged amino acids
in positions ⫺2 and ⫺5 (Fig. 1D). These positions are adverse
to Pex5p binding and peroxisomal localization, for which polar/
hydrophilic or positively charged amino acids in position ⫺2
FIG. 4. Subcellular localization of Ldh1p. (A) Organelles from the
wild-type strain carrying Ldh1p-GFP were isolated from cells grown to
stationary phase in oleic acid-containing medium. Proteins from the
subcellular fractions were precipitated, and the same amounts were
separated by SDS-PAGE and analyzed by Western blotting using primary antibodies against marker enzymes, as indicated. The same
amounts of proteins were loaded; therefore, the intensity of the GFP
band does not represent the relative distribution of Ldh1p between
LDs, mitochondria, and peroxisomes. The presence of organelles was
detected with primary antibody against marker enzymes, as indicated.
Erg1p, squalene epoxidase; Erg6p, ␦(24)-sterol methyl transferase
(lipid droplets); Fox1p, fatty-acyl coenzyme A oxidase (peroxisomes);
Por1p, porin (mitochondria); Wbp1p (endoplasmic reticulum); H, homogenate; C, cytosol; 40g, 40,000 ⫻ g microsomes (endoplasmic reticulum); 100g, 100,000 ⫻ g microsomes (endoplasmic reticulum); Mt,
mitochondria; Px, peroxisomes.
are preferred. In our case, the negatively charged amino acid is
not even counteracted by neighboring amino acids, giving the
likely explanation for dominating peroxisomal exclusion. The
classical PTS1, SKL, is not completely sufficient to target protein to peroxisomes if the upstream sequences are not supportive. We show that the majority of Ldh1p is an LD protein that
is targeted independently of the PTS1-binding Pex5p. This
view is confirmed by applying a PTS1 prediction algorithm
FIG. 5. The association of lipid droplets and peroxisomes is not
affected by deletion of LDH1. Shown is fluorescence microscopy of
wild-type yeast and the ⌬ldh1 strain transformed with pGFP-SKL. LDs
were stained with Oil Red O (ORO). BF, bright field. Bar, 1 ␮m.
774
EUKARYOT. CELL
THOMS ET AL.
Extended localization studies of Ldh1p-GFP showed that at
least a portion of the polypeptide is targeted to peroxisomes
and mitochondria. While this triple localization may reflect the
true cellular scenario, we also have to take into account that
partial targeting of Ldh1p to peroxisomes and mitochondria
may be due to the overexpression of Ldh1p-GFP.
We were able to show that Ldh1p and the lipase Lpx1p are
not redundant, provided that other enzymes, probably with
somewhat lower homology, cannot compensate for a defect in
the two enzymes. Both peroxisomes and LD function in concert in lipid metabolism. LDs require the action of triacylglycerol lipases to metabolize nonpolar lipids, while peroxisomes
represent the sole cellular site for fatty acid oxidation. It is thus
possible that the peroxisomal Lpx1p and the LD Ldh1p play a
physiological role in lipid metabolism by mobilizing fatty acids
and channeling them to their site of degradation. LDs, as fatty
acid depot organelles, can be the storage sites for nonpolar
lipids that are further metabolized in peroxisomes. For this
reason, and not surprisingly, LDs have been found in proximity
to peroxisomes in different organisms (2, 15, 30). It was also
shown that S. cerevisiae peroxisomes attach to LDs or even
project into LDs, which was interpreted as an intimate interaction between the two compartments (3). Our work on Ldh1p
and Lpx1p shows that, beyond a metabolic collaboration, peroxisomes and LDs may be equipped with similar hydrolases.
ACKNOWLEDGMENTS
We thank Elisabeth Becker, Monika Bürger, and Uta Ricken for
technical assistance; Robert Rucktäschel for scientific input; and Wolfgang Girzalsky for reading the manuscript.
This work was supported by the Deutsche Forschungsgemeinschaft
(SFB642, ER178/4-1).
REFERENCES
FIG. 6. Lipid droplet biogenesis is independent of Ldh1p.
(A) Comparison of Erg6p-RFP localization in a wild-type strain and
a ⌬ldh1 deletion strain. Bar, 2 ␮m. (B) Localization and morphology of Nile Red-stained LDs from the wild type and a ⌬ldh1 deletion strain. Bar, 1 ␮m. (C) LD morphology in the wild type and
⌬lpx1, ⌬ldh1, and ⌬ldh1⌬lpx1 deletion strains. LDs were stained
with Oil Red O. BF, bright field. Bar, 1 ␮m.
(http://mendel.imp.ac.at/pts1/) (23) that does not predict peroxisomal localization for Ldh1p.
LD localization signals are only poorly characterized. It has
been suggested that LD localization signals are constituted of
hydrophobic residues at the C terminus of a protein (22, 41). A
Kyte-Doolittle plot of Ldh1p indicated a region with particularly high hydrophobicity from amino acids 130 to 154 (Fig.
1C). This stretch might be required to target and/or to attach
Ldh1p to LDs. Indeed, our data show that LD targeting is not
abrogated when GFP is added to the C terminus or the N
terminus of Ldh1p. Thus, targeting information within central
parts of Ldh1p, rather than at its termini, is sufficient for the
LD localization. Interestingly, the Lpx1p stretch of high hydrophobicity is in a similar location in the primary sequence,
namely, at amino acids 154 to 177. The hydrophobic stretches
in Ldh1p are likely not classical transmembrane domains
(TMD), because LDs are bound by a single monolayer membrane of phospholipids.
1. Athenstaedt, K., and G. Daum. 2006. The life cycle of neutral lipids: synthesis, storage and degradation. Cell. Mol. Life Sci. 63:1355–1369.
2. Bascom, R. A., H. Chan, and R. A. Rachubinski. 2003. Peroxisome biogenesis occurs in an unsynchronized manner in close association with the endoplasmic reticulum in temperature-sensitive Yarrowia lipolytica Pex3p mutants. Mol. Biol. Cell 14:939–957.
3. Binns, D., et al. 2006. An intimate collaboration between peroxisomes and
lipid bodies. J. Cell Biol. 173:719–731.
4. Brenner, S. 1988. The molecular evolution of genes and proteins: a tale of
two serines. Nature 334:528–530.
5. Connerth, M., K. Grillitsch, H. Kofeler, and G. Daum. 2009. Analysis of lipid
particles from yeast. Methods Mol. Biol. 579:359–374.
6. Czabany, T., K. Athenstaedt, and G. Daum. 2007. Synthesis, storage and
degradation of neutral lipids in yeast. Biochim. Biophys. Acta 1771:299–309.
7. Czabany, T., et al. 2008. Structural and biochemical properties of lipid
particles from the yeast Saccharomyces cerevisiae. J. Biol. Chem. 283:17065–
17074.
8. Dodt, G., et al. 1995. Mutations in the PTS1 receptor gene, PXR1, define
complementation group 2 of the peroxisome biogenesis disorders. Nat.
Genet. 9:115–125.
9. Erdmann, R., M. Veenhuis, D. Mertens, and W. H. Kunau. 1989. Isolation of
peroxisome-deficient mutants of Saccharomyces cerevisiae. Proc. Natl. Acad.
Sci. U. S. A. 86:5419–5423.
10. Erdmann, R., et al. 1991. PAS1, a yeast gene required for peroxisome
biogenesis, encodes a member of a novel family of putative ATPases. Cell
64:499–510.
11. Fowler, S. D., and P. Greenspan. 1985. Application of Nile red, a fluorescent
hydrophobic probe, for the detection of neutral lipid deposits in tissue
sections: comparison with oil red O. J. Histochem. Cytochem. 33:833–836.
12. Goodman, J. M. 2009. Demonstrated and inferred metabolism associated
with cytosolic lipid droplets. J. Lipid Res. 50:2148–2156.
13. Gueldener, U., J. Heinisch, G. J. Koehler, D. Voss, and J. H. Hegemann.
2002. A second set of loxP marker cassettes for Cre-mediated multiple gene
knockouts in budding yeast. Nucleic Acids Res. 30:e23.
14. Güldener, U., S. Heck, T. Fielder, J. Beinhauer, and J. H. Hegemann. 1996.
A new efficient gene disruption cassette for repeated use in budding yeast.
Nucleic Acids Res. 24:2519–2524.
VOL. 10, 2011
PUTATIVE YEAST HYDROLASE Ldh1p IS LOCALIZED TO LIPID DROPLETS
15. Hayashi, Y., M. Hayashi, H. Hayashi, I. Hara-Nishimura, and M.
Nishimura. 2001. Direct interaction between glyoxysomes and lipid bodies in
cotyledons of the Arabidopsis thaliana ped1 mutant. Protoplasma 218:83–94.
16. Kunau, W. H., et al. 1988. Comparative enzymology of beta-oxidation.
Biochem. Soc. Trans. 16:418–420.
17. Lazarow, P. B., and W. H. Kunau. 1997. Peroxisomes, p. 547–605. In E. Jones
(ed.), The molecular and cellular biology of the yeast Saccharomyces. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
18. Leber, R., E. Zinser, G. Zellnig, F. Paltauf, and G. Daum. 1994. Characterization of lipid particles of the yeast, Saccharomyces cerevisiae. Yeast 10:
1421–1428.
19. Martin, S., and R. G. Parton. 2006. Lipid droplets: a unified view of a
dynamic organelle. Nat. Rev. Mol. Cell Biol. 7:373–378.
20. Marzioch, M., R. Erdmann, M. Veenhuis, and W. H. Kunau. 1994. PAS7
encodes a novel yeast member of the WD-40 protein family essential for
import of 3-oxoacyl-CoA thiolase, a PTS2-containing protein, into peroxisomes. EMBO J. 13:4908–4918.
21. Miyata, N., K. Hosoi, S. Mukai, and Y. Fujiki. 2009. In vitro import of
peroxisome-targeting signal type 2 (PTS2) receptor Pex7p into peroxisomes.
Biochim. Biophys. Acta 1793:860–870.
22. Müllner, H., D. Zweytick, R. Leber, F. Turnowsky, and G. Daum. 2004.
Targeting of proteins involved in sterol biosynthesis to lipid particles of the
yeast Saccharomyces cerevisiae. Biochim. Biophys. Acta 1663:9–13.
23. Neuberger, G., S. Maurer-Stroh, B. Eisenhaber, A. Hartig, and F. Eisenhaber. 2003. Prediction of peroxisomal targeting signal 1 containing proteins
from amino acid sequence. J. Mol. Biol. 328:581–592.
24. Ohsaki, Y., et al. 2009. Biogenesis of cytoplasmic lipid droplets: from the
lipid ester globule in the membrane to the visible structure. Biochim. Biophys. Acta 1791:399–407.
25. Platta, H. W., and R. Erdmann. 2007. The peroxisomal protein import
machinery. FEBS Lett. 581:2811–2819.
26. Puri, V., et al. 2007. Fat-specific protein 27, a novel lipid droplet protein that
enhances triglyceride storage. J. Biol. Chem. 282:34213–34218.
27. Rajakumari, S., K. Grillitsch, and G. Daum. 2008. Synthesis and turnover of
non-polar lipids in yeast. Prog. Lipid Res. 47:157–171.
28. Rosenberger, S., M. Connerth, G. Zellnig, and G. Daum. 2009. Phosphatidylethanolamine synthesized by three different pathways is supplied to peroxisomes of the yeast Saccharomyces cerevisiae. Biochim. Biophys. Acta
1791:379–387.
775
29. Schäfer, A., D. Kerssen, M. Veenhuis, W. H. Kunau, and W. Schliebs. 2004.
Functional similarity between the peroxisomal PTS2 receptor binding protein Pex18p and the N-terminal half of the PTS1 receptor Pex5p. Mol. Cell.
Biol. 24:8895–8906.
30. Schrader, M. 2001. Tubulo-reticular clusters of peroxisomes in living COS-7
cells: dynamic behavior and association with lipid droplets. J. Histochem.
Cytochem. 49:1421–1429.
31. Schrag, J. D., and M. Cygler. 1997. Lipases and alpha/beta hydrolase fold.
Methods Enzymol. 284:85–107.
32. Steinberg, S. J., et al. 2006. Peroxisome biogenesis disorders. Biochim. Biophys. Acta 1763:1733–1748.
33. Thoms, S., M. O. Debelyy, K. Nau, H. E. Meyer, and R. Erdmann. 2008.
Lpx1p is a peroxisomal lipase required for normal peroxisome morphology.
FEBS J. 275:504–514.
34. Thoms, S., and R. Erdmann. 2005. Import of proteins into peroxisomes, p.
125–134. In J. Eichler (ed.), Protein movement across membranes. Landes
Bioscience, Georgetown, TX.
35. Voss, H., et al. 1997. DNA sequencing and analysis of 130 kb from yeast
chromosome XV. Yeast 13:655–672.
36. Walther, T. C., and R. V. Farese, Jr. 2009. The life of lipid droplets. Biochim.
Biophys. Acta 1791:459–466.
37. Wanders, R. J., and H. R. Waterham. 2006. Biochemistry of mammalian
peroxisomes revisited. Annu. Rev. Biochem. 75:295–332.
38. Wanders, R. J., and H. R. Waterham. 2006. Peroxisomal disorders: the single
peroxisomal enzyme deficiencies. Biochim. Biophys. Acta 1763:1707–1720.
39. Wolinski, H., and S. D. Kohlwein. 2008. Microscopic analysis of lipid droplet
metabolism and dynamics in yeast. Methods Mol. Biol. 457:151–163.
40. Yang, X., P. E. Purdue, and P. B. Lazarow. 2001. Eci1p uses a PTS1 to enter
peroxisomes: either its own or that of a partner, Dci1p. Eur. J. Cell Biol.
80:126–138.
41. Zehmer, J. K., R. Bartz, P. Liu, and R. G. Anderson. 2008. Identification of
a novel N-terminal hydrophobic sequence that targets proteins to lipid droplets. J. Cell Sci. 121:1852–1860.
42. Zhang, J. W., and P. B. Lazarow. 1996. Peb1p (Pas7p) is an intraperoxisomal
receptor for the NH2-terminal, type 2, peroxisomal targeting sequence of
thiolase: Peb1p itself is targeted to peroxisomes by an NH2-terminal peptide.
J. Cell Biol. 132:325–334.
EUKARYOTIC CELL, June 2011, p. 776–781
1535-9778/11/$12.00 doi:10.1128/EC.05040-11
Copyright © 2011, American Society for Microbiology. All Rights Reserved.
Vol. 10, No. 6
Involvement of the Saccharomyces cerevisiae Hydrolase Ldh1p
in Lipid Homeostasis䌤
Mykhaylo O. Debelyy,1 Sven Thoms,1† Melanie Connerth,2 Günther Daum,2 and Ralf Erdmann1*
Abteilung für Systembiochemie, Institut für Physiologische Chemie, Medizinische Fakultät der Ruhr-Universität Bochum,
D-44780 Bochum, Germany,1 and Institute of Biochemistry, Graz University of Technology, A-8010 Graz, Austria2
Received 18 March 2011/Accepted 30 March 2011
Here, we report the functional characterization of the newly identified lipid droplet hydrolase Ldh1p.
Recombinant Ldh1p exhibits esterase and triacylglycerol lipase activities. Mutation of the serine in the
hydrolase/lipase motif GXSXG completely abolished esterase activity. Ldh1p is required for the maintenance
of a steady-state level of the nonpolar and polar lipids of lipid droplets. A characteristic feature of the
Saccharomyces cerevisiae ⌬ldh1 strain is the appearance of giant lipid droplets and an excessive accumulation
of nonpolar lipids and phospholipids upon growth on medium containing oleic acid as a sole carbon source.
Ldh1p is thought to play a role in maintaining the lipid homeostasis in yeast by regulating both phospholipid
and nonpolar lipid levels.
eration of energy by ␤-oxidation or for the synthesis of
membrane lipids and signaling molecules (9). It has been
shown that nearly all cell types have the ability to generate LDs
in response to elevated fatty acid levels and to subsequently
metabolize and disperse these LDs when conditions are reversed (26), thereby providing an emergency energy pool for
cell survival (3). Due to their unique architecture, LDs can
protect cells from the effects of potentially toxic lipid species,
such as unesterified lipids (23, 24) or toxic free fatty acids (3),
by depositing them inside the LD’s core. In addition to this
lipid-scavenging function, LDs can transiently store certain
proteins, which may be released or degraded at later time
points (9, 13, 14, 36).
Here, we report the functional characterization of the newly
identified LD hydrolase Ldh1p (34a). We demonstrate that
recombinant Ldh1p exerts esterase and triacylglycerol lipase
activities. The enzyme activity was abolished upon mutation of
the conserved GXSXG-type lipase motif of the protein. The
Saccharomyces cerevisiae ⌬ldh1 strain is characterized by the
appearance of giant LDs and the accumulation of nonpolar
lipids and phospholipids in LDs, indicative of a role of Ldh1p
in maintaining lipid homeostasis.
