Download The structure of DNA DNA looks like a twisted ladder. The rungs on

What is DNA?
We all carry DNA in the nuclei of our cells.
Plants, animals and bacteria also have
DNA. It is the known as the “secret of life”.
DNA contains information about genetic
traits. The color of our eyes, the shape of
our faces, whether we can roll our
tongues: it’s all up to our DNA.
The structure of DNA
DNA looks like a twisted ladder. The rungs
on this ladder are bases. There are four
bases in DNA:
Adenine (A)
Thymine (T)
Cytosine (C)
Guanine (G)
The bases pair up, and they always pair in the same way:
A with T
C with G
The backbone of the DNA molecule is made up of alternating
phosphate and sugar molecules.
A DNA molecule contains thousands of bases (A,T,G,C), put together
in a particular order. When a scientist figures out a DNA sequence,
he writes it as a string of letters. So, DNA sequences look something
like this:
AATTGCTAAGCTGCGAT
- And they can go on for hundreds of lines.
The exact arrangement of these letters is the key to determining
genetic traits. In other words, their arrangement is what makes you
you, and not someone or something else.
What is a gene?
A gene is a segment of DNA. Genes are the regions of
DNA that control hereditary characteristics. If you think
about a strand of DNA containing thousands of bases,
you can imagine that many of the regions are genes,
and the genes are clustered into larger regions. Some of
the DNA is “junk DNA”, DNA for which scientists have
not yet assigned a function.
Genes are passed from parent to offspring. We inherit
DNA from both our parents, so we have a combination
of genes from both our mother and our father.
What is a mutation?
A mutation really just means a random change in a DNA
sequence. For example if the sequence
AATTGCTAAGCTGCGAT changed to
AATTGCTAAGCTGTGAT
Then one random mutation has taken place.
Mutations can be natural, or can be brought about by
chemicals or radiation.
Mutations in genes can have:
1) No effect
2) A minor effect (a small physical change, for example)
3) A serious effect (in bacteria this could be something
beneficial to them like resistance to antibiotics. Some
mutations, however, can be lethal, and result in
death).
Olivera Lab HHMI Outreach Program 2010
Paperclip DNA sequences
Form a hypothesis:
To start, find the 5 shells:
Conus magus, Conus marmoreus, Conus
circumcises, Conus omaria, Cypraea annulus.
They will be labeled 1-5.
Based on the shell morphology (visible
characteristics such as pattern, shape, size,
size of opening) try to place the snails in a
phylogenetic tree.
If you look at the box at the bottom right,
you’ll notice that the paperclip strands
match up with the sequences shown.
Hypothesis
Draw your tree here (or use the one
provided). Label the branches with the
numbers of the shells. Remember, the two
most related should be closest to each other
on the tree, while the one least related should
be further away.
Use #1 (Conus circumcises) DNA as your
“base” DNA strand. Compare all other
sequences to the base. In other words
compare #1 with #2, then #1 with #3,
then #1 with #4 etc. Put the number of
differences in sequence (mutations) in
the table under “unmatched bases”.
Use the table on the top right to compare
the DNA sequences.
1
3
DNA Sequences:
1
Step 1
Results
Using your table, draw another phylogenetic
tree (in the space below). The snail with the
largest number of mutations compared to
#1 is least related to #1. The snail with the
fewest mutations compared to #1 is most
related to #1.
2
1- Conus circumcises DNA
ACTTCTTTTATCCCTACCTG
Conus circumcises (#1 base
# unmatched
strand) DNA compared to:
bases
Test hypothesis with DNA sequence
data:
The paperclip strands are models of DNA
sequences. Each paperclip color
represents a base in the DNA. So:
Conus magus (2)
Adenine (A) = blue
Thymine (T) = grey
Guanine (G) = yellow
Cytosine (C) = red
Cypraea annulus (5)
4
Conus marmoreus (3)
Conus omaria (4)
2 – Conus magus DNA
ACTTCTTTTATCTTTACCTG
3- Conus marmoreus DNA
GCTTCTTTTGTCTTTACCTG
4 – Conus omaria DNA
GCTTCTTTTATCTTTACCTG
5- Cypreaea annulus DNA
ACTTCTCCTCTCTCTACCAG
Does the tree based on shell pattern/shape/size match the DNA sequence tree?
Activity
Materials + Method:
This should be done in groups of 5. You will need
paperclips, in 4 different colors.
Background:
These are DNA sequences taken from
the “barcode” gene sequence of 5
different snails. The gene these
sequences come from is called
cytochrome oxidase I and encodes
proteins that are part of a chain
required for respiration (an essential
process where we use oxygen to
make energy).
Scientists use the barcode gene to
identify organisms. Much as a
checkout register can identify items in
a supermarket just by reading the
scanned barcode, the idea of having a
“barcode” gene for every organism is
that a quick scan of the DNA
sequence will lead to the immediate
identification of the organism. This
particular gene, cytochrome oxidase I,
is found in many animals.
Form a hypothesis:
Before beginning the DNA sequencing, find the
five snail shells:
Conus magus, Conus marmoreus, Conus
circumcises, Conus omaria, Cypraea annulus in the
shell kit.
Based on the shell morphology (visible
characteristics such as pattern, shape, size, size of
opening) try to place the snails in a phylogenetic
tree.
Test hypothesis with DNA sequence data:
Each student should synthesise a different DNA
model strand (sequences shown right) with
paperclips. Use different colors for different
bases. For example:
Adenine (A) = blue
Thymine (T) = grey
Guanine (G) = yellow
Cytosine (C) = red
Make a table like the one shown here (right).
Compare Conus circumcises DNA to the other snail
DNA sequences. Fill out the table, counting the
number of unmatched bases.
Using your table, draw another phylogenetic tree.
The snails whose sequences are most similar to
Conus circumcises DNA are most related to Conus
circumcises (which is a fish-hunting snail).
Conus circumcises DNA
# unmatched
compared to:
bases
Conus magus
Conus marmoreus
Conus omaria
Cypraea annulus
DNA Sequences:
1- Conus circumcises DNA
ACTTCTTTTATCCCTACCTG
2 – Conus magus DNA
ACTTCTTTTATCTTTACCTG
3- Conus marmoreus DNA
GCTTCTTTTGTCTTTACCTG
4 – Conus omaria DNA
GCTTCTTTTATCTTTACCTG
5- Cypreaea annulus DNA
ACTTCTCCTCTCTCTACCAG