Download Identification of Pseudomonas proteins coordinately

Microbiology (2003), 149, 2909–2918
DOI 10.1099/mic.0.26454-0
Identification of Pseudomonas proteins
coordinately induced by acidic amino acids and
their amides: a two-dimensional electrophoresis
study
Avinash Sonawane,1 Ute Klöppner,1 Sven Hövel,2,3 Uwe Völker2,3,4
and Klaus-Heinrich Röhm1
Correspondence
Klaus-Heinrich Röhm
[email protected]
1
Philipps-University Marburg, Institute of Physiological Chemistry, D-35032 Marburg, Germany
2
Philipps-University Marburg, Department of Biology, Laboratory for Microbiology, D-35032,
Marburg, Germany
3
Max-Planck-Institute for Terrestrial Microbiology, D-35043 Marburg, Germany
4
Ernst-Moritz-Arndt-University, Medical Faculty, Laboratory for Functional Genomics, D-17487
Greifswald, Germany
Received 2 May 2003
Revised 14 July 2003
Accepted 14 July 2003
The acidic amino acids (Asp, Glu) and their amides (Asn, Gln) are excellent growth
substrates for many pseudomonads. This paper presents proteomics data indicating that growth of
Pseudomonas fluorescens ATCC 13525 and Pseudomonas putida KT2440 on these amino
acids as sole source of carbon and nitrogen leads to the induction of a defined set of proteins. Using
mass spectrometry and N-terminal sequencing, a number of these proteins were identified as
enzymes and transporters involved in amino acid uptake and metabolism. Most of them depended
on the alternative sigma factor s54 for expression and were subject to strong carbon catabolite
repression by glucose and citrate cycle intermediates. For a subset of the identified proteins, the
observed regulatory effects were independently confirmed by RT-PCR. The authors propose
that the respective genes (together with others still to be identified) make up a regulon that mediates
uptake and utilization of the abovementioned amino acids.
INTRODUCTION
Plant-growth-promoting rhizobacteria (PGPRs) are microorganisms with a potential to enhance crop yields. They can
contribute to plant growth by biofertilization, by secretion
of growth hormones or by the production of antibiotics
that control pathogenic fungi and competing bacteria
(Bloemberg & Lugtenberg, 2001). In recent years, several
groups have initiated projects with the aim of elucidating the
interactions between plant roots and rhizosphere microorganisms. In most of these studies, fluorescent pseudomonads have been used; these inhabit the rhizospheres of
most crop plants. Although progress is still slow, it is now
well established that root exudates play a central role in
plant–PGPR interactions. Exudate components are thought
to attract beneficial micro-organisms to the rhizosphere and
also to promote their survival in this special environment.
One approach to characterize the effects of exudate components on rhizobacteria is to search for bacterial genes that
are differentially expressed in the rhizosphere, or in the
Abbreviations: MALDI-PSD, -TOF, matrix-assisted laser desorption/
ionization-post source decay, -time-of-flight; PGA, periplasmic glutaminase/asparaginase.
0002-6454 G 2003 SGM
presence of root exudates (van Overbeek & van Elsas, 1995;
Bayliss et al., 1997). Although a number of such genes have
been identified, the precise roles of most of them have
remained elusive.
The main organic components of root exudates are sugars,
various organic acids and a number of amino acids (Fan
et al., 1997). Although sugars account for most of the organic
matter in exudates, there is no evidence indicating that they
play a major role in plant–bacterial interactions. Lugtenberg
et al. (1999) could not find a significant contribution of sugars
to tomato root colonization by a well-studied Pseudomonas
biocontrol strain. On the other hand, it was shown that root
exudates can induce bacterial enzymes that are involved
in the metabolism of amino acids such as proline (Vilchez
et al., 2000a, b) or lysine (Espinosa-Urgel & Ramos, 2001).
The predominant amino acids in root exudates are the acidic
amino acids aspartate (Asp) and glutamate (Glu) and their
amides asparagine (Asn) and glutamine (Gln) (Barber &
Gunn, 1974; Jones & Darrah, 1993). Glu and Gln are
key intermediates in nitrogen metabolism. In E. coli and
other enterobacteria all nitrogen-containing compounds
derive their nitrogen from Glu or Gln (Reitzer, 1996a, b).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Tue, 09 May 2017 00:28:29
Printed in Great Britain
2909
A. Sonawane and others
Nevertheless, Glu and Gln are inferior to NH+
4 in supporting the growth of enteric bacteria. In pseudomonads the
situation is different. We have recently shown that several
strains of Pseudomonas fluorescens and Pseudomonas putida
rapidly grow on acidic amino acids and their amides, even
when supplied as the sole source of carbon and nitrogen
(Sonawane et al., 2003). All of these amino acids strongly
and specifically induce periplasmic glutaminase/asparaginase (PGA) (Hüser et al., 1999). On the other hand, PGA
is subject to carbon catabolite repression by glucose and
dicarboxylic acids such as succinate, fumarate and 2oxoglutarate. A PGA knockout mutant was unable to utilize
Gln whereas growth on Glu, Asn and Asp was unimpaired.
In order to examine whether the acidic amino acids and
their amides, in addition to regulating PGA expression,
induce a more general response in pseudomonads, we used
two-dimensional polyacrylamide gel electrophoresis (2DPAGE) to compare gene expression in pseudomonads in the
presence and absence of these amino acids.