Lipid droplets (LDs) are remarkable dynamic subcellular
organelles of globular shape with a size range from 20 to 100
␮m, depending on the cell type (9, 12, 15, 31). LDs are depots
of neutral lipids with a complex biology that exist in virtually
any kind of cell, ranging from bacteria to yeasts, plants, and
higher mammals (3, 13, 15). In many cells, LDs occupy a
considerable portion of the cell volume and weight (35). As the
major intracellular storage organelles, LDs were first described
in the works of R. Altmann and E. B. Wilson in the 19th
century (1, 37). In contrast to the vesicular organelles, which
have the aqueous content enclosed by a phospholipid bilayer
membrane (12, 13), mature LDs have a unique physical structure: they have a neutral lipid core consisting of triacylglycerols
(TG) and sterol esters (SE) surrounded by a phospholipid
monolayer (3, 24, 38) that contains numerous peripheral or
embedded proteins (26, 33). TG as well as SE play crucial roles
for the cell: TG is the main energy store, and both TG and SE
are depots of membrane lipid components (35). LDs can
tightly regulate the level of intracellular free cholesterol by
hydrolyzing sterol ester (26). The LD core also contains other
endogenous neutral lipids, like monoacylglycerol, diacylglycerol, free cholesterol, and retinol ester, and xenobiotic hydrophobic compounds, such as polycyclic aromatic hydrocarbons
(15, 17, 29, 32, 33). A number of proteins are specifically
targeted to the LD surface (18), where they can regulate LD
dynamics and the turnover of stored lipids (24). Lipid-metabolizing enzymes, including hydrolases and lipases, are the major class of LD enzymes (9). LDs play crucial roles in cellular
energy homeostasis and lipid metabolism (35). LDs can provide a rapidly mobilized lipid source for many important biological processes. Neutral lipids may be mobilized for the gen-
MATERIALS AND METHODS
Strains and plasmids. S. cerevisiae strains BY4742, BY4742 ⌬ybr204c, BY4742
⌬yor084w, BY4742 ⌬ybr204c ⌬yor084w, BY4742 ERG6-RFP, and BY4742
ERG6-RFP ⌬ybr204c are described in reference 34a. DNA plasmids pUG35LDH1 (Ldh1p-GFP) and pUG36-LDH1 (GFP-Ldh1p) are described in reference
34a. Yeast media have been described previously (10, 11). pUG35-LDH1-M1
[Ldh1p-(S177A)-GFP] and pUG36-LDH1-M1 [GFP-Ldh1p-(S177A)] were cloned
from pUG35-LDH1 and pUG36-LDH1 using a QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) (primers RE2400 [5⬘-ATAGTGCTTGTA
GGGCATGCTATGGGTTGTTTTCTGGCA-3⬘] and RE2401 [5⬘-TGCCAGA
AAACAACCCATAGCATGCCCTACAAGCACTAT-3⬘]). pET21d-LDH1 was
constructed by introducing PCR-amplified YBR204c (primers OST248 [5⬘-GC
GAATTCCATATGAATATGGCAGAACGTGCAG-3⬘] and OST217 [5⬘-GCT
GCGGCCGCCAATTTGGAATTATCAATCACC-3⬘]) into NdeI and NotI
sites of pET21b (EMD Chemicals). pET21d-LDH1-M1 [Ldh1p-(S177A)-His6]
was cloned from pET21d-LDH1 using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) (primers RE2400 [5⬘-ATAGTGCTTGTAGGG
CATGCTATGGGTTGTTTTCTGGCA-3⬘] and RE2401 [5⬘-TGCCAGAAAA
* Corresponding author. Mailing address: Institut für Physiologische Chemie, Ruhr-Universität Bochum, Universitätsstraße 150,
D-44780 Bochum, Germany. Phone: 49 234 322 4943. Fax: 49 234
321 4266. E-mail: [email protected].
† Present address: Universitätsmedizin Göttingen, Abteilung für Pädiatrie und pädiatrische Neurologie, Georg-August-Universität Göttingen, D-37099 Göttingen, Germany.
䌤
Published ahead of print on 8 April 2011.
776
VOL. 10, 2011
INVOLVEMENT OF YEAST HYDROLASE Ldh1p IN LIPID HOMEOSTASIS
CAACCCATAGCATGCCCTACAAGCACTAT-3⬘]). All constructs were
confirmed by DNA sequencing.
Protein expression. Ldh1p was expressed from plasmid pET21b-LDH1 in
Escherichia coli BL21(DE3). Cells were harvested by centrifugation and diluted
in buffer A (1⫻ phosphate-buffered saline [PBS], 300 mM sodium chloride, 1
mM dithiothreitol, 40 mM imidazole) containing a protease inhibitor mixture (8
␮M antipain-dihydrochloride, 0.3 ␮M aprotinin, 1 ␮M bestatin, 10 ␮M chymostatin, 5 ␮M leupeptin, 1.5 ␮M pepstatin), together with 50 ␮g/ml lysozyme, 22.5
␮g/ml DNase I, and 40 mM imidazole. The cells were sonicated using a 250D
Branson (Danbury, CT) Digital Sonifier. After removal of cell debris by centrifugation, the supernatant was clarified by 0.22-␮m filtration and loaded on HisTrap columns (GE Healthcare Life Sciences) equilibrated with buffer A. The
column was washed in buffer A, and recombinant Ldh1p was eluted by a
continuous 40 to 500 mM imidazole gradient. Peak fractions were identified
by SDS-PAGE and pooled, and the isolated protein was concentrated with
VivaSpin concentrators (30-kDa cutoff; Sartorius). The concentrated Ldh1p was
subjected to size exclusion chromatography on an ÄKTA Purifier FPLC System with
Superdex 200 (GE Healthcare Life Sciences). Peak fractions of Ldh1p were identified by SDS-PAGE and pooled, and the isolated protein was concentrated with
VivaSpin (30-kDa cutoff; Sartorius).
Enzyme assays. Esterase activity was determined with p-nitrophenyl butyrate
(PNB) (Sigma) in PBS (pH 7.4) in a total volume of 200 ␮l at 37°C. Free
p-nitrophenol was determined at 410 nm in 96-well plates. Michaelis-Menten
kinetics was analyzed using GraphPad Prism 5 (GraphPad Software). Triacylglycerol lipase (TGL) activity was determined using 1,2-dioleoyl-3-pyrenedecanol-rac-glycerol (DPG) (Marker Gene) in 0.1 M glycine, 19 mM sodium
deoxycholate, pH 9.5, in a total volume of 200 ␮l at 37°C. Hydrolysis of DPG was
followed in 96-well plates at 460 nm with 360-nm excitation in a Sirius HT
fluorescence plate reader (MWG Biotech). The TGL activity of Ldh1p toward
DPG was compared with the TGL activity of Candida rugosa triacylglycerol
lipase (Lipase AT30 Amano; 1,440 units/mg; Sigma) as a control. We also
adapted a specific and sensitive TGL assay originally developed for the measurement of bacterial TGLs (22). The TGL activity of Ldh1p on rhodamine B
agar plates was determined by using agar plates containing trioleoylglycerol and
rhodamine B. The agar (1% [wt/vol]) was dissolved in PBS, adjusted to pH 7.4,
autoclaved, and cooled to 60°C. Then, trioleoylglycerol (2.5% [wt/vol]) and
rhodamine B (0.001% [wt/vol]) were added to the agar medium with vigorous
stirring for 1 min. The medium was kept for 10 min at 60°C to reduce foaming,
and 20 ml of medium was poured into plastic petri dishes. To detect triacylglycerol lipase activity, holes with a diameter of 6 mm were punched into the agar
and filled with 200 ␮l protein solution. Ldh1p and C. rugosa lipase (CRL) were
diluted in PBS (pH 7.4). The plates were incubated for 48 h at 30°C. After 48 h,
the plates began to show an orange fluorescence visible under UV light (350 nm).
Lipid extraction and TLC. The lipids were extracted by the method of Bligh
and Dyer (4). The organic layer was washed three times with 1 M KCl, and the
solvent was removed by evaporation in a vacuum. The lipids were dissolved in a
small volume of chloroform and separated on thin-layer chromatography (TLC)
plates (TLC Silica gel 60 F254; 20 by 20 cm; Merck) using chloroformmethanol-water (65:25:4 [vol/vol/vol]) as the developing solvent. Lipid classes
were visualized with iodine vapor and identified according to TLC standard
18-5A (Nu-Chek Prep, Elysian, MN).
Electron microscopy. The ultrastructure of yeast cells was studied with oleateinduced cells that had been fixed with 1.5% KMnO4 and processed as described
previously (10).
Miscellaneous. Oil Red O staining, image acquisition, and the isolation of LDs
are described in reference 34a. LD purification for lipid extraction was performed as described previously (8, 27). The weight of LDs was estimated gravimetrically in 1.5-ml reaction tubes (Eppendorf).
777
FIG. 1. Protein expression, purification, and enzymatic activity of
Ldh1p. (A) Ldh1p was expressed as a fusion protein with a hexahistidine tag and purified by affinity chromatography. (B) Esterase activity
of Ldh1p toward PNB. Km and Vmax values were calculated using
Michaelis-Menten approximations. (C) TGL activity of Ldh1p toward
DPG. (D) Purified Ldh1p and CRL were incubated on plates containing 2.5% trioleoylglycerol and 0.001% rhodamine B and, after 48 h,
imaged at 350 nm. The numbers indicate the concentrations in mg/ml.
In total, 200 ␮l was loaded per agar slot. Hydrolysis of trioleoylglycerol
was identified by fluorescent halos.
RESULTS
Enzymatic activity of Ldh1p. Characteristic GXSXG motifs
and similarities to ␣/␤-hydrolases in the predicted protein sequences of Ldh1p suggest that the protein is an esterase or
lipase (5, 28, 34). Indeed, Ldh1p was identified as a serine
hydrolase by computational and chemical proteomics methods
(2). We expressed Ldh1p as hexahistidine-tagged fusions in
E. coli (Fig. 1A) and tested the isolated protein for esterase
activity using PNB as a substrate. We found Ldh1p to be an
active esterase hydrolyzing the model substrate PNB with a Km
of 0.77 mM and a Vmax of 0.041 ␮mol/min/mg (Fig. 1B).
Phospholipase A, C, and D activities were not detected (data
not shown). For the analysis of phospholipase A activity, we
used the fluorogenic phospholipase A substrate bis-BODIPY
FL C11-PC (B7701; Invitrogen) [1,2-bis-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-undecanoyl)-snglycero-3-phosphocholine]. For analysis of phospholipase C
778
DEBELYY ET AL.
EUKARYOT. CELL
FIG. 2. Hydrolase activity is not required for Ldh1p targeting to LDs. (A) Ldh1p is a hydrolytically active serine hydrolase with a classical
catalytic triad containing a conserved serine (GXSXG motif), histidine, and aspartate (grey shading). (B) GFP-Ldh1m1p and Ldh1m1p-GFP were
coexpressed in a yeast strain with genomically tagged Erg6p-RFP. Ldh1m1p colocalizes with the LD marker protein Erg6p [␦(24)-sterol methyl
transferase]. Ldh1p containing a mutation of the active site (S177A) still localizes to LDs, indicating that the lipid targeting is independent of its
catalytic activity. Bar, 1 ␮m. BF, bright field.
activity, we used the Amplex Red Phosphatidylcholine-Specific
Phospholipase C Assay Kit (A12218; Invitrogen). Phospholipase D activity was assayed with the Amplex Red Phospholipase D Assay Kit (A12219; Invitrogen).
Next, we assayed TGL activity using DPG as a substrate
(Fig. 1C). One of the acyl residues of DPG contains the eximer-forming pyrene decanoic acid. Upon hydrolytic cleavage,
the released pyrene decanoic acid leads to a decrease in eximer
fluorescence. We found Ldh1p to be an active triacylglycerol
lipase hydrolyzing the model substrate DPG with a Km of 3.3
mM and a Vmax of 1 ␮mol/min/mg (Fig. 1C). TGL activity was
also confirmed by an assay with fluorescein dilaurate as the
substrate (not shown). We also adapted a specific and sensitive
TGL assay originally developed for the measurement of bacterial TGLs (22). This assay is based on the hydrolysis of
trioleoylglycerol and the formation of orange fluorescent rhodamine B halos. The results shown in Fig. 1D revealed that
Ldh1p exerts a weak TGL activity. In summary, the purified
Ldh1p exerts esterase and TG lipase activities.
Mutational analysis of the GXSXG-type lipase motif. The
characteristic GXSXG motif of ␣/␤-hydrolases is present in
Ldh1p and is thought to contribute to the active site of the
enzyme (Fig. 2A). To test this experimentally, we introduced a
point mutation into the putative active site of Ldh1p (S177A)
and analyzed the mutated protein for esterase activity. Replacement of serine with alanine in the hydrolase/lipase motif
of Ldh1p completely abolished hydrolase activity. The mutated
protein (Ldh1m1p) still localized to LDs, suggesting that the
catalytic activity is not required for its topogenesis (Fig. 2B).
The ⌬ldh1 mutant is characterized by the accumulation of
lipids. Ldh1p has been shown to be predominantly localized to
LDs (34a). To characterize the function of Ldh1p in more
detail, we investigated whether the enzyme is involved in the
biogenesis of LDs. To this end, LDs were isolated from oleic
acid-induced wild-type and ⌬ldh1 mutant cells and appeared as
a thick layer on top of a gradient of the mutant (Fig. 3A). The
total weight of LDs was drastically increased in the ⌬ldh1 yeast
strain in comparison to the wild type (Fig. 3B). These data
were corroborated by TLC separation of extracted lipids from
FIG. 3. The ⌬ldh1 yeast strain exhibits excessive accumulation of
nonpolar and polar lipids in LDs during growth on medium containing
oleic acid as a sole carbon source. (A) LDs were isolated from wildtype and ⌬ldh1 mutant cells and appeared as a thick layer on top of a
gradient of the mutant. (B) The total weight of LDs was strongly
increased in the ⌬ldh1 yeast strain in comparison to the wild type. The
error bars indicate standard deviations. (C) TLC separation of extracted nonpolar and polar lipids from purified LDs, which showed the
increase in nonpolar lipids and phospholipids in the ⌬ldh1 yeast strain.
PC, phosphatidylcholine; PE, phosphatidylethanolamine; NPL, nonpolar lipids.
VOL. 10, 2011
INVOLVEMENT OF YEAST HYDROLASE Ldh1p IN LIPID HOMEOSTASIS
779
wild-type cells, ⌬ldh1 mutant cells, and mutant cells expressing
plasmids encoding either wild-type Ldh1p or the mutant
Ldh1m1p. LDs appeared as a thick layer on top of the gradient, and comparison of the gradients revealed a thin lipid layer
on top of the gradient for the wild type and the ⌬ldh1 mutant
complemented with wild-type Ldh1p. A thicker layer, which is
typical of the ⌬ldh1 mutant, was monitored for mutant cells
that contained the catalytic dead Ldh1p (Fig. 5A). These data
were corroborated by determination of the total weight of LDs,
which was increased in the ⌬ldh1 strain and remained increased
upon expression of the mutant protein (not shown). Accordingly,
staining with Oil Red O and inspection of the cells by fluorescence microscopy (Fig. 5B), as well as by electron microscopy
(Fig. 5C), revealed that the giant-LD phenotype of the ⌬ldh1
strain could be complemented with wild-type Ldh1p, but not with
the catalytic dead mutant Ldh1p. These data demonstrate that
functional complementation of the ⌬ldh1 mutant phenotype requires expression of enzymatically active Ldh1p, indicating that
the hydrolase activity of the enzyme is required for its function in
lipid homeostasis.
DISCUSSION
FIG. 4. Giant LDs in the ⌬ldh1 mutant. (A) Comparison of LD
morphologies of the wild type (BY4742 Erg6p-RFP) and a deletion
strain (BY4742 ⌬ldh1 Erg6p-RFP) by fluorescence microscopy. Bar, 1
␮m. (B) Localizations and morphologies of Oil Red O-stained wildtype (BY4742) and deletion strain (BY4742 ⌬ldh1) LDs. Bar, 1 ␮m.
(C) Absence of LDH1 leads to the formation of giant LDs, as well to
the reduction of the total LD number in a cell. Shown are electron
microscopic images of cells: the wild type (BY4742) and a deletion
strain (BY4742 ⌬ldh1). Bars, 1 ␮m.
purified LDs, which showed the increase in nonpolar lipids and
phospholipids in the ⌬ldh1 yeast strain (Fig. 3C).
Giant lipid droplets in ⌬ldh1 mutant cells. To analyze
whether the accumulation of lipids in mutant cells lacking the
LD protein Ldh1p is accompanied by changes in LD morphology, the LDs of oleic acid-induced wild-type and ⌬ldh1 knockout cells expressing genomically encoded Erg6p-red fluorescent protein (RFP) were visualized by fluorescence microscopy
(Fig. 4A), and the LDs of oleic acid-induced wild-type and
⌬ldh1 knockout cells were stained with Oil Red O and inspected by fluorescence microscopy (Fig. 4B). The data demonstrate that LDs can still be formed in the absence of Ldh1p,
indicating that Ldh1p per se is not required for the formation
of LDs. However, the morphological appearance of LDs in
⌬ldh1 mutant cells differed significantly from that in wild-type
cells. The LDs of the mutant exhibited brighter fluorescence,
indicating the existence of bigger LDs. These data were corroborated by electron microscopic inspection of wild-type and
mutant cells, which revealed the presence of giant LDs in the
⌬ldh1 mutant (Fig. 4C).
Esterase activity of Ldh1p is required for lipid homeostasis.
The ⌬ldh1 yeast strain exhibits an excessive accumulation of
lipids in LDs during growth on medium containing oleic acid as
a sole carbon source. To test whether the loss of hydrolase
activity of Ldh1p is responsible for the observed phenotype, we
tested complementation of the mutant with functional and
catalytic dead Ldh1p harboring a substitution of the active-site
serine (Ldh1m1p). LDs were isolated from oleic acid-induced
Ldh1p is a hydrolytically active serine hydrolase with a classical catalytic triad containing a serine (GXSXG motif). A
conserved histidine was revealed by profile hidden Markov
models (9a), and the aspartate of the probable triad was derived from an alignment with canine gastric triacylglycerol
lipase (Fig. 2A). The putative active-site serine of Ldh1p is
located next to the regions of highest hydrophobicity, suggesting that Ldh1p is a membrane-active hydrolase. We demonstrated that the hydrolase activity of Ldh1p could be completely abolished by the replacement of the active-site serine by
alanine. Fluorescence microscopy analysis indicated that
Ldh1p targets to the boundary of the LD monolayer membrane, supporting the idea that Ldh1p is involved in metabolic
processes. Taken together, these features characterize Ldh1p
as an active LD hydrolase. Mutation of the active site of Ldh1p
does not lead to protein mislocalization, indicating that the
lipase active site of Ldh1p is not involved in LD targeting.