METHODS
Protein identification by N-terminal sequencing. Spots of
Bacterial strains and growth conditions. P. fluorescens ATCC
13525 or P. putida KT2440 (Bagdasarian & Timmis, 1982) and an
isogenic rpoN-null mutant of the latter strain (Köhler et al., 1989)
were used for the experiments. The cells were cultivated with
shaking at 30 uC in LB broth or in M9 minimal medium (Sambrook
et al., 1989) supplemented with various carbon and nitrogen
sources. To investigate the effect of nutrients on growth and enzyme
activity, cultures were first pregrown overnight in M9 medium supplemented with NH4Cl (19 mM) and glucose (22 mM). Then the
cells were washed and aliquots transferred to fresh M9 medium supplemented with (a) NH+
4 /glucose as above, (b) amino acids (10 mM)
as the sole source of carbon and nitrogen, or (c) glutamate
(10 mM)+alternative carbon sources (glucose, sucrose, fumarate,
2-oxoglutarate, 10 mM each).
PGA assay. Glutaminase/asparaginase (PGA) activities were measured with L-aspartic b-hydroxamate as the substrate (Derst et al.,
1992). Briefly, 20 ml enzyme solution was added to 30 ml of 1 mM
substrate in 50 mM MOPS, pH 7?0. After an incubation for
5–60 min at room temperature, the reaction was terminated and
colour developed by adding 240 ml stop solution (1 M Na2CO3 containing 2 %, w/v, 8-hydroxyquinoline in dimethyl sulfoxide and 1 %,
w/v, NaIO4). After 5 min, the A655 was measured in a Bio-Rad
3550-UV microplate reader. Protein concentrations were determined
by the BCA method using bovine serum albumin as the standard.
One unit of PGA activity is the amount of enzyme hydrolysing 1 mmol
21
L-aspartic acid b-hydroxamate min
under these conditions.
Sample preparation for 2D gel electrophoresis. Bacteria were
usually harvested 4–6 h after transfer to fresh medium and collected
by centrifugation. After washing with M9 salt solution, the pellet
was resuspended in TE/PMFS buffer (10 mM Tris, 1 mM EDTA,
0?1 mM PMSF, pH 7?5) cooled on ice and disrupted by sonication
(Sonoplus, Bandelin; 1564 s). The homogenate was centrifuged for
10 min at 10 000 r.p.m. and then twice for 30 min at 14 000 r.p.m.
Proteins were precipitated by the addition of 5 vols ice-cold acetone
(analytical grade), incubated overnight at 220 uC, and then collected
by centrifugation at 0 uC.
2D gel electrophoresis. For isoelectric focussing (IEF), proteins
were solubilized in a rehydration solution containing 8 M urea, 2 M
2910
thiourea, 4 % (w/v) CHAPS, 28 mM DTT, 1?3 % (v/v) Pharmalytes,
pH 3–10 and bromophenol blue. After rehydration for 24 h under
low-viscosity paraffin oil, Immobiline DryStrips (IPG strips 18 cm
NL; Amersham Biosciences) covering a pH range of 3–10 were subjected to isoelectric focussing with the following voltage/time profile:
linear increase from 0 to 500 V for 1000 V h, 500 V for 2000 V h,
linear increase from 500 to 3500 V for 10 000 V h and a final phase
of 3500 V for 35 000 V h up to a total of 48 000 V h. After IEF, the
individual strips were consecutively incubated in equilibration solutions A and B, each for 15 min [50 mM Tris/HCl, pH 6?8, 6 M
urea, 30 % (v/v) glycerol, 4 % (w/v) SDS, with 3?5 mg DTT ml21
(solution A); or 45 mg iodoacetamide ml21 instead of DTT
(solution B)]. In the second dimension, proteins were separated on
12?5 % SDS-polyacrylamide gels with the Investigator System
(Perkin Elmer Life Sciences) at 2 W per gel. For routine use proteins
were visualized by silver staining. Gels intended for MALDI-TOF
analysis were stained with PhastGel Coomassie R350 according to
the manufacturer’s instructions (Amersham BioSciences). Scanned
images were analysed with the Melanie3 software package (Bio-Rad)
to facilitate identification of differentially expressed spots. For quantitative densitometry the BandLeader program (Magnitec) was used.
Separate gels of each condition were analysed and only spots were
labelled that displayed the same pattern (i.e. up- or down-regulation)
in all replicates.
interest were transferred to a PVDF membrane by electroblotting
using the semi-dry method (Kyhse-Anderson, 1984). Sequencing
was performed by Dr D. Linder, Giessen.
Protein identification by peptide mass fingerprinting. Protein
spots were excised from stained 2D gels. Pooled extracts from three
to nine gels were destained and digested with trypsin (Promega).
Peptides were extracted according to Otto et al. (1996). They were
purified with C18 tips according to the manufacturer’s instructions
(Millipore) and eluted with 75 % acetonitrile/2 % trifluoroacetic acid
(v/v). Peptide solutions were mixed with an equal volume of saturated a-cyano-3-hydroxycinnamic acid solution in 50 % acetonitrile/
0?1 % trifluoroacetic acid (v/v) and applied to a sample template for
a MALDI-TOF (matrix-assisted laser desorption/ionization time-offlight) mass spectrometer. Peptide masses were determined in the
positive ion reflector mode in a Voyager DE RP mass spectrometer
(PerSeptive Biosystems) with internal calibration. Mass accuracy was
usually in the range between 10 and 50 p.p.m. Peptide mass fingerprints were compared to databases using the program MS-Fit
(http://prospector.ucsf.edu). Spots that could not be identified by
the above method were further analysed by MALDI-Post Source
Decay (PSD) sequencing (Protagen AG, Bochum, Germany).