Cells deficient in Ldh1p are characterized by giant LDs
accompanied by the accumulation of nonpolar lipids and phospholipids. Thus, Ldh1p seems to be required for the mobilization of LD-stored lipids, which would also explain the dependency of the Ldh1p function on its hydrolase activity. We
speculate that Ldh1p plays a role in maintaining lipid homeostasis by regulating both phospholipid and nonpolar lipid levels. Interestingly, the ⌬ldh1 (⌬ybr204c) strain has been reported to exhibit resistance to the lipophilic drug camptothecin
(16, 19, 20). Camptothecin is a cytotoxic quinoline alkaloid that
inhibits the DNA enzyme topoisomerase I. The resistance to
camptothecin might be explained by increased detoxification
properties of LDs with an excessive amount of nonpolar lipids,
which may serve as a reservoir for hydrophobic toxic molecules
(3, 7, 21, 35). Global genomic screening research recently disclosed the transient induction of LDH1 by growth on oleate
medium (30). It was shown that the level of Ldh1p increased
within the first 3 h of induction, followed by a decrease within
the subsequent 6 h and complete reduction to basal levels
within the next 17 h. Such an expression profile might hint at a
780
EUKARYOT. CELL
DEBELYY ET AL.
FIG. 5. The esterase activity of Ldh1p is required for lipid homeostasis. The ⌬ldh1 yeast strain exhibits excessive accumulation of lipids in LDs
during growth on medium containing oleic acid as a sole carbon source. LDs were isolated from oleic acid-induced wild-type cells and ⌬ldh1 mutant
cells expressing plasmids encoding either wild-type Ldh1p or the mutant Ldh1m1p. (A) LDs appeared as a thick layer on top of the gradient, and
comparison of the gradients revealed a thin lipid layer on top of the gradient for the wild type (WT) and the ⌬ldh1 mutant complemented with
wild-type Ldh1p. A thicker layer, typical of the ⌬ldh1 mutant, was monitored for mutant cells that contained the catalytic dead Ldh1p. (B) Staining
with Oil Red O and inspection by fluorescence microscopy revealed that the giant-LD phenotype of the ⌬ldh1 strain could be complemented with
wild-type Ldh1p, but not with the catalytic dead mutant Ldh1p. Bar, 1 ␮m. (C) Electron microscopy revealed that the giant-LD phenotype of the
⌬ldh1 strain could be complemented with wild-type Ldh1p, but not with the catalytic dead mutant Ldh1p. Bar, 1 ␮m.
regulatory or signaling function instead of direct involvement
of the enzyme in lipid metabolism. Interestingly, LDH1 expression is also induced upon sporulation (6), which is mildly affected in cells deficient in Ldh1p (25). Our data clearly show
that Ldh1p per se is not required for the biogenesis of LDs, but
the severe accumulation of lipids and the corresponding appearance of the giant LDs in ⌬ldh1 mutant cells strongly suggest a role for the enzyme in LD lipid homeostasis.
ACKNOWLEDGMENTS
We thank Elisabeth Becker, Monika Bürger, and Uta Ricken for
technical assistance; Robert Rucktäschel for scientific input; and Wolfgang Girzalsky for reading the manuscript.
This work was supported by the Deutsche Forschungsgemeinschaft
(SFB642 and ER178/4-1).
REFERENCES
1. Altmann, R. 1890. Die Elementarorganisem und ihre Beziehungen zu den
Zellen. Veit, Leipzig, Germany.
2. Baxter, S. M., et al. 2004. Synergistic computational and experimental proteomics approaches for more accurate detection of active serine hydrolases
in yeast. Mol. Cell Proteomics 3:209–225.
3. Beller, M., K. Thiel, P. J. Thul, and H. Jackle. 2010. Lipid droplets: a
dynamic organelle moves into focus. FEBS Lett. 584:2176–2182.
4. Bligh, E. G., and W. J. Dyer. 1959. A rapid method of total lipid extraction
and purification. Can. J. Biochem. Physiol. 37:911–917.
5. Brenner, S. 1988. The molecular evolution of genes and proteins: a tale of
two serines. Nature 334:528–530.
6. Chu, S., et al. 1998. The transcriptional program of sporulation in budding
yeast. Science 282:699–705.
VOL. 10, 2011
INVOLVEMENT OF YEAST HYDROLASE Ldh1p IN LIPID HOMEOSTASIS
7. Czabany, T., K. Athenstaedt, and G. Daum. 2007. Synthesis, storage and
degradation of neutral lipids in yeast. Biochim. Biophys. Acta 1771:299–309.
8. Daum, G., P. C. Bohni, and G. Schatz. 1982. Import of proteins into mitochondria. Cytochrome b2 and cytochrome c peroxidase are located in the
intermembrane space of yeast mitochondria. J. Biol. Chem. 257:13028–
13033.
9. Digel, M., R. Ehehalt, and J. Fullekrug. 2010. Lipid droplets lighting up:
insights from live microscopy. FEBS Lett. 584:2168–2175.
9a. Eddy, S. R. 1998. Profile hidden Markov models. Bioinformatics 14:755–763.
10. Erdmann, R., M. Veenhuis, D. Mertens, and W. H. Kunau. 1989. Isolation of
peroxisome-deficient mutants of Saccharomyces cerevisiae. Proc. Natl. Acad.
Sci. U. S. A. 86:5419–5423.
11. Erdmann, R., et al. 1991. PAS1, a yeast gene required for peroxisome
biogenesis, encodes a member of a novel family of putative ATPases. Cell
64:499–510.
12. Farese, R. V., Jr., and T. C. Walther. 2009. Lipid droplets finally get a little
R-E-S-P-E-C-T. Cell 139:855–860.
13. Fujimoto, T., Y. Ohsaki, J. Cheng, M. Suzuki, and Y. Shinohara. 2008. Lipid
droplets: a classic organelle with new outfits. Histochem. Cell Biol. 130:263–
279.
14. Goodman, J. M. 2008. The gregarious lipid droplet. J. Biol. Chem. 283:
28005–28009.
15. Guo, Y., K. R. Cordes, R. V. Farese, Jr., and T. C. Walther. 2009. Lipid
droplets at a glance. J. Cell Sci. 122:749–752.
16. Hsiang, Y. H., R. Hertzberg, S. Hecht, and L. F. Liu. 1985. Camptothecin
induces protein-linked DNA breaks via mammalian DNA topoisomerase I.
J. Biol. Chem. 260:14873–14878.
17. Imanishi, Y., V. Gerke, and K. Palczewski. 2004. Retinosomes: new insights
into intracellular managing of hydrophobic substances in lipid bodies. J. Cell
Biol. 166:447–453.
18. Ingelmo-Torres, M., et al. 2009. Hydrophobic and basic domains target
proteins to lipid droplets. Traffic 10:1785–1801.
19. Knab, A. M., J. Fertala, and M. A. Bjornsti. 1993. Mechanisms of camptothecin resistance in yeast DNA topoisomerase I mutants. J. Biol. Chem.
268:22322–22330.
20. Knab, A. M., J. Fertala, and M. A. Bjornsti. 1995. A camptothecin-resistant
DNA topoisomerase I mutant exhibits altered sensitivities to other DNA
topoisomerase poisons. J. Biol. Chem. 270:6141–6148.
21. Kohlwein, S. D. 2010. Triacylglycerol homeostasis: insights from yeast.
J. Biol. Chem. 285:15663–15667.
22. Kouker, G., and K. E. Jaeger. 1987. Specific and sensitive plate assay for
bacterial lipases. Appl. Environ. Microbiol. 53:211–213.
781
23. Krahmer, N., Y. Guo, R. V. Farese, Jr., and T. C. Walther. 2009. SnapShot:
lipid droplets. Cell 139:1024–1024.e1021.
24. Listenberger, L. L., and D. A. Brown. 2008. Lipid droplets. Curr. Biol.
18:R237–R238.
25. Marston, A. L., W. H. Tham, H. Shah, and A. Amon. 2004. A genome-wide
screen identifies genes required for centromeric cohesion. Science 303:1367–
1370.
26. Martin, S., and R. G. Parton. 2006. Lipid droplets: a unified view of a
dynamic organelle. Nat. Rev. Mol. Cell Biol. 7:373–378.
27. Mlícková, K., et al. 2004. Lipid accumulation, lipid body formation, and acyl
coenzyme A oxidases of the yeast Yarrowia lipolytica. Appl. Environ. Microbiol. 70:3918–3924.
28. Schrag, J. D., and M. Cygler. 1997. Lipases and alpha/beta hydrolase fold.
Methods Enzymol. 284:85–107.
29. Skinner, J. R., et al. 2009. Diacylglycerol enrichment of endoplasmic reticulum or lipid droplets recruits perilipin 3/TIP47 during lipid storage and
mobilization. J. Biol. Chem. 284:30941–30948.
30. Smith, J. J., et al. 2002. Transcriptome profiling to identify genes involved in
peroxisome assembly and function. J. Cell Biol. 158:259–271.
31. Stobart, A. K., S. Stymne, and S. Höglund. 1986. Safflower microsomes
catalyse oil accumulation in vitro: a model system. Planta 169:33–37.
32. Tauchi-Sato, K., S. Ozeki, T. Houjou, R. Taguchi, and T. Fujimoto. 2002.
The surface of lipid droplets is a phospholipid monolayer with a unique fatty
acid composition. J. Biol. Chem. 277:44507–44512.
33. Thiele, C., and J. Spandl. 2008. Cell biology of lipid droplets. Curr. Opin.
Cell Biol. 20:378–385.
34. Thoms, S., M. O. Debelyy, K. Nau, H. E. Meyer, and R. Erdmann. 2008.
Lpx1p is a peroxisomal lipase required for normal peroxisome morphology.
FEBS J. 275:504–514.
34a.Thoms, S., M. O. Debelyy, M. Connerth, G. Daum, and R. Erdmann. 2011.
The putative Saccharomyces cerevisiae hydrolase Ldh1p is localized to lipid
droplets. Eukaryot. Cell 10:●.
35. Walther, T. C., and R. V. Farese, Jr. 2009. The life of lipid droplets. Biochim.
Biophys. Acta 1791:459–466.
36. Welte, M. A. 2007. Proteins under new management: lipid droplets deliver.
Trends Cell Biol. 17:363–369.
37. Wilson, E. 1896. The cell in development and inheritance. Macmillan, New
York, NY.
38. Zweytick, D., K. Athenstaedt, and G. Daum. 2000. Intracellular lipid particles
of eukaryotic cells. Biochim. Biophys. Acta 1469:101–120.
CHAPTER 3. DISCUSSION_________________________________________________ 77
CHAPTER 3. DISCUSSION
The novel hydrolases and peroxisome related ubiquitin-specific protease of yeast
S. cerevisiae are characterized in this chapter. Lpx1p and Ldh1p are hydrolases of
peroxisome and lipid droplets, respectively. Ubp15p is a peroxisome related
deubiquitinating enzyme. Triacylglycerol lipase and hydrolase activities were shown for
both recombinant proteins Lpx1p and Ldh1p as well as oligoubiqutin-hydrolase and
Ub-Pex5p deubiquitinating activities were shown for recombinant Ubp15p in vitro. It is
demonstrated that the Lpx1p protein is not required for wild-type-like steady-state
function of peroxisomes and that Δlpx1 mutants have an aberrant morphology
characterized by intraperoxisomal vesicles or invaginations. Morover, Ldh1p is not
required for the function and biogenesis of peroxisomes, but is essential for the
maintenance of a steady-state level of the nonpolar and polar lipids of lipid droplets. In
line with this finding, the Δldh1 strain is characterized by appearance of giant lipid
droplets and an excessive accumulation of nonpolar lipids and phospholipids upon
growth on medium containing oleic acid as a sole carbon source.
It is demonstrated that the peroxisomal AAA-complex contains Pex5p dislocase
and Ub-Pex5p deubiquitinating activites and that Ubp15p is a novel constituent of this
complex. Δubp15 mutant is characterized as a strain which has a stress related PTS1import defect.
3.1
Novel hydrolases of yeast S. cerevisiae
Lpx1p as well as Ldh1p, a novel hydrolase of S. cerevisiae (35, 209), comprises the typical
GXSXG-type lipase motif of members of the α/β-hydrolase family (189). LPX1 is one of the
most strongly induced genes following a shift from glucose to oleate, as determined by serial
analysis of gene expression (SAGE) experiments (103). The oleate-induced increase in
mRNA abundance is abolished in the Δpip2 Δoaf1 double deletion strain, indicating that its
induction is dependent on the transcription factor pair Pip2p and Oaf1p (103). It was shown
by use of an antibody raised against Lpx1p that this protein itself is induced by oleic acid
(210). Besides, it was determined, by using a Protein A tag, that Lpx1p protein is strongly
induced by oleic acid (196). Moderate induction by oleic acid was also demonstrated for
Ldh1p protein (196).
CHAPTER 3. DISCUSSION_________________________________________________ 78
Both proteins Lpx1p as well as Ldh1p carry a putative peroxisomal targeting signal
type-1 (PTS1) (126) and can be aligned with two regions of homology by WUBLAST-2
search (134) (Fig. 3.1.1).
Fig. 3.1.1 Ldh1p and Lpx1p from S. cerevisiae are similar proteins with a α/βhydrolase/lipase motif. Alignment of the two regions of homology of Lpx1p and Ldh1p
exhibiting 28% (region A) and 27% (region B) amino acid identities. The GXSXG
hydrolase/lipase motif is underlined; similar amino acids are indicated by a plus symbol.
Taken with modifications from (209).
Lpx1p does not conform with its QKL motife to the general PTS1 consensus. Three
other proteins with an QKL on their extreme C-terminus are known in S. cerevisiae, which
are probably not peroxisomal: Efb1p (systematic name: Yal003wp) is the elongation factor
EF-1b (82), Rpt4p (Yor259cp) is a mostly nuclear 19S proteasome cap AAA protein (149),
and Tea1p (Yor337wp) is a nuclear Ty1 enhancer activator (70). However, QKL is sufficient
to sponsor Pex5p binding (124). Why are these QKL proteins not imported into peroxisomes?
This is probably due to the upstream sequences. Lpx1p has a lysine at position -1 (relative to
the PTS1 tripeptide) and a hydrophobic amino acid at position -5. These features promote
Pex5p binding and are not found in the other three QKL proteins (124).
Ldh1p contains the consensus sequence for a classical peroxisomal targeting signal
type-1 (PTS1), but the protein is primarily targeted to lipid droplets and not to peroxisomes.
Peroxisomal exclusion of Ldh1p is likely due to the upstream sequences with charged amino
acids in positions - 2 and - 5. These positions are adverse to Pex5p binding and peroxisomal
localization, for which polar/hydrophilic or positively charged amino acids in position - 2 are
preferred. The negatively charged amino acid is not even counteracted by neighbouring amino
acids, giving the likely explanation for dominating peroxisomal exclusion. The classical
PTS1, SKL, is not completely sufficient to target protein to peroxisomes if the upstream
sequences are not supportive. It was shown that the majority of Ldh1p is a lipid droplets
protein that is targeted independently of the PTS1-binding Pex5p.
CHAPTER 3. DISCUSSION_________________________________________________ 79
Moreover, it was shown by applying a PTS1 prediction algorithm
(http://mendel.imp.ac.at/pts1/) (156, 157), which predicted peroxisomal localization, that only
Lpx1p but not Ldh1p as well as Efb1p, Rpt4p, and Tea1p, is localized in peroxisome.
It was shown dimerization of Lpx1p in the context of piggyback protein import into
peroxisomes (210). Self-interaction (dimerization) is frequently found in regulation of the
enzymatic activity of other lipases such as Candida rugosa lipase or human lipoprotein lipase
(63, 164).
Lipid droplets localization signals are only poorly characterized. It has been suggested
that lipid droplets localization signals are constituted of hydrophobic residues at the Cterminus of a protein (154, 237). A Kyte-Doolittle plot of Ldh1p indicated a region with
particularly high hydrophobicity from amino acids 130 to 154. This stretch might be required
to target and/or to attach Ldh1p to lipid droplets. Indeed, it was shown that lipid droplets
targeting are not abrogated when GFP is added to the C-terminus or the N-terminus of Ldh1p.
Thus, targeting information within central parts of Ldh1p, rather than at its termini, is
sufficient for the lipid droplets localization. Interestingly, the Lpx1p stretch of high
hydrophobicity is in a similar location in the primary sequence, namely, at amino acids 154 to
177 (210). The hydrophobic stretches in Ldh1p are likely not classical transmembrane
domains, because lipid droplets are bound by a single monolayer membrane of phospholipids.
Extended localization studies of Ldh1p-GFP showed that at least a portion of the polypeptide
is targeted to peroxisomes and mitochondria. While this triple localization may reflect the true
cellular scenario, it has to be taken into account that partial targeting of Ldh1p to peroxisomes
and mitochondria may be due to the overexpression of Ldh1p-GFP.
The putative active-site serine of Lpx1p is located next to the region of highest
hydropathy, suggesting that Lpx1p is a membrane-active lipase that contributes to metabolism
or the membrane shaping of peroxisomes. Peroxisomes are sites of lipid metabolism (223). It
is thus not surprising to find a lipase associated with peroxisomes. It was demonstrated that
Lpx1p has triacylglycerol lipase activity; however, activities towards the artificial test
substrates DPG (1,2-dioleoyl-3-(pyren-1-yl) decanoyl-rac-glycerol) and DGR (1,2-O-dilaurylrac-glycero-3-glutaric acid (6-methyl resorufin) ester) were low (210). The evidence for
phospholipase A activity of the enzyme (substrate: 1,2-bis-(4,4-difluoro-5,7-dimethyl-4-bora3a,4a-diaza-sindacene-3-undecanoyl)-sn-glycero-3-phosphocholine),
together
with
the
electron microscopy phenotype, suggest that Lpx1p has a more specialized role in modifying
membrane
phospholipids
(210).