Semi-quantitative RT-PCR. RNA was isolated from mid-exponential-
phase cells using the RNeasy minikit (Qiagen). Residual DNA was
removed by digestion for 30 min at 37 uC with 1 U ml21 RNase-free
DNase (Promega). The reaction was stopped by adding 1 ml RQ1
DNase stop solution and incubated at 65 uC for 10 min. The reverse
transcription was carried out using 1 mg RNA in a 20 ml reaction mixture containing 16 RT buffer, 0?1 mM dNTP, 50 pmol oligo(dT)
primer, 5 mM MgCl2, 20 mM DTT, 2 U RNaseOUT Recombinant
RNase inhibitor, 0?25 U SUPERSCRIPT II RT (Invitrogen). PCR was
carried out in 50 ml reaction mixtures, containing 2 ml of the RT reaction as template for Pfu Turbo DNA polymerase (0?5 U, Stratagene),
100 pmol of each primer (Table 1), 0?2 mM dNTP, and amplified for
26 cycles. The PCR sequence used was: 94 uC, 60 s; 54 uC, 30 s; 72 uC,
4 min and 72 uC, 5 min. cDNA-specific primers (listed in Table 1)
were derived from the P. putida KT2440 genome (Nelson et al., 2002).
Ten microlitres of RT-PCR products was then subjected to electrophoresis in a 1?5 % agarose gel and visualized by staining with ethidium
bromide.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Tue, 09 May 2017 00:28:29
Microbiology 149
Pseudomonas protein induction by amino acids
Table 1. Oligonucleotides used for RT-PCR experiments in this study (for, forward; rev, reverse)
Protein
Rho factor
Glutaminase/asparaginase (PGA)
ABC transporter ATP-binding protein
Gene
rho
ansB
?
Aspartase
aspA
Porin D
oprD
Fumarase C
fumC
RESULTS
Selection of strains
In a previous study we adressed the question whether amino
acids in root exudates are involved in the communication
between root-colonizing pseudomonads and their host
plants. We compared type strains of P. fluorescens and
P. putida and a number of root-colonizing pseudomonads
as to their ability to utilize amino acids as sources of carbon
and/or nitrogen (Sonawane et al., 2003). Extracts from
P. fluorescens ATCC 13525 were then used to study proteins
differentially expressed in the presence of amino acids.
While these experiments were in progress, the full genome
sequence of the efficient root colonizer P. putida KT2440
became available (Nelson et al., 2002). For this reason
P. putida KT2440 was selected for further 2D-PAGE
experiments.
Primers
for:
rev:
for:
rev:
for:
rev:
for:
rev:
for:
rev:
for:
rev:
ATCCTGCTGGACTCGATCAC
GAGCGGTTGATGTTGATGG
CTGTCCTGGGTCTTGGTCAT
GTATGGCTATGGCAACGTCA
CACATCATGGTCATGCCTTC
ACCTGACCATCACCGAGAAC
GGTTGATTTCGGTCAGCAGT
ACCTGCACCCTAACAACGAC
AGACCCGCATGCTGTATTTC
ACTGGTCACCCACTTTCAGC
ATACGGCCAGTACCCACGTA
GTAGCTGCTTGACTGCACCA
as a repressor. As described elsewhere (Sonawane et al.,
2003), PGA induction by Asn and Asp is delayed as
compared to that by Glu and Gln. Therefore, full PGA
induction by Asp or Asn was only seen in samples taken
after 24 h.
Protein production during growth of
P. fluorescens ATCC 13525 on amino acids
In order to identify further proteins differentially expressed
in the presence of acidic amino acids and/or their amides, we
Regulation of PGA expression by amino acids
and alternative carbon sources
As reported previously, the expression of periplasmic
glutaminase/asparaginase (PGA) in pseudomonads is strongly
and specifically enhanced by acidic amino acids and their
amides, while good carbon sources such as glucose or
tricarboxylic acid cycle intermediates repress PGA production (Hüser et al., 1999). Surprisingly, in P. fluorescens
ATCC 13525, Asp and Glu rather than Asn and Gln were
found to be the actual inducers, while in P. putida KT2440
the time-courses of PGA induction by Asn and Asp on the
one hand, or Gln and Glu on the other, were almost the same
(Sonawane et al., 2003).
As in P. fluorescens ATCC 13525, the expression of PGA in
P. putida KT2440 is subject to carbon catabolite repression
by good carbon sources. Fig. 1 shows the effects of sugars
(glucose, sucrose) and intermediates of the citric acid cycle
(2-oxoglutarate, fumarate) on PGA expression. Glucose,
fumarate and 2-oxoglutarate almost completely prevented
PGA induction by Glu, while sucrose, which is not
metabolized by P. putida KT2440, was much less effective
http://mic.sgmjournals.org
Fig. 1. Regulation of PGA activity in P. putida KT2440. Cells
were pre-grown overnight in M9 medium containing 22 mM
glucose and 19 mM NH4Cl (NH+
4 /Glc), washed and transferred
to the same medium or M9 medium containing 10 mM each of
glutamate (Glu), glutamine (Gln), aspartate (Asp) or asparagine
(Asn) as sole source of C and N. Other cultures were supplied
with 10 mM glutamate and 22 mM glucose (Glu+Glc), 10 mM
glutamate and 10 mM sucrose (Glu+Sucr), 10 mM glutamate
and 10 mM fumarate (Glu+Fum) or 10 mM glutamate and
10 mM 2-oxoglutarate (Glu+2-OG). Specific activities of PGA
were measured 6 h (open bars) and 24 h (filled bars) after
transfer.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Tue, 09 May 2017 00:28:29
2911
A. Sonawane and others
performed 2D-PAGE experiments with cell extracts prepared at different times (2–6 h) after transfer from NHz4 /
glucose to media containing amino acids alone or in
combination with fumarate. Fig. 2 shows such gels obtained
with P. fluorescens ATCC 13525. The extracts were prepared
6 h after transfer from NHz4 /glucose to the same medium
(Fig. 2a) or to M9 containing L-Asn (Fig. 2b), L-Asp
(Fig. 2c) or L-Asn in combination with 10 mM fumarate
(Fig. 2d). Major spots upregulated under these conditions
(Pf1–Pf6, Pf for P. fluorescens) are marked by squares and
circles.
Two of the spots marked in Fig. 2 could be assigned to
known proteins. By MALDI-TOF mass spectrometry,
protein Pf1 was identified as PGA. N-terminal sequencing
of Pf2 yielded the sequence AELTGTLKKINDXGT, which
closely matches the N-termini of several periplasmic binding
proteins associated with ABC transporters. They include
(a)
(b)
(c)
(d)
Fig. 2. Two-dimensional electrophoresis maps (pH 4–9) of soluble proteins expressed by P. fluorescencs ATCC 13525
during growth on M9 medium containing 5 mM NH4Cl and 22 mM glucose (NH+
4 /Glc, a), M9 medium supplemented with
10 mM L-asparagine (Asn, b), with 10 mM L-aspartate (Asp, c), or with 10 mM Asn and 10 mM fumarate (Asp+Fum, d).
Major protein spots upregulated in each case are marked by squares (a) or circles (b–d). Spots used as references in
densitometric measurements (see Fig. 3) are marked by arrows in (a).
2912
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Tue, 09 May 2017 00:28:29
Microbiology 149
Pseudomonas protein induction by amino acids
Spots Pf1–Pf6 responded in a similar fashion to different
carbon and nitrogen sources. Fig. 3 compares their relative
densities estimated by quantitative densitometry. Although
the extent of induction and carbon catabolite repressions
varied to some extent, the same general pattern was seen
with all spots examined. As compared to growth on NHz4 /
glucose, their expression was strongly upregulated by Asn
and Asp, while the effect of Asn was markedly reduced by
fumarate.
Density (arbitrary units)
6000
5000
4000
3000
2000
1000
Pf1
Pf2
Pf3
Pf4
Pf5
Pf6
Fig. 3. Differential protein expression during growth of P. fluorescens ATCC 13525 on different media: M9 minimal medium
supplemented with 5 mM NH4Cl and 22 mM glucose (NH+
4/
Glc), with 10 mM asparagine (Asn), with 10 mM aspartate (Asp),
or with 10 mM asparagine and 10 mM fumarate (Asn+Fum).
Cell extracts containing equal amounts of protein were analysed
by 2D gel electrophoresis. Spots Pf1–Pf6 (see Fig. 2) of each
gel were quantified by densitometry. The figure shows integrated
densities of these spots as estimated by the program BandLeader.
They were calibrated by reference to spots not significantly
affected by medium composition (marked by arrows in Fig. 2a).
the P. aeruginosa PA1342 gene product, the product of
the P. putida KT2440 gene PP1071 as well as putative
Gln-binding proteins from Bacillus subtilis (Wu & Welker,
1991) and Rhodospirillum rubrum (glnA, [gi:2599566]).
Identification of Glu-induced proteins in
P. putida KT2440
2D gels loaded with extracts from P. putida KT2440 yielded
comparable results to those seen with P. aeruginosa. A
group of 8–10 major spots were coordinately upregulated by
Glu and repressed by good carbon sources. Other proteins
were more strongly expressed in cells grown on NH+
4/
glucose. In the experiment illustrated in Fig. 4, a total of 13
spots (Pp1–Pp13, Pp for P. putida) were selected, extracted
from several gels, pooled, digested with trypsin and analysed
by MALDI-TOF or MALDI-PSD mass spectrocopy. Except
for Pp2 and Pp7, all spots could be identified and assigned
to proteins deduced from the P. putida KT2440 genome.
Table 2 summarizes the results of the mass spectrometric
analysis. The table lists the names of the encoding genes,
their known or putative functions, as well as isoelectric
points, and molecular masses calculated from the genome
data. In addition, the dependency of induction/repression
on the presence of the alternative sigma factor RpoN and the
Fig. 4. Two-dimensional electrophoresis maps (pH 4–9) of soluble proteins expressed by P. putida KT2440 during growth
on M9 medium containing 5 mM NH4Cl and 22 mM glucose (NH+
4 /Glc) and M9 medium supplemented with 10 mM
glutamate (Glu) as the sole source of C and N. Selected proteins upregulated during growth on Glu (Pp1–Pp9) and NH+
4 /Glc
(Pp10–Pp13) are marked by circles.
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Tue, 09 May 2017 00:28:29
2913
A. Sonawane and others
Table 2. Characteristics of differentially expressed protein spots in P. fluorescens ATCC 13525 (Pfn) and P. putida KT2440 (Ppn)
Spot
Identified as
Identified
by*
Locus
Induced during growth on Glu in P. fluorescens ATCC 13525
Pf1
Glutaminase/asparaginase (PGA)
PM (7)
ansB
Pf2
ABC transporter amino-acid-binding protein
Seq
(PP1071)
Induced during growth on Glu in P. putida KT2440
Pp1
Transcription termination factor Rho
PSD (12) rho (PP5214)
Pp2
Not identified
Pp3, Pp4 Glutaminase/asparaginase (PGA)
PM (11) ansB (PP2453)
Pp5
ABC transporter ATP-binding protein
PSD (2)
? (PP1068)
Pp6
Aspartate ammonia-lyase (aspartase)
PSD (7)
aspA (PP5338)
Pp7
Not identified
Pp8
Outer-membrane porin D
PSD (2) oprD (PP 1206)
Pp9
Carboxyphosphonoenolpyruvate phosphonoPSD (3)
? (PP1389)
mutase (putative)
Induced during growth on glucose+NH4Cl in P. putida KT2440
Pp10
2,4-Diaminobutyrate-2-oxoglutarate transaminase PSD (4)
gabT (PP4223)
Pp11
Fumarase
PM (7)
fumC (PP0944)
Pp12
Sugar ABC transporter sugar-binding protein
PSD (6)
(PP1015)
Pp13
Putrescine ABC transporter putrescine-binding
PSD (2)
potF (PP5181)
protein
pIcalc Masscalc
(kDa)
Expressed
in RpoN”
strain
Repressed by
fumarate
6?6
7?0
36?2D
30?7D
2
2
+
+
7?7
47?0
6?6
8?2
5?7
36?1D
28?1
51?5
4?8
5?1
46?1D
31?8
2
2
2
2
+
2
2
2
+
2
+
+
(2)
(+)
+
+
6?5
5?7
5?7
6?1
48?8
48
45?4
40?1
(+)
+
+
+
(2)
2
2
2
*PM (n), identified from peptide masses (n=number of peptides). PSD (n), identified by MALDI-PDS (n=number of matching peptides).