A
mammalian
group
VIB
calcium-independent
phospholipase A2 (iPLA2c) was identified that possesses a PTS1 SKL and a mitochondrial
CHAPTER 3. DISCUSSION_________________________________________________ 80
targeting signal (140, 234). The enzyme is localized in peroxisomes and mitochondria, and is
involved, among others, in arachidonic acid and cardiolipin metabolism (139, 155). Knockout
mice of iPLA2c show mitochondrial ⁄ cardiac phenotypes (141). It will be exciting to
determine whether human iPLA2c and yeast Lpx1p are functionally related. It was shown that
peroxisomes are still functional in the absence of LPX1. This suggests a non-essential
metabolic role for Lpx1p in peroxisome function (210). The morphological defect found in
electron microscopic images of a deletion of Lpx1p (peroxisomes containing inclusions or
invaginations) is symptomatic of a yeast peroxisomal mutant, and is reminiscent of the
phenotypes found in human peroxisomal disorders (56, 151). All these data suggest that
Lpx1p is required to determine the shape of peroxisomes (210).
Lipase activity and cellular function of Lpx1p could be involved in various processes:
(a) detoxification and stress response, (b) lipid mobilization, or (c) peroxisome biogenesis. As
Lpx1p expression may be regulated by Yrm1p and Yrr1p (135), a transcription factor pair that
mediates pleiotropic drug resistance effects, it was speculated that Lpx1p is required for a
multidrug resistance response (210). The epoxide hydrolase activity for Lpx1p was, however,
excluded because hydrolysis of the epoxide hydrolase test substrate was not affected by a
specific epoxide hydrolase inhibitor (210).
It was demonstrated that recombinant Ldh1p exerts an esterase and triacylglycerol
lipase activities. The enzyme activity was abolished upon mutation of the conserved GXSXGtype lipase motif of the protein. The S. cerevisiae Δldh1 strain is characterized by the
appearance of giant lipid droplets and the accumulation of nonpolar lipids and phospholipids
in lipid droplets, indicative of a role of Ldh1p in maintaining lipid homeostasis (35). Ldh1p is
a hydrolytically active serine hydrolase with a classical catalytic triad containing a serine
(GXSXG motif). A conserved histidine was revealed by profile hidden Markov models (40),
and the aspartate of the probable triad was derived from an alignment with canine gastric
triacylglycerol lipase (209). The putative active-site serine of Ldh1p is located next to the
regions of highest hydrophobicity, suggesting that Ldh1p is a membrane-active hydrolase. It
was demonstrated that the hydrolase activity of Ldh1p could be completely abolished by the
replacement of the active-site serine by alanine. Fluorescence microscopy analysis indicated
that Ldh1p targets to the boundary of the lipid droplets monolayer membrane, supporting the
idea that Ldh1p is involved in metabolic processes.
Taken together, these features characterize Ldh1p as an active lipid droplets hydrolase.
Mutation of the active site of Ldh1p does not lead to protein mislocalization, indicating that
the lipase active site of Ldh1p is not involved in lipid droplets targeting.
CHAPTER 3. DISCUSSION_________________________________________________ 81
Cells deficient in Ldh1p are characterized by giant lipid droplets accompanied by the
accumulation of nonpolar lipids and phospholipids. Thus, Ldh1p seems to be required for the
mobilization of lipid droplets-stored lipids, which would also explain the dependency of the
Ldh1p function on its hydrolase activity. It was speculated that Ldh1p plays a role in
maintaining lipid homeostasis by regulating both phospholipid and nonpolar lipid levels (35).
Interestingly, the Δldh1 (Δybr204c) strain has been reported to exhibit resistance to the
lipophilic drug camptothecin (89, 110, 111). Camptothecin is a cytotoxic quinoline alkaloid
that inhibits the DNA enzyme topoisomerase I. The resistance to camptothecin might be
explained by increased detoxification properties of lipid droplets with an excessive amount of
nonpolar lipids, which may serve as a reservoir for hydrophobic toxic molecules (15, 32, 112,
221).
Global genomic screening research recently disclosed the transient induction of LDH1
by growth on oleate medium (196). It was shown that the level of Ldh1p increased within the
first 3 h of induction, followed by a decrease within the subsequent 6 h and complete
reduction to basal levels within the next 17 h. Such an expression profile might hint at a
regulatory or signalling function instead of direct involvement of the enzyme in lipid
metabolism.
Interestingly, LDH1 expression is also induced upon sporulation (29), which is mildly
affected in cells deficient in Ldh1p (142). The data clearly show that Ldh1p per se is not
required for the biogenesis of lipid droplets, but the severe accumulation of lipids and the
corresponding appearance of the giant LDs in Δldh1 mutant cells strongly suggest a role for
the enzyme in lipid droplets lipid homeostasis (35).
While Lpx1p was shown to be a peroxisomal enzyme, subcellular localization studies
revealed that Ldh1p is predominantly localized to lipid droplets. It was shown that Lpx1p
import is dependent on the PTS1 receptor Pex5p. Moreover, it was shown that Lpx1p is
piggyback-transported into peroxisomes. But it was demonstrated that targeting of Ldh1p to
lipid droplets occurs independently of the PTS1 receptor Pex5p. Triacylglycerol lipase as well
as hydrolase activities were shown for both recombinant proteins Lpx1p and Ldh1p in vitro. It
was shown that the Lpx1p protein is not required for wild-type-like steadystate function of
peroxisomes, which might be indicative of a metabolic rather than a biogenetic role. It was
clearly shown that peroxisomes in Δlpx1 mutants have an aberrant morphology characterized
by intraperoxisomal vesicles or invaginations.
It was demonstrated that Ldh1p is not required for the function and biogenesis of
peroxisomes. Ldh1p is required for the maintenance of a steady-state level of the nonpolar
CHAPTER 3. DISCUSSION_________________________________________________ 82
and polar lipids of lipid droplets. A characteristic feature of the Δldh1 strain is the appearance
of giant lipid droplets and an excessive accumulation of nonpolar lipids and phospholipids
upon growth on medium containing oleic acid as a sole carbon source. Ldh1p is thought to
play a role in maintaining the lipid homeostasis in yeast by regulating both phospholipid and
nonpolar lipid levels.
Ldh1p hydrolase and the Lpx1p lipase are not redundant proteins; other enzymes,
probably with somewhat lower homology, cannot compensate for a defect in the two
enzymes. Both peroxisomes and lipid droplets function in concert in lipid metabolism. Lipid
droplets require the action of triacylglycerol lipases to metabolize nonpolar lipids, while
peroxisomes represent the sole cellular site for fatty acid oxidation. It is thus possible that the
peroxisomal Lpx1p and the lipid droplets Ldh1p play a physiological role in lipid metabolism
by mobilizing fatty acids and channeling them to their site of degradation. Lipid droplets, as
fatty acid depot organelles, can be the storage sites for nonpolar lipids that are further
metabolized in peroxisomes. For this reason, and not surprisingly, LDs have been found in
proximity to peroxisomes in different organisms (14, 78, 187). It was also shown that S.
cerevisiae peroxisomes attach to lipid droplets or even project into lipid droplets, which was
interpreted as an intimate interaction between the two compartments (18). Ldh1p and Lpx1p
shows that beyond a metabolic collaboration, peroxisomes and lipid droplets may be equipped
with similar hydrolases (209).
3.2
Ubp15p, a novel compound of AAA-complex
It was proposed, at least for Pex1p, that it can fulfil its function by unfoldase activity,
using its N-terminal putative adaptor-binding domain (193).
So far, it is possible only speculate, that both AAA peroxins, Pex1p and Pex6p are
highly substrate specific unfoldases/foldase (chaperons), enzymes that unfold/fold protein
substrate in ATP-hydrolysis dependent manner. In this case, ubiquitinated Pex5p could be a
substrate for such activity. On the first step of the Ub-Pex5p release from the peroxisome it
could be unfolded by one of AAA peroxin, probably by Pex6p. On the next step, Pex5p could
be folded by second AAA peroxin Pex1p, with the following release of Pex5p to the cytosol.
Such hypothesis could explain a requirement of two AAA ATPases, instead of just one.
It was recently shown that the AAA-complex is responsible for receptor
deubiquitination, which is supposed to be an important step in receptor recycling (34).
CHAPTER 3. DISCUSSION_________________________________________________ 83
It was shown that yeast S. cerevisiae has 19 deubiquitinating enzymes (DUB) (Table
3.2.1). All of them have catalytic regions with three evolutionary conserved amino acids:
cysteine, hystedine and tryptophan (Fig 3.2.1).
Fig. 3.2.1 Highest homology region of S. cerevisiae deubiquitinating enzymes. Moderately
conserved residues are shaded in grey whereas the conserved histidine (H) and tryptophan
(D), two aminoacids of the catalytic triad CHD, as well as highly conserved tyrosine (Y) are
highlighted in black. ClustalW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/) algorithm was
used for yeast S. cerevisiae DUBs alignment.
The corresponding deubiquitinating enzymes (DUB) Ubp15p was identified as a novel factor
that accompanies the AAA-complex in peroxisomal protein import (34). It was demonstrated
that Ubp15p share common features conserved among other UBP members (90) (Fig 3.2.2).
All members of the ubiquitin-specific processing protease family (UBP) of deubiquitinating
enzymes (DUB) share strong homology in the Cys and His Boxes. The Cys Box contains the
catalytic cysteine residue, which is thought to undergo deprotonation and to unleash a
nucleophilic attack on the carbonyl carbon atom of the ubiquitin Gly76 at the scissile peptide
bond. In analogy with other cysteine proteases, the deprotonation of this cysteine residue most
likely is assisted by an adjacent His residue, which, in turn, is stabilized by a nearby side
chain from an Asn or Asp residue. Together, these three residues constitute the so-called
catalytic triad (90). Previous mutagenesis studies on several UBPs have provided evidence
that these residues have critical roles in catalysis (9, 61, 90, 91).
PolyUb-Pex5p (106, 171) as well as monoUb-Pex5p (71, 116) are solely found at the
peroxisomal membrane fraction in wild-type yeast and rat liver cells, indicating that Pex5p
ubiquitination exclusively takes place at the peroxisomal membrane.
Interestingly, exported Pex5p appears to be unmodified, indicating that the Ub-moiety
is removed during or directly after receptor export (27, 116, 169). However, published data on
the deubiquitination of Pex5p so far have focused on in vitro assays with mammalian Pex5p.
CHAPTER 3. DISCUSSION_________________________________________________ 84
Table 3.2.1 Deubiquitinating enzymes of yeast Saccharomyces cerevisiae
DUB
1
Ubp1p
2
Ubp2p
3
Ubp3p
4
Doa4p
5
Ubp5p
6
Ubp6p
7
Ubp7p
8
Ubp8p
9
Ubp9p
10
Ubp10p
11
Ubp11p
12
Ubp12p
13
Ubp13p
14
Ubp14p
15
Ubp15p
16
Ubp16p
17
Yuh1p
18
Otu1p
19
Rpn11p
Description
Cellular component
Ubiquitin-specific protease that removes ubiquitin from
ubiquitinated proteins; cleaves at the C terminus of ubiquitin
fusions irrespective of their size; capable of cleaving
polyubiquitin chains.
Ubiquitin-specific protease that removes ubiquitin from
ubiquitinated proteins; interacts with Rsp5p and is required for
MVB sorting of membrane proteins; can cleave polyubiquitin
and has isopeptidase activity.
Ubiquitin-specific protease that interacts with Bre5p to coregulate anterograde and retrograde transport between the ER
and Golgi; inhibitor of gene silencing; cleaves ubiquitin fusions
but not polyubiquitin; also has mRNA binding activity.
Ubiquitin isopeptidase, required for recycling ubiquitin from
proteasome-bound ubiquitinated intermediates, acts at the late
endosome/prevacuolar compartment to recover ubiquitin from
ubiquitinated membrane proteins en route to the vacuole.
cytoplasm,
endoplasmic reticulum
(1, 4, 12, 23, 34, 77,
109, 115, 125, 130,
133, 214)
cytoplasm
(12, 23, 122, 125)
cytoplasm
(12, 30, 31, 148)
endosome, membrane
fraction, proteasome
complex,
mitochondrion
(1, 3, 5, 6, 109, 161,
162, 174, 202)
Putative ubiquitin-specific protease, closest paralog of Doa4p but
has no functional overlap; concentrates at the bud neck.
cellular bud neck,
incipient cellular bud
site
proteasome complex,
proteasome regulatory
particle
(3, 5, 115, 161)
cytoplasm
(5, 83)
Ubiquitin-specific protease that is a component of the SAGA
(Spt-Ada-Gcn5-Acetyltransferase) acetylation complex; required
for SAGA-mediated deubiquitination of histone H2B.
Ubiquitin carboxyl-terminal hydrolase, ubiquitin-specific
protease that cleaves ubiquitin-protein fusions.
DUBm complex,
SAGA complex, SLIK
(SAGA-like) complex
cytoplasm
(5, 79, 83)
Ubiquitin-specific protease that deubiquitinates ubiquitin-protein
moieties; may regulate silencing by acting on Sir4p; involved in
posttranscriptionally regulating Gap1p and possibly other
transporters; primarily located in the nucleus.
Ubiquitin-specific protease that cleaves ubiquitin from
ubiquitinated proteins.
nucleus
(5, 101, 102, 194)
UNKNOWN
(5, 125)
Ubiquitin carboxyl-terminal hydrolase, ubiquitin-specific
protease present in the nucleus and cytoplasm that cleaves
ubiquitin from ubiquitinated proteins.
Putative ubiquitin carboxyl-terminal hydrolase, ubiquitin-specific
protease that cleaves ubiquitin-protein fusions.
cytoplasm, nucleus
(5, 23, 92)
UNKNOWN
(5, 77, 83)
Ubiquitin-specific protease that specifically disassembles
unanchored ubiquitin chains; involved in fructose-1,6bisphosphatase (Fbp1p) degradation; similar to human
isopeptidase T.
Ubiquitin-specific protease that may play a role in ubiquitin
precursor processing.
cytoplasm
(1, 4, 130)
cytoplasm, peroxisome
(1, 23, 34, 115, 133)
Deubiquitinating enzyme anchored to the outer mitochondrial
membrane, probably not important for general mitochondrial
functioning, but may perform a more specialized function at
mitochondria.
Ubiquitin C-terminal hydrolase that cleaves ubiquitin-protein
fusions to generate monomeric ubiquitin; hydrolyzes the peptide
bond at the C-terminus of ubiquitin; also the major processing
enzyme for the ubiquitin-like protein Rub1p.
Deubiquitylation enzyme that binds to the chaperone-ATPase
Cdc48p; may contribute to regulation of protein degradation by
deubiquitylating substrates that have been ubiquitylated by
Ufd2p; member of the Ovarian Tumor (OTU) family.
Metalloprotease subunit of the 19S regulatory particle of the 26S
proteasome lid; couples the deubiquitination and degradation of
proteasome substrates; involved, independent of catalytic
activity, in fission of mitochondria and peroxisomes.
cytoplasm,
mitochondrial outer
membrane
(109, 133)
cytoplasm
(12, 23, 125, 131, 182,
214)
cytoplasm, nucleus
(22, 59, 98, 137, 181)
cytosol, mitochondrion,
nucleus, proteasome
regulatory particle,
lid subcomplex,
proteasome storage
granule
(16, 74, 85, 220, 235)
Ubiquitin-specific protease situated in the base subcomplex of
the 26S proteasome, releases free ubiquitin from branched
polyubiquitin chains; works in opposition to Hul5p polyubiquitin
elongation activity; mutant has aneuploidy tolerance.
Ubiquitin-specific protease that cleaves ubiquitin-protein fusions.
References
(1, 23, 74)
(77, 115)
CHAPTER 3. DISCUSSION_________________________________________________ 85
Fig 3.2.2 Sequence alignment of Ubp15p with six representative UBP family proteins
Conserved residues are shaded in yellow whereas the catalytic triad is highlighted in red.
Residues that are involved in direct inter-molecular hydrogen bond interactions using their
side chains and main chains are marked with purple and green arrows, respectively. Residues
that are involved in van der Waals contact with ubiquitin aldehyde (Ubal) are labelled with
blue squares. Residues that coordinate the oxyanion through hydrogen bonds are identified
with blue triangles above the alignment. The secondary structural elements above the
sequences are indicated for the free HAUSP (lower) and the ubiquitin-bound HAUSP (upper),
respectively. Taken with modifications from (90).
CHAPTER 3. DISCUSSION_________________________________________________ 86
Soluble monoUb-Pex5p is formed when the in vitro export reaction is performed in
presence of DUB inhibitors (27, 71).
Accordingly, it was concluded that deubiquitination of Pex5p occurs predominantly in
the cytosol after release from the membrane. It also was suggested that a small fraction of the
dislocated Ub-Pex5p in vitro can already be deubiquitinated by reducing reagents like
glutathione, while most of the Ub-Pex5p is deubiquitinated via an enzymatic pathway (71).
Cleavage of the Ub-moiety from mammalian Pex5p was originally thought to be
catalyzed by an unspecific reaction that could be carried out by any DUB in the cytosol or
may even function via a non-enzymatic reaction (71). Later it was shown that
deubiquitination of yeast Pex5p represents a specific and important event for the optimal
functionality of the export machinery (34). Ubp15p has been identified as deubiquitinating
enzyme that is dedicated for this deubiquitination event in baker’s yeast. The deubiquitinating
activity found to be associated with the endogenous AAA-complex was the first indication for
the presence of such an enzyme. Mass spectrometry analysis of the AAA-complex derived
from endogenous proteins as well as overexpressed Pex6p revealed a stable association of
Ubp15p. The interaction with Pex6p was confirmed by yeast two-hybrid analysis and the
interaction site could be mapped to the D1 domain of Pex6p. While the evolutionarily related
AAA-protein Cdc48p (p97/VCP) utilizes several co-factors (98), Ubp15p is only the second
known co-factor that accompanies the function of Pex6p, with its membrane-anchor Pex15p
(Pex26p in mammals) being the first one (20).