Seq, identified by N-terminal sequencing.
DMass calculated without leader peptide.
influence of carbon catabolite repression elicited by the
presence of fumarate in the growth medium are indicated.
RT-PCR analysis of Glu-induced gene
expression in P. putida KT2440
To ascertain whether the effects of Glu detected at the
protein level are indeed taking place at the level of
transcription, we used RT-PCR to examine the levels of
mRNA for several of the proteins differentially expressed in
the absence or presence of Glu. Total RNA was isolated from
cells grown on NH+
4 /Glc or Glu and transcribed into cDNA,
which was then amplified by PCR. Care was taken to use
equal amounts of cells (based on protein content) and
identical reaction conditions in PCR for all samples. The
primers used were derived from the KT2440 genome data.
The observed effects of Glu on the amounts of RT-PCR
amplificates (Fig. 5) showed the same general pattern as
the changes of the respective spot densities in 2D-PAGE.
Glu-responsive proteins previously identified in 2D gels (cf.
Table 2) seemed to be up-regulated on the transcriptional
level as well. The RT-PCR products corresponding to the
ABC transporter ATP-binding protein (Pp5) and aspartase
(Pp6) were not seen during growth on NH+
4 /Glc but were
readily detected during growth on Glu. The mRNAs for PGA
(Pp3), the outer-membrane porin D (Pp8) and the Rho
Fig. 5. RT-PCR analysis of gene expression
in P. putida KT2440. Total RNA was
extracted from cells grown on M9 medium
containing 5 mM NH4Cl and 22 mM glucose
(NH+
4 /Glc) and M9 medium supplemented
with 10 mM glutamate (Glu) as the sole
source of C and N. RT-PCR of the genes
indicated was carried out as described in
Methods. See Table 1 for identities of proteins.
2914
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Tue, 09 May 2017 00:28:29
Microbiology 149
Pseudomonas protein induction by amino acids
Fig. 6. Effect of Glu on protein expression in P. putida KT2440 wild-type (wt, left panel) and a mutant defective in the
alternative sigma factor s54 (RpoN”, right panel). Protein spots upregulated by Glu in the wild-type are marked by solid circles.
The corresponding spots in the mutant strain are highlighted by dashed circles.
termination factor (Pp1) were also detected in the absence of
Glu but greatly increased when the amino acid was present.
The formation of fumarase mRNA (Pp11), on the other
hand, was strongly suppressed by Glu. However, as we used
only one pair of primers per gene and did not include a
Glu-independent control gene in the RT-PCR experiments,
the results shown in Fig. 5 are still qualitative rather than
quantitative.
Many of the Glu-inducible genes require s54 for
expression
rpoN encodes the alternative sigma factor s54 (sN) which is
required for the expression of genes involved in the
utilization of alternative nitrogen and carbon sources as
well as diverse other functions (Merrick, 1993). Therefore, a
comparative proteome analysis of the wild-type strain
KT2440 (Fig. 6a) and its isogenic rpoN mutant (Fig. 6b) was
performed to investigate the rpoN-dependency of the
changes in the protein profile discussed above. As reported
by Köhler et al. (1989), an rpoN mutant of strain KT2440
displayed a severe growth defect when amino acids were
given as sole source of carbon and nitrogen. The data
presented in Fig. 6 clearly show that the accumulation of
Glu-responsive proteins was almost completely prevented in
the strain lacking RpoN, supporting the notion that
induction of their genes following transfer from NH+
4 /Glc
medium to Glu medium requires s54. The only exception
was Pp6 (aspartase), the spot density of which was similar
in the mutant (see Fig. 6).
http://mic.sgmjournals.org
To corroborate our conclusion that the Glu-responsive
proteins identified in the present study all depend on s54 for
expression, we screened the P. putida KT2440 genome to
localize potential s54 recognition sequences in the upstream
regions of the respective genes using the program PROMSCAN
(Studholme et al., 2000). s54 recognition sequences are
typically located at 212/224 relative to the start of transcription. In the consensus sequence (see Table 3) a GG and
a TG pair, both separated by 9 nucleotides, are strictly
conserved (Buck et al., 2000). For all Glu-responsive genes
identified here, sequences with the expected properties were
Table 3. Putative s54 recognition sites of Glu-responsive
genes in P. putida KT2440
Protein
Pf2
Potential s54-binding site
Gln-binding protein
TGGCACgactcATGCC*
TGGTACgcgctTTGCAD
Pp1 Rho termination factor
GGCCACgttttTTGCT
Pp3/4 Glutaminase/asparaginase
TGGTACgaaaaATGCCD
(PGA)
TGGTACaaatcCTGCT*
Pp6 Aspartate ammonia lyase
TGGCACggtgcTTGGCD
Pp8 Outer-membrane porin D
cggcacgacatctgcaD
Pp9 Phosphoenolpyruvate mutase CGGTGCgcacgTTGCGD
Consensus sequence:
TGGCACGnnnnTTGCT
*In P. fluorescens.
DIn P. putida KT2440.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Tue, 09 May 2017 00:28:29
2915
A. Sonawane and others
found at a reasonable distance (i.e. within 200 bp) from
the respective translation start sites. Of course, for an
unequivocal identification of these sites it will be necessary
to locate the transcription start in each case. So far, this has
only been done for the ansB gene of P. fluorescens ATCC
13525 (Hüser et al., 1999).
The Rho protein (spot Pp1) is known to participate in the
regulation of tryptophanase expression in E. coli: tryptophan
enhances the transcription of tryptophanase by Rhomediated antitermination (Konan & Yanofsky, 2000). It is
unknown whether comparable mechnisms also operate in
the regulation of Gln and Glu metabolism of other bacteria.
The essential role of PGA (Pf2; Pp3/4) in the utilization of
Gln by P. putida KT2440 has been established previously
(Sonawane et al., 2003). The origin of the minor spot Pp4
(cf. Fig. 4) has not yet been investigated in detail. It may
correspond to a PGA variant in which one or more Asn
or Gln residues have been degraded to the respective
dicarboxylates. However, the existence of a phosphorylated
or otherwise covalently modified form of the enzyme cannot
be excluded.
amino-acid-binding protein Pf2 (encoded by PP10171 in
P. putida KT2440) and the ATP-binding protein Pp5
(endoded by PP1068) could both belong to such a transport
system of the ABC type which possibly mediates the uptake
of the acidic amino acids and/or their amides. This
assumption is based on the genetic organization of
certain Glu-related genes in P. aeruginosa, P. putida and
P. fluorescens (see Fig. 7). In P. aeruginosa PAO1, a series of
eight consecutive genes (PA1342–PA1335) encode proteins
that all appear to be involved in the uptake and utilization
of acidic amino acids. PA1342–1339 code for an ABC
transporter that, by sequence similarity, mediates amino
acid uptake. Two subsequent genes, PA1338 and PA1337,
encode a c-glutamyltransferase and PGA (ansB), respectively, while PA1336 and PA1335 encode a two-component
system with strong similarity to dctBD, a system controlling
dicarboxylate utilization in rhizobia (Wang et al., 1989). In
P. putida KT2440, the genes for a closely related twocomponent system (PP1067–1066) are immediately adjacent to those encoding the ABC transporter mentioned
above (PP1071–1068) while the ansB gene (PP2453) and the
c-glutamyltransferase gene (PP4659) are located elsewhere.
The sequence identity between the ABC transporters of
the two strains (PP1071–1068 and PA1342–1339) is 85 %
at the protein level while the two-component systems
(PP1067–1066 and PA1336–1335) have 76 % of the amino
acid residues in common. A similar arrangement of genes
for an ABC transporter and a two-component system was
detected in the unfinished genome data of P. fluorescens
SBW25 (available at the Sanger Institute, http://www.
sanger.ac.uk/Projects/P_fluorescens/).
The
respective
open reading frames which are contained in fragment
Pflu346g05.q1kb show a very high degree of sequence
similarity to PP1065–1071. The predicted amino acid
sequence of gene 2 (see Fig. 7), which encodes a periplasmic
solute-binding protein, contains the complete N-terminal
sequence determined for spot Pf2 (i.e. AELTGTLKKINDXGT,
see Table 2), and the predicted sequence of gene 5 (the ATPbinding component of the ABC transporter) shows 93 %
identity with the predicted sequence of PP1068.
PGA hydrolyses Asn and Gln at similar rates and thus
can generate both dicarboxylates (Glu and Asp) for
uptake by transport systems in the inner membrane. The
Aspartate ammonia lyase (aspartase, Pp6) converts aspartate
to fumarate and ammonia. Under aerobic conditions this
reaction feeds the tricarboxylic acid cycle with the carbon
DISCUSSION
In the present communication we show that the growth of
P. fluorescens ATCC 13525 and P. putida KT2440 on acidic
amino acids and their amides as sole source of carbon and
nitrogen leads to the coordinated expression of a welldefined set of genes. Our data suggest (but do not prove)
that in both organisms all four amino acids (Asn, Asp, Gln
and Glu) induce the same proteins. Most of the genes
induced during growth on amino acids of this group are also
subject to carbon catabolite repression by intermediates of
the citric acid cycle and other good carbon sources. Many
of the proteins differentially expressed upon transfer from
glucose/NH+
4 to amino acids as sole carbon and nitrogen
source were shown either to be involved in sugar
metabolism or to perform functions that relate them to
amino acid uptake and metabolism.
Fig. 7. Genetic organization of Glu-related
genes in the genomes of P. putida KT2440,
P. aeruginosa PAO1 and P. fluorescens
SBW25 (see text).
2916
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Tue, 09 May 2017 00:28:29
Microbiology 149
Pseudomonas protein induction by amino acids
skeletons of Asn and Asp. In E. coli and other enterobacteria,
the enzyme also assists in anerobic fumarate respiration by
providing fumarate from aspartate. Unlike the other spots
induced by Glu, Pp6 was also expressed in the rpoN mutant
and only weakly repressed by fumarate.
The outer-membrane porin D (Pp8) facilitates the uptake of
amino acids and/or peptides by P. aeruginosa (Trias &
Nikaido, 1990). Ochs et al. (1999) further showed that oprD
expression in this organism is strongly enhanced by amino
acids (including Glu, Arg and Ala) and repressed by
succinate. The arginine-mediated induction of oprD was
mediated by the regulatory protein ArgR, whereas the
Glu-induced expression of OprD was independent of ArgR,
indicating the presence of more than a single activation
mechanism.