Pex6p acts in concert with Pex1p as dislocase complex for the ubiquitinated Pex5p in
order to facilitate the export of the PTS1-receptor back to the cytosol (150, 172). This leads to
the intriguing question, how the activity of the deubiquitinating enzyme Ubp15p is
coordinated with the Ub-dependent dislocation of Pex5p from the membrane and release into
the cytosol. The finding that the deletion of UBP15 does not result in a complete peroxisomal
biogenesis defect, can either be explained by the model that deubiquitination has only
modulating activity or it may indicate the existence of additional factors which may
accompany the AAA-complex in its function. This situation could well be explained by
redundant DUBs acting on Ub-Pex5p.
Possible candidates are the known Ubp15p-binding partners Ubp14p and Doa4p
(Ubp4p) (4, 120). However, the characterization of the single deletion strains suggested that
these two DUBs do not have a peroxisome-specific function similar to Ubp15p. The single
deletion strain of Ubp14p had no significant effect on peroxisome morphology or cargo
import, both under oleate as well as under H2O2 stress conditions. Previous studies have
CHAPTER 3. DISCUSSION_________________________________________________ 87
suggested a role for Ubp14p in the disassembly of unanchored polyubiquitin chains (4). The
deletion of Doa4p had an effect on the efficiency of peroxisomal cargo import. However, it
has to be taken into account that the deletion of Doa4p is known to result in pleiotropic effects
on many Ub-dependent processes in the cell, as Doa4p influences the homeostasis of free
ubiquitin (202). Possibly related to this function, DOA4 is a stress regulated gene, giving an
alternative explanation for the oleate induction reported by (197). Thus, although it is not
possible to fully exclude that Doa4p exhibits a peroxisome-related overlapping function with
Ubp15p, the partial import defect observed for the Δdoa4 strain might well be explained by
the pleiotropic phenotype of this mutant.
The observation that Δubp15 cells contain more clustered peroxisomes than wild-type
cells is puzzling. Earlier work correlated a reduced level of imported matrix proteins such as
catalase and the occurrence of clustered peroxisomes (238). Slowing of Pex5p cycling is most
likely associated with reduced import rates. Interestingly, induction of oxidative stress by
treating cells with hydrogen peroxide causes Pex5p to amass on the organelle membrane and
significantly reduces PTS1 protein import (127, 165, 206). As data are clear in that Ubp15p
can deubiquitinate Pex5p and as the ubiquitination status of the PTS1-receptor directly
influences its cycling (27, 169), it is conceivable that the deletion of Ubp15p influences the
import process of PTS1-proteins like catalase and thus possibly also morphology and
clustering of peroxisomes. Although Ubp15p is not essential for peroxisomal biogenesis
under normal conditions, its regulative function gains significantly more weight when the
cells are stressed with H2O2 and require an efficient import of matrix proteins into
peroxisomes. Thus, the findings that 1) Ubp15p is stably associated with the export
machinery by interacting with Pex6p, 2) the fact that a small portion of the protein is
associated with peroxisomes, and 3) the partial protein import defect for PTS1 proteins
observed in Δubp15 cells upon oxidative stress suggest that the deubiquitination, at least in
baker’s yeast, is not an unspecific event that takes place at any location in the cytosol, as
suggested by the mammalian study (71), but supports the notion that the detachment of the
Ub-moiety is a regulated event.
Ubiquitination of the receptor is a precondition for its export (27, 169). In this respect,
it is likely that the Pex1p/Pex6p-complex recognizes the Ub-moiety. This, however, still
needs to be shown. The in vitro data demonstrate that the exported import receptor is
deubiquitinated. This reflects the in vivo situation which is clear in that the cytosolic receptor
is not ubiquitinated. Thus, the accumulating evidence indicates that the ubiquitin moiety is
cleaved off from the import receptor during or shortly after export.
CHAPTER 3. DISCUSSION_________________________________________________ 88
There are several possible advantages to favour a peroxisome-associated
deubiquitination of Ub-Pex5p. This could protect Pex5p from unspecific ubiquitination by
detaching Ub-moieties from lysine residues or preventing the formation of a poly-ubiquitin
chain at the crucial cysteine residue dedicated to mono-ubiquitination (Fig 3.2.3). This
function would ensure an optimal protection and presentation of monoUb-Pex5p to the export
machinery
Fig 3.2.3 The PTS1-receptor cycle. Hypothetical model describes a possible function of
Ubp15p in Pex5p cycle. Ubp15p can protect Pex5p from unspecific polyubiquitination by
ubiquitin-conjugating enzyme (E2) Ubc4p. Such activity of Ubp15p can prevent Pex5p
proteasomal degradation and save it for the next round of recetor cycle. Red colored arrows
show direction of the Pex5p cycle with participation of Ubp15p; blue colored arrow show
direction of the Pex5p cycle without participation of Ubp15p. DUB, unknown
deubiquitinating enzyme; P, proteasome; Ub, ubiquitin.
Another possible explanation might be that the deubiquitination step may trigger the
efficient release of Pex5p from the export-machinery by cleavage of the complex-bound Ubmoiety. Furthermore, this mechanism could prevent the monoUb-Pex5p to be recognized by
the proteasome system to ensure an efficient recycling of the receptor for new matrix protein
import cycles.
The finding that both ubiquitinating and deubiquitinating activities are required for the
transport of proteins from a membrane to the cytosol finds an examples in the ERAD
CHAPTER 3. DISCUSSION_________________________________________________ 89
pathway. The AAA-type ATPase p97 (Cdc48/VCP) is evolutionary related to the peroxisomal
AAA-proteins Pex1p and Pex6p (58). Most interestingly, among the growing number of
known co-factors and adaptor proteins that p97 utilizes to carry out its different functions are
also several deubiquitinating enzymes (98). The mammalian deubiquitinating enzymes YOD1
and Ataxin-3 are p97-associated proteins and function in the ERAD pathway (39, 45, 224).
Most of the published literature defines both DUBs as a positive regulator of the p97driven dislocation of the ERAD-substrates, most likely by editing the poly-Ub chains on the
substrates themselves in order to ensure the best fit to downstream Ub-receptor proteins.
Ubp15p acts in concert with the AAA-peroxins in the matrix protein import cycle of
the PTS1-receptor. Pex5p deubiquitination occurs as a highly specific event in yeast and
removal of ubiquitin of the PTS1-receptor Pex5p turns out to be a vital step in the receptor
cycle in its own right. Thus, removal of the ubiquitin seems to complete the receptor cycle of
Pex5p in order to make the receptor available for another round of matrix protein import.
CHAPTER 4. REFERENCES________________________________________________ 90
CHAPTER 4. REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Aguilar-Henonin, L., J. Bravo, and P. Guzman. 2006. Genetic interactions of a
putative Arabidopsis thaliana ubiquitin-ligase with components of the Saccharomyces
cerevisiae ubiquitination machinery. Curr Genet 50:257-268.
Altmann, R. 1890. Die Elementarorganisem und ihre Beziehungen zu den Zellen.
Leipzig: Veit.
Amerik, A., N. Sindhi, and M. Hochstrasser. 2006. A conserved late endosometargeting signal required for Doa4 deubiquitylating enzyme function. J Cell Biol
175:825-835.
Amerik, A., S. Swaminathan, B. A. Krantz, K. D. Wilkinson, and M.
Hochstrasser. 1997. In vivo disassembly of free polyubiquitin chains by yeast Ubp14
modulates rates of protein degradation by the proteasome. Embo J 16:4826-4838.
Amerik, A. Y., S. J. Li, and M. Hochstrasser. 2000. Analysis of the deubiquitinating
enzymes of the yeast Saccharomyces cerevisiae. Biol Chem 381:981-992.
Amerik, A. Y., J. Nowak, S. Swaminathan, and M. Hochstrasser. 2000. The Doa4
deubiquitinating enzyme is functionally linked to the vacuolar protein-sorting and
endocytic pathways. Mol Biol Cell 11:3365-3380.
Arlt, H., R. Tauer, H. Feldmann, W. Neupert, and T. Langer. 1996. The YTA1012 complex, an AAA protease with chaperone-like activity in the inner membrane of
mitochondria. Cell 85:875-885.
Athenstaedt, K., and G. Daum. 2006. The life cycle of neutral lipids: synthesis,
storage and degradation. Cell Mol Life Sci 63:1355-1369.
Baek, K. H., M. A. Mondoux, R. Jaster, E. Fire-Levin, and A. D. D'Andrea. 2001.
DUB-2A, a new member of the DUB subfamily of hematopoietic deubiquitinating
enzymes. Blood 98:636-642.
Baerends, R. J., S. W. Rasmussen, R. E. Hilbrands, M. van der Heide, K. N.
Faber, P. T. Reuvekamp, J. A. Kiel, J. M. Cregg, I. J. van der Klei, and M.
Veenhuis. 1996. The Hansenula polymorpha PER9 gene encodes a peroxisomal
membrane protein essential for peroxisome assembly and integrity. J Biol Chem
271:8887-8894.
Baker, A., and I. A. Sparkes. 2005. Peroxisome protein import: some answers, more
questions. Curr Opin Plant Biol 8:640-647.
Baker, R. T., J. W. Tobias, and A. Varshavsky. 1992. Ubiquitin-specific proteases
of Saccharomyces cerevisiae. Cloning of UBP2 and UBP3, and functional analysis of
the UBP gene family. J Biol Chem 267:23364-23375.
Bartz, R., W. H. Li, B. Venables, J. K. Zehmer, M. R. Roth, R. Welti, R. G.
Anderson, P. Liu, and K. D. Chapman. 2007. Lipidomics reveals that adiposomes
store ether lipids and mediate phospholipid traffic. J Lipid Res 48:837-847.
Bascom, R. A., H. Chan, and R. A. Rachubinski. 2003. Peroxisome biogenesis
occurs in an unsynchronized manner in close association with the endoplasmic
reticulum in temperature-sensitive Yarrowia lipolytica Pex3p mutants. Mol Biol Cell
14:939-957.
Beller, M., K. Thiel, P. J. Thul, and H. Jackle. 2010. Lipid droplets: a dynamic
organelle moves into focus. FEBS Lett 584:2176-2182.
Berndt, C., D. Bech-Otschir, W. Dubiel, and M. Seeger. 2002. Ubiquitin system:
JAMMing in the name of the lid. Curr Biol 12:R815-817.
Biardi, L., and S. K. Krisans. 1996. Compartmentalization of cholesterol
biosynthesis. Conversion of mevalonate to farnesyl diphosphate occurs in the
peroxisomes. J Biol Chem 271:1784-1788.
CHAPTER 4. REFERENCES________________________________________________ 91
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
Binns, D., T. Januszewski, Y. Chen, J. Hill, V. S. Markin, Y. Zhao, C. Gilpin, K.
D. Chapman, R. G. Anderson, and J. M. Goodman. 2006. An intimate
collaboration between peroxisomes and lipid bodies. J Cell Biol 173:719-731.
Birschmann, I., K. Rosenkranz, R. Erdmann, and W. H. Kunau. 2005. Structural
and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p. Febs
J 272:47-58.
Birschmann, I., A. K. Stroobants, M. van den Berg, A. Schafer, K. Rosenkranz,
W. H. Kunau, and H. F. Tabak. 2003. Pex15p of Saccharomyces cerevisiae provides
a molecular basis for recruitment of the AAA peroxin Pex6p to peroxisomal
membranes. Mol Biol Cell 14:2226-2236.
Blanchette-Mackie, E. J., N. K. Dwyer, T. Barber, R. A. Coxey, T. Takeda, C. M.
Rondinone, J. L. Theodorakis, A. S. Greenberg, and C. Londos. 1995. Perilipin is
located on the surface layer of intracellular lipid droplets in adipocytes. J Lipid Res
36:1211-1226.
Bohm, S., D. Frishman, and H. W. Mewes. 1997. Variations of the C2H2 zinc finger
motif in the yeast genome and classification of yeast zinc finger proteins. Nucleic
Acids Res 25:2464-2469.
Borodovsky, A., B. M. Kessler, R. Casagrande, H. S. Overkleeft, K. D. Wilkinson,
and H. L. Ploegh. 2001. A novel active site-directed probe specific for
deubiquitylating enzymes reveals proteasome association of USP14. Embo J 20:51875196.
Borst, P. 1989. Peroxisome biogenesis revisited. Biochim Biophys Acta 1008:1-13.
Brown, L. A., and A. Baker. 2003. Peroxisome biogenesis and the role of protein
import. J Cell Mol Med 7:388-400.
Brown, L. A., and A. Baker. 2008. Shuttles and cycles: transport of proteins into the
peroxisome matrix (review). Mol Membr Biol 25:363-375.
Carvalho, A. F., M. P. Pinto, C. P. Grou, I. S. Alencastre, M. Fransen, C. SaMiranda, and J. E. Azevedo. 2007. Ubiquitination of mammalian Pex5p, the
peroxisomal import receptor. J Biol Chem 282:31267-31272.
Chapman, K. D., and R. N. Trelease. 1991. Acquisition of membrane lipids by
differentiating glyoxysomes: role of lipid bodies. J Cell Biol 115:995-1007.
Chu, S., J. DeRisi, M. Eisen, J. Mulholland, D. Botstein, P. O. Brown, and I.
Herskowitz. 1998. The transcriptional program of sporulation in budding yeast.
Science 282:699-705.
Cohen, M., F. Stutz, N. Belgareh, R. Haguenauer-Tsapis, and C. Dargemont.
2003. Ubp3 requires a cofactor, Bre5, to specifically de-ubiquitinate the COPII
protein, Sec23. Nat Cell Biol 5:661-667.
Cohen, M., F. Stutz, and C. Dargemont. 2003. Deubiquitination, a new player in
Golgi to endoplasmic reticulum retrograde transport. J Biol Chem 278:51989-51992.
Czabany, T., K. Athenstaedt, and G. Daum. 2007. Synthesis, storage and
degradation of neutral lipids in yeast. Biochim Biophys Acta 1771:299-309.
De Duve, C., and P. Baudhuin. 1966. Peroxisomes (microbodies and related
particles). Physiol Rev 46:323-357.
Debelyy, M. O., H. W. Platta, D. Saffian, A. Hensel, S. Thoms, H. E. Meyer, B.
Warscheid, W. Girzalsky, and R. Erdmann. 2011. Ubp15p, an ubiquitin hydrolase
associated with the peroxisomal export machinery. Journal of Biological Chemistry.
Debelyy, M. O., S. Thoms, M. Connerth, G. Daum, and R. Erdmann. 2011.
Involvement of the Saccharomyces cerevisiae Hydrolase Ldh1p in Lipid Homeostasis.
Eukaryot Cell 10:776-781.
CHAPTER 4. REFERENCES________________________________________________ 92
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
Delker, C., B. K. Zolman, O. Miersch, and C. Wasternack. 2007. Jasmonate
biosynthesis in Arabidopsis thaliana requires peroxisomal beta-oxidation enzymes-additional proof by properties of pex6 and aim1. Phytochemistry 68:1642-1650.
Digel, M., R. Ehehalt, and J. Fullekrug. 2010. Lipid droplets lighting up: insights
from live microscopy. FEBS Lett 584:2168-2175.
Dodt, G., and S. J. Gould. 1996. Multiple PEX genes are required for proper
subcellular distribution and stability of Pex5p, the PTS1 receptor: evidence that PTS1
protein import is mediated by a cycling receptor. J Cell Biol 135:1763-1774.
Doss-Pepe, E. W., E. S. Stenroos, W. G. Johnson, and K. Madura. 2003. Ataxin-3
interactions with rad23 and valosin-containing protein and its associations with
ubiquitin chains and the proteasome are consistent with a role in ubiquitin-mediated
proteolysis. Mol Cell Biol 23:6469-6483.
Eddy, S. R. 1998. Profile hidden Markov models. Bioinformatics 14:755-763.
Eitzen, G. A., R. K. Szilard, and R. A. Rachubinski. 1997. Enlarged peroxisomes
are present in oleic acid-grown Yarrowia lipolytica overexpressing the PEX16 gene
encoding an intraperoxisomal peripheral membrane peroxin. J Cell Biol 137:12651278.
Elgersma, Y., L. Kwast, M. van den Berg, W. B. Snyder, B. Distel, S. Subramani,
and H. F. Tabak. 1997. Overexpression of Pex15p, a phosphorylated peroxisomal
integral membrane protein required for peroxisome assembly in S.cerevisiae, causes
proliferation of the endoplasmic reticulum membrane. Embo J 16:7326-7341.
Erdmann, R., and G. Blobel. 1996. Identification of Pex13p a peroxisomal
membrane receptor for the PTS1 recognition factor. J Cell Biol 135:111-121.
Erdmann, R., and W. Schliebs. 2005. Peroxisomal matrix protein import: the
transient pore model. Nat Rev Mol Cell Biol 6:738-742.
Ernst, R., B. Mueller, H. L. Ploegh, and C. Schlieker. 2009. The otubain YOD1 is a
deubiquitinating enzyme that associates with p97 to facilitate protein dislocation from
the ER. Mol Cell 36:28-38.
Erzberger, J. P., and J. M. Berger. 2006. Evolutionary relationships and structural
mechanisms of AAA+ proteins. Annu Rev Biophys Biomol Struct 35:93-114.