Unlike the proteins discussed above, Pp9, a putative
carboxyphosphonoenolpyruvate phosphonomutase, has no
apparent relation to amino acid metabolism. The only
known function of this enzyme is to catalyse a step in the
biosynthesis of the antibiotic bialaphos in Streptomyces
hygroscopicus (Lee et al., 1995). However, the deduced
amino acid sequence of Pp9 also shows similarity to more
common phosphopyruvate hydratases from intermediary
metabolism (e.g. enolase; Lee et al., 1995). Thus, the
annotation of PP1389 as a PEP phosphonomutase may be
erroneous. Further experiments are required to characterize
the role of Pp9 in P. putida KT2440.
The proteins upregulated during growth on NHz
4 /glucose
(Pp10–Pp13) can be related to the uptake and degradation
of glucose (Pp11, Pp12) or diamines, respectively (Pp10 and
Pp13). The transaminase Pp10 was shown to catalyse a step
in the biosynthesis of 1,3-diaminopropane by Acinetobacter
baumannii (Ikai & Yamamoto, 1997). However, other
functions appear to be possible as well, for instance the
synthesis of Glu from 2,4-diaminobutyrate.
The increased synthesis of a sugar uptake system during
growth on glucose (spot Pp12) is not surprising, while the
upregulation of putrescine uptake (Pp13, gene: potF) is
more difficult to explain. Putrescine, a component of root
exudates, was shown to inhibit growth of P. fluorescens
WCS365 and its ability to colonize tomato roots (Kuiper
et al., 2001). Sauer & Camper (2001), studying changes in
gene expression during attachment of P. putida to surfaces,
found that 15 proteins were upregulated following bacterial
adhesion and 30 proteins were downregulated. The downregulated proteins include the potF gene product (Pp13) as
well as PGA (Pp3/4) and other proteins involved in amino
acid uptake and metabolism. Although these findings are
difficult to interpret at present, they support the notion that
profound changes in the metabolism of amino acids and
polyamines accompany the change from free-living to sessile
growth in pseudomonads.
Our present data further indicate that most of the proteins
upregulated by Glu depend on the alternative sigma factor
http://mic.sgmjournals.org
s54 (RpoN) for expression. With the possible exception of
aspartase (Pp6), none of the Glu-responsive proteins was
synthesized in an RpoN2 mutant of strain KT2440. As a
result of this diminished presence of amino-acid-metabolizing enzymes, this strain exhibits a severe growth defect in
media lacking glucose and NH4Cl (Köhler et al., 1989). It is
now well established that activation of the s54–RNA
polymerase holoenzyme requires additional enhancerbinding proteins with ATPase activity to stimulate transcription (Buck et al., 2000). The function of these proteins
is to facilitate conversion of the closed promoter complex to
an open one. Usually the enhancer proteins are so-called
response regulators i.e. proteins that transmit environmental signals from a membrane-bound sensor kinase to the
transcription complex (Chang & Stewart, 1998). A set of
individual genes and/or operons controlled by one and the
same response regulator is called a regulon. In our opinion,
the present data indicate that the P. putida proteins
upregulated by acidic amino acids and their amides (and
other proteins not yet identified) may all be products of
a regulon responsible for their uptake and metabolism.
In order to substantiate this hypothesis, it has to be
demonstrated that a single response regulator binds to and
enhances transcription of these genes. Experiments aiming
at the identification of such a response regulator are now
under way in our laboratory.
REFERENCES
Bagdasarian, M. & Timmis, K. N. (1982). Host-vector systems
for gene cloning in Pseudomonas. Curr Top Microbiol Immunol 96,
47–67.
Barber, D. A. & Gunn, K. B. (1974). The effect of mechanical forces
on the exudation of organic substances by the roots of cereal plants
grown under sterile conditions. New Phytol 73, 39–45.
Bayliss, C., Bent, E., Culham, D. E., MacLellan, S., Clarke, A. J.,
Brown, G. L. & Wood, J. M. (1997). Bacterial genetic loci implicated
in the Pseudomonas putida GR12–2R3-canola mutualism: identification of an exudate-inducible sugar transporter. Can J Microbiol 43,
809–818.
Bloemberg, G. V. & Lugtenberg, B. J. (2001). Molecular basis of
plant growth promotion and biocontrol by rhizobacteria. Curr Opin
Plant Biol 4, 343–350.
Buck, M., Gallegos, M. T., Studholme, D. J., Guo, Y. & Gralla, J. D.
(2000). The bacterial enhancer-dependent s54 (sN) transcription
factor. J Bacteriol 182, 4129–4136.
Chang, C. & Stewart, R. C. (1998). The two-component system.
Regulation of diverse signaling pathways in prokaryotes and
eukaryotes. Plant Physiol 117, 723–731.
Derst, C., Henseling, J. & Röhm, K. H. (1992). Probing the role of
threonine and serine residues of E. coli asparaginase II by site specific
mutagenesis. Protein Eng 5, 785–789.
Espinosa-Urgel, M. & Ramos, J. L. (2001). Expression of a
Pseudomonas putida aminotransferase involved in lysine catabolism
is induced in the rhizosphere. Appl Environ Microbiol 67, 5219–5224.
Fan, T. W., Lane, A. N., Pedler, J., Crowley, D. & Higashi, R. M.
(1997). Comprehensive analysis of organic ligands in whole root
exudates using nuclear magnetic resonance and gas chromatographymass spectrometry. Anal Biochem 251, 57–68.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Tue, 09 May 2017 00:28:29
2917
A. Sonawane and others
Hüser, A., Klöppner, U. & Röhm, K. H. (1999). Cloning, sequence
analysis, and expression of ansB from Pseudomonas fluorescens,
encoding periplasmic glutaminase/asparaginase. FEMS Microbiol Lett
178, 327–335.
Ikai, H. & Yamamoto, S. (1997). Identification and analysis of a gene
encoding L-2,4-diaminobutyrate: 2-ketoglutarate 4-aminotransferase
involved in the 1,3-diaminopropane production pathway in
Acinetobacter baumannii. J Bacteriol 179, 5118–5125.
Jones, D. L. & Darrah, P. R. (1993). Influx and efflux of amino acids
from Zea mays L. roots and their implications for N-nutrition and
the rhizosphere. Plant Soil 155, 87–90.
Köhler, T., Harayama, S., Ramos, J. L. & Timmis, K. N. (1989).
Involvement of Pseudomonas putida RpoN s factor in regulation of
various metabolic functions. J Bacteriol 171, 4326–4333.
Konan, K. V. & Yanofsky, C. (2000). Rho-dependent transcription
termination in the tna operon of Escherichia coli: roles of the boxA
sequence and the rut site. J Bacteriol 182, 3981–3988.
Kuiper, I., Bloemberg, G. V., Noreen, S., Thomas-Oates, J. E. &
Lugtenberg, B. J. (2001). Increased uptake of putrescine in the
rhizosphere inhibits competitive root colonization by Pseudomonas
fluorescens strain WCS365. Mol Plant–Microbe Interact 14, 1096–1104.
Kyhse-Anderson, J. (1984). Electroblotting of multiple gels. A
simple apparatus with buffer tank for rapid transfer of proteins from
polyacrylamide to nitrocellulose. J Biochem Biophys Methods 10, 105–132.
Lee, S. H., Hidaka, T., Nakashita, H. & Seto, H. (1995). The
carboxyphosphonoenolpyruvate synthase-encoding gene from the
bialaphos-producing organism Streptomyces hygroscopicus. Gene 153,
143–144.
Lugtenberg, B. J., Kravchenko, L. V. & Simons, M. (1999). Tomato
seed and root exudate sugars: composition, utilization by
Pseudomonas biocontrol strains and role in rhizosphere colonization.
Environ Microbiol 1, 439–446.
Merrick, M. J. (1993). In a class of its own – the RNA polymerase
sigma factor s54 (sN). Mol Microbiol 10, 903–909.
Nelson, K., Paulsen, I., Weinel, C. & 39 other authors (2002).
Complete genome sequence and comparative analysis of the metabolically versatile Pseudomonas putida KT2440. Environ Microbiol 4,
799–808.
Ochs, M. M., Lu, C. D., Hancock, R. E. & Abdelal, A. T. (1999). Amino
acid-mediated induction of the basic amino acid-specific outer
membrane porin OprD from Pseudomonas aeruginosa. J Bacteriol
181, 5426–5432.
Otto, A., Thiede, B., Müller, E. C., Scheler, C., Wittmann-Liebold, B.
& Jungblut, P. (1996). Identification of human myocardial proteins
2918
separated by two-dimensional electrophoresis using an effective
sample preparation for mass spectrometry. Electrophoresis 17,
1643–1650.
Reitzer, J. L. (1996a). Sources of nitrogen and their utilization. In
Escherichia coli and Salmonella typhimurium: Cellular and Molecular
Biology, 2nd edn, pp. 380–390. Washington, DC: American Society
for Microbiology.
Reitzer, L. J. (1996b). Ammonia assimilation and the biosynthesis of
glutamine, glutamate, aspartate, asparagine, L-alanine, and D-alanine.
In Escherichia coli and Salmonella: Cellular and Molecular Biology,
2nd edn. Washington, DC: American Society for Microbiology.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning:
a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory.
Sauer, K. & Camper, A. K. (2001). Characterization of phenotypic
changes in Pseudomonas putida in response to surface-associated
growth. J Bacteriol 183, 6579–6589.
Sonawane, A., Klöppner, U., Derst, C. & Röhm, K. H. (2003).
Utilization of acidic amino acids and their amides by pseudomonads:
role of periplasmic glutaminase-asparaginase. Arch Microbiol 179,
151–159.
Studholme, D. J., Buck, M. & Nixon, T. (2000). Identification of
potential sN-dependent promoters in bacterial genomes. Microbiology
146, 3021–3023.
Trias, J. & Nikaido, H. (1990). Protein D2 channel of the
Pseudomonas aeruginosa outer membrane has a binding site for
basic amino acids and peptides. J Biol Chem 265, 15680–15684.
van Overbeek, L. S. & van Elsas, J. D. (1995). Root exudate-induced
promoter activity in Pseudomonas fluorescens mutants in the wheat
rhizosphere. Appl Environ Microbiol 61, 890–898.
Vilchez, S., Manzanera, M. & Ramos, J. L. (2000a). Control of
expression of divergent Pseudomonas putida put promoters for
proline catabolism. Appl Environ Microbiol 66, 5221–5225.
Vilchez, S., Molina, L., Ramos, C. & Ramos, J. L. (2000b). Proline
catabolism by Pseudomonas putida: cloning, characterization, and
expression of the put genes in the presence of root exudates.
J Bacteriol 182, 91–99.
Wang, Y. P., Birkenhead, K., Boesten, B., Manian, S. & O’Gara, F.
(1989). Genetic analysis and regulation of the Rhizobium meliloti
genes controlling C4-dicarboxylic acid transport. Gene 85, 135–144.
Wu, L. & Welker, N. E. (1991). Cloning and characterization of a
glutamine transport operon of Bacillus stearothermophilus NUB36:
effect of temperature on regulation of transcription. J Bacteriol 173,
4877–4888.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Tue, 09 May 2017 00:28:29
Microbiology 149