Faber, K. N., J. A. Heyman, and S. Subramani. 1998. Two AAA family peroxins,
PpPex1p and PpPex6p, interact with each other in an ATP-dependent manner and are
associated with different subcellular membranous structures distinct from
peroxisomes. Mol Cell Biol 18:936-943.
Fan, W., and Y. Fujiki. 2006. A temperature-sensitive CHO pex1 mutant with a
novel mutation in the AAA Walker A1 motif. Biochem Biophys Res Commun
345:1434-1439.
Fang, Y., J. C. Morrell, J. M. Jones, and S. J. Gould. 2004. PEX3 functions as a
PEX19 docking factor in the import of class I peroxisomal membrane proteins. J Cell
Biol 164:863-875.
Farese, R. V., Jr., and T. C. Walther. 2009. Lipid droplets finally get a little R-E-SP-E-C-T. Cell 139:855-860.
Ferre, P. 2004. The biology of peroxisome proliferator-activated receptors:
relationship with lipid metabolism and insulin sensitivity. Diabetes 53 Suppl 1:S4350.
Fransen, M., I. Vastiau, C. Brees, V. Brys, G. P. Mannaerts, and P. P. Van
Veldhoven. 2004. Potential role for Pex19p in assembly of PTS-receptor docking
complexes. J Biol Chem 279:12615-12624.
Fransen, M., I. Vastiau, C. Brees, V. Brys, G. P. Mannaerts, and P. P. Van
Veldhoven. 2005. Analysis of human Pex19p's domain structure by pentapeptide
scanning mutagenesis. J Mol Biol 346:1275-1286.
CHAPTER 4. REFERENCES________________________________________________ 93
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
Fransen, M., T. Wylin, C. Brees, G. P. Mannaerts, and P. P. Van Veldhoven.
2001. Human pex19p binds peroxisomal integral membrane proteins at regions
distinct from their sorting sequences. Mol Cell Biol 21:4413-4424.
Fujimoto, T., Y. Ohsaki, J. Cheng, M. Suzuki, and Y. Shinohara. 2008. Lipid
droplets: a classic organelle with new outfits. Histochem Cell Biol 130:263-279.
Funato, M., N. Shimozawa, T. Nagase, Y. Takemoto, Y. Suzuki, Y. Imamura, T.
Matsumoto, T. Tsukamoto, T. Kojidani, T. Osumi, T. Fukao, and N. Kondo.
2006. Aberrant peroxisome morphology in peroxisomal beta-oxidation enzyme
deficiencies. Brain Dev 28:287-292.
Furuki, S., S. Tamura, N. Matsumoto, N. Miyata, A. Moser, H. W. Moser, and Y.
Fujiki. 2006. Mutations in the peroxin Pex26p responsible for peroxisome biogenesis
disorders of complementation group 8 impair its stability, peroxisomal localization,
and interaction with the Pex1p x Pex6p complex. J Biol Chem 281:1317-1323.
Gabaldon, T., B. Snel, F. van Zimmeren, W. Hemrika, H. Tabak, and M. A.
Huynen. 2006. Origin and evolution of the peroxisomal proteome. Biol Direct 1:8.
Gardocki, M. E., M. Bakewell, D. Kamath, K. Robinson, K. Borovicka, and J. M.
Lopes. 2005. Genomic analysis of PIS1 gene expression. Eukaryot Cell 4:604-614.
Ghaedi, K., S. Tamura, K. Okumoto, Y. Matsuzono, and Y. Fujiki. 2000. The
peroxin pex3p initiates membrane assembly in peroxisome biogenesis. Mol Biol Cell
11:2085-2102.
Gilchrist, C. A., and R. T. Baker. 2000. Characterization of the ubiquitin-specific
protease activity of the mouse/human Unp/Unph oncoprotein. Biochim Biophys Acta
1481:297-309.
Glickman, M. H., D. M. Rubin, V. A. Fried, and D. Finley. 1998. The regulatory
particle of the Saccharomyces cerevisiae proteasome. Mol Cell Biol 18:3149-3162.
Goldberg, I. J., and M. Merkel. 2001. Lipoprotein lipase: physiology, biochemistry,
and molecular biology. Front Biosci 6:D388-405.
Goodman, J. M. 2008. The gregarious lipid droplet. J Biol Chem 283:28005-28009.
Goodman, J. M. 2009. Demonstrated and inferred metabolism associated with
cytosolic lipid droplets. J Lipid Res 50:2148-2156.
Gorgas, K. 1986. Morphogenesis of peroxisomes in lipid synthesizing epithelia.
Peroxisomes in Biology and Medicine H. D. Fahimi and H. Sies, editors. SpringerVerlag, Berlin, Heidelberg.:3-17.
Gotte, K., W. Girzalsky, M. Linkert, E. Baumgart, S. Kammerer, W. H. Kunau,
and R. Erdmann. 1998. Pex19p, a farnesylated protein essential for peroxisome
biogenesis. Mol Cell Biol 18:616-628.
Gould, S. J., J. E. Kalish, J. C. Morrell, J. Bjorkman, A. J. Urquhart, and D. I.
Crane. 1996. Pex13p is an SH3 protein of the peroxisome membrane and a docking
factor for the predominantly cytoplasmic PTs1 receptor. J Cell Biol 135:85-95.
Gouveia, A. M., C. P. Guimaraes, M. E. Oliveira, C. Reguenga, C. Sa-Miranda,
and J. E. Azevedo. 2003. Characterization of the peroxisomal cycling receptor,
Pex5p, using a cell-free in vitro import system. J Biol Chem 278:226-232.
Gray, W. M., and J. S. Fassler. 1996. Isolation and analysis of the yeast TEA1 gene,
which encodes a zinc cluster Ty enhancer-binding protein. Mol Cell Biol 16:347-358.
Grou, C. P., A. F. Carvalho, M. P. Pinto, S. J. Huybrechts, C. Sa-Miranda, M.
Fransen, and J. E. Azevedo. 2009. Properties of the ubiquitin-pex5p thiol ester
conjugate. J Biol Chem 284:10504-10513.
Grunau, S., W. Schliebs, R. Linnepe, C. Neufeld, C. Cizmowski, B. Reinartz, H.
E. Meyer, B. Warscheid, W. Girzalsky, and R. Erdmann. 2009. Peroxisomal
targeting of PTS2 pre-import complexes in the yeast Saccharomyces cerevisiae.
Traffic 10:451-460.
CHAPTER 4. REFERENCES________________________________________________ 94
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
Guo, Y., K. R. Cordes, R. V. Farese, Jr., and T. C. Walther. 2009. Lipid droplets at
a glance. J Cell Sci 122:749-752.
Guterman, A., and M. H. Glickman. 2004. Complementary roles for Rpn11 and
Ubp6 in deubiquitination and proteolysis by the proteasome. J Biol Chem 279:17291738.
Haan, G. J., K. N. Faber, R. J. Baerends, A. Koek, A. Krikken, J. A. Kiel, I. J.
van der Klei, and M. Veenhuis. 2002. Hansenula polymorpha Pex3p is a peripheral
component of the peroxisomal membrane. J Biol Chem 277:26609-26617.
Hajra, A. K., and J. E. Bishop. 1982. Glycerolipid biosynthesis in peroxisomes via
the acyl dihydroxyacetone phosphate pathway. Ann N Y Acad Sci 386:170-182.
Hansen-Hagge, T. E., J. W. Janssen, H. Hameister, F. R. Papa, U. Zechner, T.
Seriu, A. Jauch, D. Becke, M. Hochstrasser, and C. R. Bartram. 1998. An
evolutionarily conserved gene on human chromosome 5q33-q34, UBH1, encodes a
novel deubiquitinating enzyme. Genomics 49:411-418.
Hayashi, Y., M. Hayashi, H. Hayashi, I. Hara-Nishimura, and M. Nishimura.
2001. Direct interaction between glyoxysomes and lipid bodies in cotyledons of the
Arabidopsis thaliana ped1 mutant. Protoplasma 218:83-94.
Henry, K. W., A. Wyce, W. S. Lo, L. J. Duggan, N. C. Emre, C. F. Kao, L. Pillus,
A. Shilatifard, M. A. Osley, and S. L. Berger. 2003. Transcriptional activation via
sequential histone H2B ubiquitylation and deubiquitylation, mediated by SAGAassociated Ubp8. Genes Dev 17:2648-2663.
Heupel, R., and H. W. Heldt. 1994. Protein organization in the matrix of leaf
peroxisomes. A multi-enzyme complex involved in photorespiratory metabolism. Eur
J Biochem 220:165-172.
Hicke, L. 2001. Protein regulation by monoubiquitin. Nat Rev Mol Cell Biol 2:195201.
Hiraga, K., K. Suzuki, E. Tsuchiya, and T. Miyakawa. 1993. Cloning and
characterization of the elongation factor EF-1 beta homologue of Saccharomyces
cerevisiae. EF-1 beta is essential for growth. FEBS Lett 316:165-169.
Hochstrasser, M. 1996. Ubiquitin-dependent protein degradation. Annu Rev Genet
30:405-439.
Hoepfner, D., D. Schildknegt, I. Braakman, P. Philippsen, and H. F. Tabak. 2005.
Contribution of the endoplasmic reticulum to peroxisome formation. Cell 122:85-95.
Hofmann, L., R. Saunier, R. Cossard, M. Esposito, T. Rinaldi, and A. Delahodde.
2009. A nonproteolytic proteasome activity controls organelle fission in yeast. J Cell
Sci 122:3673-3683.
Hohfeld, J., M. Veenhuis, and W. H. Kunau. 1991. PAS3, a Saccharomyces
cerevisiae gene encoding a peroxisomal integral membrane protein essential for
peroxisome biogenesis. J Cell Biol 114:1167-1178.
Honsho, M., T. Hiroshige, and Y. Fujiki. 2002. The membrane biogenesis peroxin
Pex16p. Topogenesis and functional roles in peroxisomal membrane assembly. J Biol
Chem 277:44513-44524.
Honsho, M., S. Tamura, N. Shimozawa, Y. Suzuki, N. Kondo, and Y. Fujiki.
1998. Mutation in PEX16 is causal in the peroxisome-deficient Zellweger syndrome
of complementation group D. Am J Hum Genet 63:1622-1630.
Hsiang, Y. H., R. Hertzberg, S. Hecht, and L. F. Liu. 1985. Camptothecin induces
protein-linked DNA breaks via mammalian DNA topoisomerase I. J Biol Chem
260:14873-14878.
Hu, M., P. Li, M. Li, W. Li, T. Yao, J. W. Wu, W. Gu, R. E. Cohen, and Y. Shi.
2002. Crystal structure of a UBP-family deubiquitinating enzyme in isolation and in
complex with ubiquitin aldehyde. Cell 111:1041-1054.
CHAPTER 4. REFERENCES________________________________________________ 95
91.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
Huang, Y., R. T. Baker, and J. A. Fischer-Vize. 1995. Control of cell fate by a
deubiquitinating enzyme encoded by the fat facets gene. Science 270:1828-1831.
Huh, W. K., J. V. Falvo, L. C. Gerke, A. S. Carroll, R. W. Howson, J. S.
Weissman, and E. K. O'Shea. 2003. Global analysis of protein localization in
budding yeast. Nature 425:686-691.
Hunt, J. E., and R. N. Trelease. 2004. Sorting pathway and molecular targeting
signals for the Arabidopsis peroxin 3. Biochem Biophys Res Commun 314:586-596.
Imanishi, Y., V. Gerke, and K. Palczewski. 2004. Retinosomes: new insights into
intracellular managing of hydrophobic substances in lipid bodies. J Cell Biol 166:447453.
Ingelmo-Torres, M., E. Gonzalez-Moreno, A. Kassan, M. Hanzal-Bayer, F.
Tebar, A. Herms, T. Grewal, J. F. Hancock, C. Enrich, M. Bosch, S. P. Gross, R.
G. Parton, and A. Pol. 2009. Hydrophobic and basic domains target proteins to lipid
droplets. Traffic 10:1785-1801.
Islinger, M., M. J. Cardoso, and M. Schrader. 2010. Be different--the diversity of
peroxisomes in the animal kingdom. Biochim Biophys Acta 1803:881-897.
Jakobs, B. S., and R. J. Wanders. 1991. Conclusive evidence that very-long-chain
fatty acids are oxidized exclusively in peroxisomes in human skin fibroblasts.
Biochem Biophys Res Commun 178:842-847.
Jentsch, S., and S. Rumpf. 2007. Cdc48 (p97): a "molecular gearbox" in the
ubiquitin pathway? Trends Biochem Sci 32:6-11.
Johnson, M. A., W. B. Snyder, J. L. Cereghino, M. Veenhuis, S. Subramani, and
J. M. Cregg. 2001. Pichia pastoris Pex14p, a phosphorylated peroxisomal membrane
protein, is part of a PTS-receptor docking complex and interacts with many peroxins.
Yeast 18:621-641.
Jones, J. M., J. C. Morrell, and S. J. Gould. 2004. PEX19 is a predominantly
cytosolic chaperone and import receptor for class 1 peroxisomal membrane proteins. J
Cell Biol 164:57-67.
Kahana, A. 2001. The deubiquitinating enzyme Dot4p is involved in regulating
nutrient uptake. Biochem Biophys Res Commun 282:916-920.
Kahana, A., and D. E. Gottschling. 1999. DOT4 links silencing and cell growth in
Saccharomyces cerevisiae. Mol Cell Biol 19:6608-6620.
Kal, A. J., A. J. van Zonneveld, V. Benes, M. van den Berg, M. G. Koerkamp, K.
Albermann, N. Strack, J. M. Ruijter, A. Richter, B. Dujon, W. Ansorge, and H.
F. Tabak. 1999. Dynamics of gene expression revealed by comparison of serial
analysis of gene expression transcript profiles from yeast grown on two different
carbon sources. Mol Biol Cell 10:1859-1872.
Kammerer, S., N. Arnold, W. Gutensohn, H. W. Mewes, W. H. Kunau, G. Hofler,
A. A. Roscher, and A. Braun. 1997. Genomic organization and molecular
characterization of a gene encoding HsPXF, a human peroxisomal farnesylated
protein. Genomics 45:200-210.
Kashiwayama, Y., K. Asahina, H. Shibata, M. Morita, A. C. Muntau, A. A.
Roscher, R. J. Wanders, N. Shimozawa, M. Sakaguchi, H. Kato, and T. Imanaka.
2005. Role of Pex19p in the targeting of PMP70 to peroxisome. Biochim Biophys
Acta 1746:116-128.
Kiel, J. A., K. Emmrich, H. E. Meyer, and W. H. Kunau. 2005. Ubiquitination of
the peroxisomal targeting signal type 1 receptor, Pex5p, suggests the presence of a
quality control mechanism during peroxisomal matrix protein import. J Biol Chem
280:1921-1930.
Kiel, J. A., M. Veenhuis, and I. J. van der Klei. 2006. PEX genes in fungal
genomes: common, rare or redundant. Traffic 7:1291-1303.
CHAPTER 4. REFERENCES________________________________________________ 96
108.
109.
110.
111.
112.
113.
114.
115.
116.
117.
118.
119.
120.
121.
122.
Kim, P. K., R. T. Mullen, U. Schumann, and J. Lippincott-Schwartz. 2006. The
origin and maintenance of mammalian peroxisomes involves a de novo PEX16dependent pathway from the ER. J Cell Biol 173:521-532.
Kinner, A., and R. Kolling. 2003. The yeast deubiquitinating enzyme Ubp16 is
anchored to the outer mitochondrial membrane. FEBS Lett 549:135-140.
Knab, A. M., J. Fertala, and M. A. Bjornsti. 1993. Mechanisms of camptothecin
resistance in yeast DNA topoisomerase I mutants. J Biol Chem 268:22322-22330.
Knab, A. M., J. Fertala, and M. A. Bjornsti. 1995. A camptothecin-resistant DNA
topoisomerase I mutant exhibits altered sensitivities to other DNA topoisomerase
poisons. J Biol Chem 270:6141-6148.
Kohlwein, S. D. 2010. Triacylglycerol homeostasis: insights from yeast. J Biol Chem
285:15663-15667.
Koller, A., W. B. Snyder, K. N. Faber, T. J. Wenzel, L. Rangell, G. A. Keller, and
S. Subramani. 1999. Pex22p of Pichia pastoris, essential for peroxisomal matrix
protein import, anchors the ubiquitin-conjugating enzyme, Pex4p, on the peroxisomal
membrane. J Cell Biol 146:99-112.
Komori, M., J. A. Kiel, and M. Veenhuis. 1999. The peroxisomal membrane protein
Pex14p of Hansenula polymorpha is phosphorylated in vivo. FEBS Lett 457:397-399.
Kouranti, I., J. R. McLean, A. Feoktistova, P. Liang, A. E. Johnson, R. H.
Roberts-Galbraith, and K. L. Gould. 2010. A global census of fission yeast
deubiquitinating enzyme localization and interaction networks reveals distinct
compartmentalization profiles and overlapping functions in endocytosis and polarity.
PLoS Biol 8.
Kragt, A., T. Voorn-Brouwer, M. van den Berg, and B. Distel. 2005. The
Saccharomyces cerevisiae peroxisomal import receptor Pex5p is monoubiquitinated in
wild type cells. J Biol Chem 280:7867-7874.
Krahmer, N., Y. Guo, R. V. Farese, Jr., and T. C. Walther. 2009. SnapShot: Lipid
Droplets. Cell 139:1024-1024 e1021.
Krisans, S. K. 1992. The role of peroxisomes in cholesterol metabolism. Am J Respir
Cell Mol Biol 7:358-364.
Krisans, S. K. 1996. Cell compartmentalization of cholesterol biosynthesis. Ann N Y
Acad Sci 804:142-164.
Krogan, N. J., G. Cagney, H. Yu, G. Zhong, X. Guo, A. Ignatchenko, J. Li, S. Pu,
N. Datta, A. P. Tikuisis, T. Punna, J. M. Peregrin-Alvarez, M. Shales, X. Zhang,
M. Davey, M. D. Robinson, A. Paccanaro, J. E. Bray, A. Sheung, B. Beattie, D. P.
Richards, V. Canadien, A. Lalev, F. Mena, P. Wong, A. Starostine, M. M. Canete,
J. Vlasblom, S. Wu, C. Orsi, S. R. Collins, S. Chandran, R. Haw, J. J. Rilstone, K.
Gandi, N. J. Thompson, G. Musso, P. St Onge, S. Ghanny, M. H. Lam, G.
Butland, A. M. Altaf-Ul, S. Kanaya, A. Shilatifard, E. O'Shea, J. S. Weissman, C.
J. Ingles, T. R. Hughes, J. Parkinson, M. Gerstein, S. J. Wodak, A. Emili, and J.
F. Greenblatt. 2006. Global landscape of protein complexes in the yeast
Saccharomyces cerevisiae. Nature 440:637-643.
Lageweg, W., J. E. Sykes, M. Lopes-Cardozo, and R. J. Wanders. 1991. Oxidation
of very-long-chain fatty acids in rat brain: cerotic acid is beta-oxidized exclusively in
rat brain peroxisomes. Biochim Biophys Acta 1085:381-384.
Lam, M. H., D. Urban-Grimal, A. Bugnicourt, J. F. Greenblatt, R. HaguenauerTsapis, and A. Emili. 2009. Interaction of the deubiquitinating enzyme Ubp2 and the
e3 ligase Rsp5 is required for transporter/receptor sorting in the multivesicular body
pathway. PLoS One 4:e4259.
CHAPTER 4. REFERENCES________________________________________________ 97
123.
124.
125.
126.
127.
128.
129.
130.
131.
132.
133.
134.
135.
136.
137.
138.
Lam, S. K., N. Yoda, and R. Schekman. 2010. A vesicle carrier that mediates
peroxisome protein traffic from the endoplasmic reticulum. Proc Natl Acad Sci U S A
107:21523-21528.
Lametschwandtner, G., C. Brocard, M. Fransen, P. Van Veldhoven, J. Berger,
and A. Hartig. 1998. The difference in recognition of terminal tripeptides as
peroxisomal targeting signal 1 between yeast and human is due to different affinities
of their receptor Pex5p to the cognate signal and to residues adjacent to it. J Biol
Chem 273:33635-33643.
Layfield, R., K. Franklin, M. Landon, G. Walker, P. Wang, R. Ramage, A.
Brown, S. Love, K. Urquhart, T. Muir, R. Baker, and R. J. Mayer. 1999.
Chemically synthesized ubiquitin extension proteins detect distinct catalytic capacities
of deubiquitinating enzymes. Anal Biochem 274:40-49.
Lazarow, P. B., and W. H. Kunau. 1997. Peroxisomes. In E. Jones (ed.), The
molecular and cellular biology of the yeast Saccharomyces. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York.:547-605.
Legakis, J. E., J. I. Koepke, C. Jedeszko, F. Barlaskar, L. J. Terlecky, H. J.
Edwards, P. A. Walton, and S. R. Terlecky. 2002. Peroxisome senescence in human
fibroblasts. Mol Biol Cell 13:4243-4255.
Leon, S., L. Zhang, W. H. McDonald, J. Yates, 3rd, J. M. Cregg, and S.
Subramani. 2006. Dynamics of the peroxisomal import cycle of PpPex20p: ubiquitindependent localization and regulation. J Cell Biol 172:67-78.
Lin, Y., L. Sun, L. V. Nguyen, R. A. Rachubinski, and H. M. Goodman. 1999. The
Pex16p homolog SSE1 and storage organelle formation in Arabidopsis seeds. Science
284:328-330.
Lindsey, D. F., A. Amerik, W. J. Deery, J. D. Bishop, M. Hochstrasser, and R. H.
Gomer. 1998. A deubiquitinating enzyme that disassembles free polyubiquitin chains
is required for development but not growth in Dictyostelium. J Biol Chem 273:2917829187.
Linghu, B., J. Callis, and M. G. Goebl. 2002. Rub1p processing by Yuh1p is
required for wild-type levels of Rub1p conjugation to Cdc53p. Eukaryot Cell 1:491494.
Listenberger, L. L., and D. A. Brown. 2008. Lipid droplets. Curr Biol 18:R237-238.
Liu, Y., F. Wang, H. Zhang, H. He, L. Ma, and X. W. Deng. 2008. Functional
characterization of the Arabidopsis ubiquitin-specific protease gene family reveals
specific role and redundancy of individual members in development. Plant J 55:844856.
Lopez, R., V. Silventoinen, S. Robinson, A. Kibria, and W. Gish. 2003. WU-Blast2
server at the European Bioinformatics Institute. Nucleic Acids Res 31:3795-3798.
Lucau-Danila, A., T. Delaveau, G. Lelandais, F. Devaux, and C. Jacq. 2003.
Competitive promoter occupancy by two yeast paralogous transcription factors
controlling the multidrug resistance phenomenon. J Biol Chem 278:52641-52650.
Ma, C., and S. Subramani. 2009. Peroxisome matrix and membrane protein
biogenesis. IUBMB Life 61:713-722.
Makarova, K. S., L. Aravind, and E. V. Koonin. 2000. A novel superfamily of
predicted cysteine proteases from eukaryotes, viruses and Chlamydia pneumoniae.
Trends Biochem Sci 25:50-52.
Managadze, D., C. Wurtz, S. Wiese, M. Schneider, W. Girzalsky, H. E. Meyer, R.
Erdmann, B. Warscheid, and H. Rottensteiner. 2010. Identification of PEX33, a
novel component of the peroxisomal docking complex in the filamentous fungus
Neurospora crassa. Eur J Cell Biol 89:955-964.
CHAPTER 4. REFERENCES________________________________________________ 98
139.
140.
141.
142.
143.
144.
145.
146.
147.
148.
149.
150.
151.
152.
153.
154.
Mancuso, D. J., X. Han, C. M. Jenkins, J. J. Lehman, N. Sambandam, H. F. Sims,
J. Yang, W. Yan, K. Yang, K. Green, D. R. Abendschein, J. E. Saffitz, and R. W.
Gross. 2007. Dramatic accumulation of triglycerides and precipitation of cardiac
hemodynamic dysfunction during brief caloric restriction in transgenic myocardium
expressing human calcium-independent phospholipase A2gamma. J Biol Chem
282:9216-9227.
Mancuso, D. J., C. M. Jenkins, H. F. Sims, J. M. Cohen, J. Yang, and R. W.
Gross. 2004. Complex transcriptional and translational regulation of iPLAgamma
resulting in multiple gene products containing dual competing sites for mitochondrial
or peroxisomal localization. Eur J Biochem 271:4709-4724.
Mancuso, D. J., H. F. Sims, X. Han, C. M. Jenkins, S. P. Guan, K. Yang, S. H.
Moon, T. Pietka, N. A. Abumrad, P. H. Schlesinger, and R. W. Gross. 2007.
Genetic ablation of calcium-independent phospholipase A2gamma leads to alterations
in mitochondrial lipid metabolism and function resulting in a deficient mitochondrial
bioenergetic phenotype. J Biol Chem 282:34611-34622.
Marston, A. L., W. H. Tham, H. Shah, and A. Amon. 2004. A genome-wide screen
identifies genes required for centromeric cohesion. Science 303:1367-1370.
Martin, S., and R. G. Parton. 2006. Lipid droplets: a unified view of a dynamic
organelle. Nat Rev Mol Cell Biol 7:373-378.
Marzioch, M., R. Erdmann, M. Veenhuis, and W. H. Kunau. 1994. PAS7 encodes
a novel yeast member of the WD-40 protein family essential for import of 3-oxoacylCoA thiolase, a PTS2-containing protein, into peroxisomes. Embo J 13:4908-4918.
Matsumoto, N., S. Tamura, and Y. Fujiki. 2003. The pathogenic peroxin Pex26p
recruits the Pex1p-Pex6p AAA ATPase complexes to peroxisomes. Nat Cell Biol
5:454-460.
Matsuzono, Y., N. Kinoshita, S. Tamura, N. Shimozawa, M. Hamasaki, K.
Ghaedi, R. J. Wanders, Y. Suzuki, N. Kondo, and Y. Fujiki. 1999. Human PEX19:
cDNA cloning by functional complementation, mutation analysis in a patient with
Zellweger syndrome, and potential role in peroxisomal membrane assembly. Proc Natl
Acad Sci U S A 96:2116-2121.
Matsuzono, Y., T. Matsuzaki, and Y. Fujiki. 2006. Functional domain mapping of
peroxin Pex19p: interaction with Pex3p is essential for function and translocation. J
Cell Sci 119:3539-3550.
McCullock, S., T. Kinard, L. McCullough, and T. Formosa. 2006. blm3-1 is an
allele of UBP3, a ubiquitin protease that appears to act during transcription of
damaged DNA. J Mol Biol 363:660-672.
McDonald, H. B., and B. Byers. 1997. A proteasome cap subunit required for spindle
pole body duplication in yeast. J Cell Biol 137:539-553.
Miyata, N., and Y. Fujiki. 2005. Shuttling mechanism of peroxisome targeting signal
type 1 receptor Pex5: ATP-independent import and ATP-dependent export. Mol Cell
Biol 25:10822-10832.
Motley, A., E. Hettema, B. Distel, and H. Tabak. 1994. Differential protein import
deficiencies in human peroxisome assembly disorders. J Cell Biol 125:755-767.
Motley, A. M., and E. H. Hettema. 2007. Yeast peroxisomes multiply by growth and
division. J Cell Biol 178:399-410.
Muller, W. H., T. P. van der Krift, A. J. Krouwer, H. A. Wosten, L. H. van der
Voort, E. B. Smaal, and A. J. Verkleij. 1991. Localization of the pathway of the
penicillin biosynthesis in Penicillium chrysogenum. Embo J 10:489-495.
Mullner, H., D. Zweytick, R. Leber, F. Turnowsky, and G. Daum. 2004. Targeting
of proteins involved in sterol biosynthesis to lipid particles of the yeast
Saccharomyces cerevisiae. Biochim Biophys Acta 1663:9-13.
CHAPTER 4. REFERENCES________________________________________________ 99
155.
156.
157.
158.
159.
160.
161.
162.
163.
164.
165.
166.
167.
168.
169.
170.
171.
172.
173.
Murakami, M., S. Masuda, K. Ueda-Semmyo, E. Yoda, H. Kuwata, Y.
Takanezawa, J. Aoki, H. Arai, H. Sumimoto, Y. Ishikawa, T. Ishii, Y. Nakatani,
and I. Kudo. 2005. Group VIB Ca2+-independent phospholipase A2gamma promotes
cellular membrane hydrolysis and prostaglandin production in a manner distinct from
other intracellular phospholipases A2. J Biol Chem 280:14028-14041.
Neuberger, G., S. Maurer-Stroh, B. Eisenhaber, A. Hartig, and F. Eisenhaber.
2003. Motif refinement of the peroxisomal targeting signal 1 and evaluation of taxonspecific differences. J Mol Biol 328:567-579.
Neuberger, G., S. Maurer-Stroh, B. Eisenhaber, A. Hartig, and F. Eisenhaber.
2003. Prediction of peroxisomal targeting signal 1 containing proteins from amino
acid sequence. J Mol Biol 328:581-592.
Niederhoff, K., N. M. Meindl-Beinker, D. Kerssen, U. Perband, A. Schafer, W.
Schliebs, and W. H. Kunau. 2005. Yeast Pex14p possesses two functionally distinct
Pex5p and one Pex7p binding sites. J Biol Chem 280:35571-35578.
Novikoff, A. B., P. M. Novikoff, O. M. Rosen, and C. S. Rubin. 1980. Organelle
relationships in cultured 3T3-L1 preadipocytes. J Cell Biol 87:180-196.
Nyathi, Y., and A. Baker. 2006. Plant peroxisomes as a source of signalling
molecules. Biochim Biophys Acta 1763:1478-1495.
Papa, F. R., A. Y. Amerik, and M. Hochstrasser. 1999. Interaction of the Doa4
deubiquitinating enzyme with the yeast 26S proteasome. Mol Biol Cell 10:741-756.
Papa, F. R., and M. Hochstrasser. 1993. The yeast DOA4 gene encodes a
deubiquitinating enzyme related to a product of the human tre-2 oncogene. Nature
366:313-319.
Park, S., R. Isaacson, H. T. Kim, P. A. Silver, and G. Wagner. 2005. Ufd1 exhibits
the AAA-ATPase fold with two distinct ubiquitin interaction sites. Structure 13:9951005.
Pernas, M. A., C. Lopez, L. Pastrana, and M. L. Rua. 2001. Purification and
characterization of Lip2 and Lip3 isoenzymes from a Candida rugosa pilot-plant scale
fed-batch fermentation. J Biotechnol 84:163-174.
Petriv, O. I., and R. A. Rachubinski. 2004. Lack of peroxisomal catalase causes a
progeric phenotype in Caenorhabditis elegans. J Biol Chem 279:19996-20001.
Petriv, O. I., L. Tang, V. I. Titorenko, and R. A. Rachubinski. 2004. A new
definition for the consensus sequence of the peroxisome targeting signal type 2. J Mol
Biol 341:119-134.
Pickart, C. M. 2001. Mechanisms underlying ubiquitination. Annu Rev Biochem
70:503-533.
Platta, H. W., M. O. Debelyy, F. El Magraoui, and R. Erdmann. 2008. The AAA
peroxins Pex1p and Pex6p function as dislocases for the ubiquitinated peroxisomal
import receptor Pex5p. Biochem Soc Trans 36:99-104.
Platta, H. W., F. El Magraoui, D. Schlee, S. Grunau, W. Girzalsky, and R.
Erdmann. 2007. Ubiquitination of the peroxisomal import receptor Pex5p is required
for its recycling. J Cell Biol 177:197-204.
Platta, H. W., and R. Erdmann. 2007. The peroxisomal protein import machinery.
FEBS Lett 581:2811-2819.
Platta, H. W., W. Girzalsky, and R. Erdmann. 2004. Ubiquitination of the
peroxisomal import receptor Pex5p. Biochem J 384:37-45.
Platta, H. W., S. Grunau, K. Rosenkranz, W. Girzalsky, and R. Erdmann. 2005.
Functional role of the AAA peroxins in dislocation of the cycling PTS1 receptor back
to the cytosol. Nat Cell Biol 7:817-822.
Ploegh, H. L. 2007. A lipid-based model for the creation of an escape hatch from the
endoplasmic reticulum. Nature 448:435-438.
CHAPTER 4. REFERENCES________________________________________________ 100
174.
175.
176.
177.
178.
179.
180.
181.
182.
183.
184.
185.
186.
187.
188.
189.
190.
191.
192.
Purdue, P. E., and P. B. Lazarow. 2001. Pex18p is constitutively degraded during
peroxisome biogenesis. J Biol Chem 276:47684-47689.
Rajakumari, S., K. Grillitsch, and G. Daum. 2008. Synthesis and turnover of nonpolar lipids in yeast. Prog Lipid Res 47:157-171.
Rayapuram, N., and S. Subramani. 2006. The importomer--a peroxisomal
membrane complex involved in protein translocation into the peroxisome matrix.
Biochim Biophys Acta 1763:1613-1619.
Rhodin, J. 1954. Correlation of ultrastructural organization and function in normal
and experimentally changed proximal convoluted tubule cells of the mouse kidney.
Aktiebolaget Godvil, Stockholm.
Rosenkranz, K., I. Birschmann, S. Grunau, W. Girzalsky, W. H. Kunau, and R.
Erdmann. 2006. Functional association of the AAA complex and the peroxisomal
importomer. Febs J 273:3804-3815.
Rucktaschel, R., W. Girzalsky, and R. Erdmann. 2011. Protein import machineries
of peroxisomes. Biochim Biophys Acta 1808:892-900.
Rucktaschel, R., S. Thoms, V. Sidorovitch, A. Halbach, M. Pechlivanis, R.
Volkmer, K. Alexandrov, J. Kuhlmann, H. Rottensteiner, and R. Erdmann. 2009.
Farnesylation of pex19p is required for its structural integrity and function in
peroxisome biogenesis. J Biol Chem 284:20885-20896.
Rumpf, S., and S. Jentsch. 2006. Functional division of substrate processing
cofactors of the ubiquitin-selective Cdc48 chaperone. Mol Cell 21:261-269.
Sakamoto, T., T. Tanaka, Y. Ito, S. Rajesh, M. Iwamoto-Sugai, Y. Kodera, N.
Tsuchida, T. Shibata, and T. Kohno. 1999. An NMR analysis of ubiquitin
recognition by yeast ubiquitin hydrolase: evidence for novel substrate recognition by a
cysteine protease. Biochemistry 38:11634-11642.
Santos, M. J., T. Imanaka, H. Shio, G. M. Small, and P. B. Lazarow. 1988.
Peroxisomal membrane ghosts in Zellweger syndrome--aberrant organelle assembly.
Science 239:1536-1538.
Schliebs, W., W. Girzalsky, and R. Erdmann. 2010. Peroxisomal protein import
and ERAD: variations on a common theme. Nat Rev Mol Cell Biol 11:885-890.
Schliebs, W., and W. H. Kunau. 2004. Peroxisome membrane biogenesis: the stage
is set. Curr Biol 14:R397-399.
Schluter, A., S. Fourcade, R. Ripp, J. L. Mandel, O. Poch, and A. Pujol. 2006. The
evolutionary origin of peroxisomes: an ER-peroxisome connection. Mol Biol Evol
23:838-845.
Schrader, M. 2001. Tubulo-reticular clusters of peroxisomes in living COS-7 cells:
dynamic behavior and association with lipid droplets. J Histochem Cytochem
49:1421-1429.
Schrader, M., and H. D. Fahimi. 2008. The peroxisome: still a mysterious organelle.
Histochem Cell Biol 129:421-440.
Schrag, J. D., and M. Cygler. 1997. Lipases and alpha/beta hydrolase fold. Methods
Enzymol 284:85-107.
Schueller, N., S. J. Holton, K. Fodor, M. Milewski, P. Konarev, W. A. Stanley, J.
Wolf, R. Erdmann, W. Schliebs, Y. H. Song, and M. Wilmanns. 2010. The
peroxisomal receptor Pex19p forms a helical mPTS recognition domain. Embo J
29:2491-2500.
Schulz, H. 1991. Beta oxidation of fatty acids. Biochim Biophys Acta 1081:109-120.
Shibata, H., Y. Kashiwayama, T. Imanaka, and H. Kato. 2004. Domain
architecture and activity of human Pex19p, a chaperone-like protein for intracellular
trafficking of peroxisomal membrane proteins. J Biol Chem 279:38486-38494.
CHAPTER 4. REFERENCES________________________________________________ 101
193.
194.
195.
196.
197.
198.
199.
200.
201.
202.
203.
204.
205.
206.
207.
208.
209.
Shiozawa, K., N. Maita, K. Tomii, A. Seto, N. Goda, Y. Akiyama, T. Shimizu, M.
Shirakawa, and H. Hiroaki. 2004. Structure of the N-terminal domain of PEX1
AAA-ATPase. Characterization of a putative adaptor-binding domain. J Biol Chem
279:50060-50068.
Singer, M. S., A. Kahana, A. J. Wolf, L. L. Meisinger, S. E. Peterson, C. Goggin,
M. Mahowald, and D. E. Gottschling. 1998. Identification of high-copy disruptors
of telomeric silencing in Saccharomyces cerevisiae. Genetics 150:613-632.
Skinner, J. R., T. M. Shew, D. M. Schwartz, A. Tzekov, C. M. Lepus, N. A.
Abumrad, and N. E. Wolins. 2009. Diacylglycerol enrichment of endoplasmic
reticulum or lipid droplets recruits perilipin 3/TIP47 during lipid storage and
mobilization. J Biol Chem 284:30941-30948.
Smith, J. J., M. Marelli, R. H. Christmas, F. J. Vizeacoumar, D. J. Dilworth, T.
Ideker, T. Galitski, K. Dimitrov, R. A. Rachubinski, and J. D. Aitchison. 2002.
Transcriptome profiling to identify genes involved in peroxisome assembly and
function. J Cell Biol 158:259-271.
Smith, J. J., S. A. Ramsey, M. Marelli, B. Marzolf, D. Hwang, R. A. Saleem, R. A.
Rachubinski, and J. D. Aitchison. 2007. Transcriptional responses to fatty acid are
coordinated by combinatorial control. Mol Syst Biol 3:115.
Snyder, W. B., A. Koller, A. J. Choy, and S. Subramani. 2000. The peroxin Pex19p
interacts with multiple, integral membrane proteins at the peroxisomal membrane. J
Cell Biol 149:1171-1178.
Soukupova, M., C. Sprenger, K. Gorgas, W. H. Kunau, and G. Dodt. 1999.
Identification and characterization of the human peroxin PEX3. Eur J Cell Biol
78:357-374.
South, S. T., and S. J. Gould. 1999. Peroxisome synthesis in the absence of
preexisting peroxisomes. J Cell Biol 144:255-266.
Stobart, A. K., S. Stymne, and S. Höglund. 1986. Safflower microsomes catalyse oil
accumulation in vitro: A model system. Planta 169:33-37.
Swaminathan, S., A. Y. Amerik, and M. Hochstrasser. 1999. The Doa4
deubiquitinating enzyme is required for ubiquitin homeostasis in yeast. Mol Biol Cell
10:2583-2594.
Tamura, S., N. Shimozawa, Y. Suzuki, T. Tsukamoto, T. Osumi, and Y. Fujiki.
1998. A cytoplasmic AAA family peroxin, Pex1p, interacts with Pex6p. Biochem
Biophys Res Commun 245:883-886.
Tamura, S., S. Yasutake, N. Matsumoto, and Y. Fujiki. 2006. Dynamic and
functional assembly of the AAA peroxins, Pex1p and Pex6p, and their membrane
receptor Pex26p. J Biol Chem 281:27693-27704.
Tauchi-Sato, K., S. Ozeki, T. Houjou, R. Taguchi, and T. Fujimoto. 2002. The
surface of lipid droplets is a phospholipid monolayer with a unique Fatty Acid
composition. J Biol Chem 277:44507-44512.
Terlecky, S. R., J. I. Koepke, and P. A. Walton. 2006. Peroxisomes and aging.
Biochim Biophys Acta 1763:1749-1754.
Thiele, C., and J. Spandl. 2008. Cell biology of lipid droplets. Curr Opin Cell Biol
20:378-385.
Thoms, S. 2002. Cdc48 can distinguish between native and non-native proteins in the
absence of cofactors. FEBS Lett 520:107-110.
Thoms, S., M. O. Debelyy, M. Connerth, G. Daum, and R. Erdmann. 2011. The
Putative Saccharomyces cerevisiae Hydrolase Ldh1p Is Localized to Lipid Droplets.
Eukaryot Cell 10:770-775.
CHAPTER 4. REFERENCES________________________________________________ 102
210.
211.
212.
213.
214.
215.
216.
217.
218.
219.
220.
221.
222.
223.
224.
225.
226.
227.
228.
229.
230.
231.
Thoms, S., M. O. Debelyy, K. Nau, H. E. Meyer, and R. Erdmann. 2008. Lpx1p is
a peroxisomal lipase required for normal peroxisome morphology. Febs J 275:504514.
Thoms, S., and R. Erdmann. 2005. Import of proteins into peroxisomes. Movement
Across Membranes (Eichler J, ed.) Springer, New York.:125–134.
Thoms, S., and R. Erdmann. 2006. Peroxisomal matrix protein receptor
ubiquitination and recycling. Biochim Biophys Acta 1763:1620-1628.
Thrower, J. S., L. Hoffman, M. Rechsteiner, and C. M. Pickart. 2000. Recognition
of the polyubiquitin proteolytic signal. Embo J 19:94-102.
Tobias, J. W., and A. Varshavsky. 1991. Cloning and functional analysis of the
ubiquitin-specific protease gene UBP1 of Saccharomyces cerevisiae. J Biol Chem
266:12021-12028.
Tolbert, N. E. 1981. Metabolic pathways in peroxisomes and glyoxysomes. Annu
Rev Biochem 50:133-157.
Tolbert, N. E., and E. Essner. 1981. Microbodies: peroxisomes and glyoxysomes. J
Cell Biol 91:271s-283s.
Tower, R. J., A. Fagarasanu, J. D. Aitchison, and R. A. Rachubinski. 2011. The
peroxin Pex34p functions with the Pex11 family of peroxisomal divisional proteins to
regulate the peroxisome population in yeast. Mol Biol Cell 22:1727-1738.
van den Bosch, H., R. B. Schutgens, R. J. Wanders, and J. M. Tager. 1992.
Biochemistry of peroxisomes. Annu Rev Biochem 61:157-197.
van Roermund, C. W., E. H. Hettema, A. J. Kal, M. van den Berg, H. F. Tabak,
and R. J. Wanders. 1998. Peroxisomal beta-oxidation of polyunsaturated fatty acids
in Saccharomyces cerevisiae: isocitrate dehydrogenase provides NADPH for reduction
of double bonds at even positions. Embo J 17:677-687.
Verma, R., L. Aravind, R. Oania, W. H. McDonald, J. R. Yates, 3rd, E. V.
Koonin, and R. J. Deshaies. 2002. Role of Rpn11 metalloprotease in deubiquitination
and degradation by the 26S proteasome. Science 298:611-615.
Walther, T. C., and R. V. Farese, Jr. 2009. The life of lipid droplets. Biochim
Biophys Acta 1791:459-466.
Walton, P. A., P. E. Hill, and S. Subramani. 1995. Import of stably folded proteins
into peroxisomes. Mol Biol Cell 6:675-683.
Wanders, R. J. 2004. Peroxisomes, lipid metabolism, and peroxisomal disorders. Mol
Genet Metab 83:16-27.
Wang, Q., L. Li, and Y. Ye. 2008. Inhibition of p97-dependent protein degradation
by Eeyarestatin I. J Biol Chem 283:7445-7454.
Weber, H. 2002. Fatty acid-derived signals in plants. Trends Plant Sci 7:217-224.
Weissman, A. M. 2001. Themes and variations on ubiquitylation. Nat Rev Mol Cell
Biol 2:169-178.
Welchman, R. L., C. Gordon, and R. J. Mayer. 2005. Ubiquitin and ubiquitin-like
proteins as multifunctional signals. Nat Rev Mol Cell Biol 6:599-609.
Weller, S., I. Cajigas, J. Morrell, C. Obie, G. Steel, S. J. Gould, and D. Valle.
2005. Alternative splicing suggests extended function of PEX26 in peroxisome
biogenesis. Am J Hum Genet 76:987-1007.
Weller, S., S. J. Gould, and D. Valle. 2003. Peroxisome biogenesis disorders. Annu
Rev Genomics Hum Genet 4:165-211.
Welte, M. A. 2007. Proteins under new management: lipid droplets deliver. Trends
Cell Biol 17:363-369.
Wiebel, F. F., and W. H. Kunau. 1992. The Pas2 protein essential for peroxisome
biogenesis is related to ubiquitin-conjugating enzymes. Nature 359:73-76.
CHAPTER 4. REFERENCES________________________________________________ 103
232.
233.
234.
235.
236.
237.
238.
239.
Williams, C., M. van den Berg, R. R. Sprenger, and B. Distel. 2007. A conserved
cysteine is essential for Pex4p-dependent ubiquitination of the peroxisomal import
receptor Pex5p. J Biol Chem 282:22534-22543.
Wilson, E. 1896. The Cell in Development and Inheritance. New York: Macmillan.
Yang, J., X. Han, and R. W. Gross. 2003. Identification of hepatic peroxisomal
phospholipase A(2) and characterization of arachidonic acid-containing choline
glycerophospholipids in hepatic peroxisomes. FEBS Lett 546:247-250.
Yao, T., and R. E. Cohen. 2002. A cryptic protease couples deubiquitination and
degradation by the proteasome. Nature 419:403-407.
Ye, Y., H. H. Meyer, and T. A. Rapoport. 2003. Function of the p97-Ufd1-Npl4
complex in retrotranslocation from the ER to the cytosol: dual recognition of
nonubiquitinated polypeptide segments and polyubiquitin chains. J Cell Biol 162:7184.
Zehmer, J. K., R. Bartz, P. Liu, and R. G. Anderson. 2008. Identification of a
novel N-terminal hydrophobic sequence that targets proteins to lipid droplets. J Cell
Sci 121:1852-1860.
Zhang, J. W., Y. Han, and P. B. Lazarow. 1993. Novel peroxisome clustering
mutants and peroxisome biogenesis mutants of Saccharomyces cerevisiae. J Cell Biol
123:1133-1147.
Zweytick, D., K. Athenstaedt, and G. Daum. 2000. Intracellular lipid particles of
eukaryotic cells. Biochim Biophys Acta 1469:101-120.
CHAPTER 5. MISCELLANEOUS____________________________________________ 104
CHAPTER 5. MISCELLANEOUS
5.1
Publications
1.
Debelyy, M. O., H. W. Platta, D. Saffian, A. Hensel, S. Thoms, H. E. Meyer, B.
Warscheid, W. Girzalsky, and R. Erdmann. 2011. Ubp15p, an ubiquitin hydrolase
associated with the peroxisomal export machinery. Journal of Biological Chemistry. In
press
2.
Debelyy, M. O., S. Thoms, M. Connerth, G. Daum, and R. Erdmann. 2011.
Involvement of the Saccharomyces cerevisiae Hydrolase Ldh1p in Lipid Homeostasis.
Eukaryot Cell 10:776-781.
3.
Platta, H. W., M. O. Debelyy, F. El Magraoui, and R. Erdmann. 2008. The AAA
peroxins Pex1p and Pex6p function as dislocases for the ubiquitinated peroxisomal
import receptor Pex5p. Biochem Soc Trans 36:99-104.
4.
Thoms, S., M. O. Debelyy, M. Connerth, G. Daum, and R. Erdmann. 2011. The
Putative Saccharomyces cerevisiae Hydrolase Ldh1p Is Localized to Lipid Droplets.
Eukaryot Cell 10:770-775.
5.
Thoms, S., M. O. Debelyy, K. Nau, H. E. Meyer, and R. Erdmann. 2008. Lpx1p is
a peroxisomal lipase required for normal peroxisome morphology. Febs J 275:504514.
CHAPTER 5. MISCELLANEOUS____________________________________________ 105
5.2
Personal contribution to the papers
1.
Debelyy, M. O., H. W. Platta, D. Saffian, A. Hensel, S. Thoms, H. E. Meyer, B.
Warscheid, W. Girzalsky, and R. Erdmann. 2011. Ubp15p, an ubiquitin hydrolase
associated with the peroxisomal export machinery. Journal of Biological Chemistry. In
press.
Planning: 70 %
Experiments: 70 %
Manuscript writing: 30 %
2.
Debelyy, M. O., S. Thoms, M. Connerth, G. Daum, and R. Erdmann. 2011.
Involvement of the Saccharomyces cerevisiae Hydrolase Ldh1p in Lipid Homeostasis.
Eukaryot Cell 10:776-781.
Planning: 80 %
Experiments: 80 %
Manuscript writing: 80 %
3.
Platta, H. W., M. O. Debelyy, F. El Magraoui, and R. Erdmann. 2008. The AAA
peroxins Pex1p and Pex6p function as dislocases for the ubiquitinated peroxisomal
import receptor Pex5p. Biochem Soc Trans 36:99-104.
Manuscript writing: 30 %
4.
Thoms, S., M. O. Debelyy, M. Connerth, G. Daum, and R. Erdmann. 2011. The
Putative Saccharomyces cerevisiae Hydrolase Ldh1p Is Localized to Lipid Droplets.
Eukaryot Cell 10:770-775.
Planning: 50 %
Experiments: 50 %
Manuscript writing: 20 %
5.
Thoms, S., M. O. Debelyy, K. Nau, H. E. Meyer, and R. Erdmann. 2008. Lpx1p is
a peroxisomal lipase required for normal peroxisome morphology. Febs J 275:504514.
Planning: 50 %
Experiments: 30 %
Manuscript writing: 20 %
CHAPTER 5. MISCELLANEOUS____________________________________________ 106
5.3
Conferences
1.
Open European Peroxisome Meeting 2006. Leuven, Belgium, 18-19 September
2006. (Poster)
2.
VAAM-Symposium: Biology of Yeast and Filamentous Fungi 2006. Bochum,
Germany, 12 October 2006. (Poster)
3.
Seventh International Meeting on AAA Proteins 2007. Royal Agricultural College,
Cirencester, United Kingdom, 9—13 September 2007. (Poster)
4.
The EMBO Meeting – Advancing the Life Sciences 2009. Amsterdam, Netherlands,
29 August – 1 September 2009. (Poster)
CHAPTER 5. MISCELLANEOUS____________________________________________ 107
5.4
Curriculum Vitae
PERSONAL DATA
Name
Mykhaylo O. Debelyy
Date of Birth
11 March 1978
Place of Birth
Dnepropetrovsk, Ukraine
Citizenship
Ukrainian
Marital Status
Married, one child
EDUCATION
July 2006 – July 2011
Ruhr-University Bochum
Institute of Physiological Chemistry
Department of System Biochemistry
Ph.D. student
Guidance by:
Prof. Dr. Ralf Erdmann
Dr. Wolfgang Girzalsky
September 1996 – August 2001
Dnepropetrovsk National University
Department of Biochemistry & Biophysics
Dipl.-Biol. &. Biochem.
Guidance by:
Prof. Dr. Natalia I. Shtemenko
Prof. Dr. Galina A. Ushakova
CHAPTER 5. MISCELLANEOUS____________________________________________ 108
5.5
Acknowledgement
Prof. Dr. Ralf Erdmann
Vishal Kalel
Alexander Neuhaus
Prof. Dr. Wolf-H. Kunau
Delia Saffian
Prof. Dr. Günter Daum
Immanuel Grimm
Fouzi El Magraoui
PD Dr. Mathias Lübben
Sohel Hasan
PD Dr. Wolfgang Schliebs
Sabrina Mindthoff
Sabrina Beck
Dr. Wolfgang Girzalsky
Rezeda Mirgalieva
Imtiaz Ali
Dr. Robert Rucktäschel
Dr. Harald W. Platta
Christiane Sprenger
Dr. Shirisha Nagotu
Sigrid Wuethrich
Dr. Christian Cizmowski
Monika Bürger
Dr. Pratima Bharti
Ülrike Freimann
Dr. David Managadze
Elisabeth Becker
Frauke Albustin
Meike Möller
Britta Stickel
CHAPTER 5. MISCELLANEOUS____________________________________________ 109
5.6
Global scientific outlook for human race
Sociology:
1.
Is it possible to create a classless society of equal possibilities for each human being,
where all people have an access to high quality food, safe environment,
accommodation, medical services, elementary and higher education and have the
possibility for individual development?
Biology:
1.
What are life and death?
2.
What is brain and what is the nature of consciousness?
3.
Is it possible to improve the limited nature of human beings?
Physics:
1.
What is the time?
1.
What is the nature of gravity and momentum?
2.
What is the nature of electric and magnetic fields?
3.
What is space and what it is filled with?
Philosophy:
1.
Is there a limit to the scientific exploration of the universe? If yes, then would it make
sense to improve the limited nature of human beings by the physical influence?