* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Biology
Frameshift mutation wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
RNA interference wikipedia , lookup
Non-coding DNA wikipedia , lookup
Point mutation wikipedia , lookup
Transfer RNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Polyadenylation wikipedia , lookup
RNA silencing wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Expanded genetic code wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
History of RNA biology wikipedia , lookup
Messenger RNA wikipedia , lookup
Non-coding RNA wikipedia , lookup
RNA-binding protein wikipedia , lookup
Genetic code wikipedia , lookup
12–3 RNA and Protein Synthesis 12-3 RNA and Protein Synthesis Slide 1 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis 12–3 RNA and Protein Synthesis DNA is located in the nucleus. DNA is impermeable to the nuclear envelope. Genes are segments of DNA which code for the production of proteins. Ribosomes outside the nucleus make the proteins. Slide 2 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis Do you see a problem with this scenario? Slide 3 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis RNA is the solution to this problem. RNA is DNA’s main man. RNA is DNA’s “go to guy”. RNA is DNA’s number one “get it done person”. One of RNA’s jobs is to copy DNA’s instructions and take those instructions out of the nucleus to the ribosomes. Slide 4 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis The Structure of RNA The Structure of RNA 1. RNA is a type of nucleic acid which is made up of a long chain of nucleotides. 2. Each nucleotide, like DNA, is made up of a: 1. 5-carbon sugar, 2. phosphate group 3. nitrogenous base. (Sounds familiar..........just like DNA’s nucleotides) Slide 5 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis The Structure of RNA There are three main differences between RNA and DNA: • 1. The sugar in RNA is ribose instead of deoxyribose. • 2. RNA is a single-strand of nucleotides. • 3. RNA contains uracil in place of thymine. Slide 6 of 39 Copyright Pearson Prentice Hall Types of RNA There are three types of RNA • 1. messenger RNA ~ mRNA • 2. ribosomal RNA ~ rRNA • 3. transfer RNA ~ tRNA Slide 7 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis Types of RNA Messenger RNA (mRNA) copies DNA’s code for making proteins and takes it’s copy to the ribosomes. Slide 8 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis Types of RNA Ribosome Ribosomal RNA Ribosomal RNA (rRNA) is the main component of a ribosome. rRNA is bound into two “round” units by proteins to form the large and small subunits which Slide make up a ribosome. 9 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis Types of RNA Amino acid Transfer RNA Transfer RNA (tRNA) transfers specific amino acids to the ribosome for the making of the proteins. Slide 10 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis Transcription What is transcription? Slide 11 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis Transcription Transcription RNA copies DNA’s code in its own language and take the code to the ribosomes to make proteins. Transcription requires the enzyme RNA polymerase. Slide 12 of 39 Copyright Pearson Prentice Hall Steps to Transcription: 1.During transcription, RNA polymerase attaches to DNA and separates the DNA strands. Slide 13 of 39 Copyright Pearson Prentice Hall 2. RNA polymerase then adds RNA nucleotides to one side of the DNA molecule/the sense side of DNA. -DNA is a double strand of nucleotides BUT only one side of the DNA molecule actually codes for making proteins. Slide 14 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis 2 strands of DNA 1. Sense side: Has code for making proteins. 2. Antisense side: Has no code~ makes no sense. Slide 15 of 39 Copyright Pearson Prentice Hall 3. RNA nucleotides are added to the sense side of DNA following the base pair rule: Guinine bonds to Cytosine and Uracil bonds to Adenine Sense side of DNA A T G G C U A C C G T A C Copyright Pearson Prentice Hall C G Slide 16 of 39 12–3 RNA and Protein Synthesis 4. This single strand of RNA is now known as messenger RNA or mRNA and it now has a copy of DNA’s code for making proteins. Slide 17 of 39 Copyright Pearson Prentice Hall 5. Since mRNA is single stranded it can now take a copy of DNA’s code out of the nucleus to the ribosomes. Slide 18 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis Transcription Hyperlink RNA RNA polymerase DNA Slide 19 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis The Genetic Code Protein Synthesis: The process of using mRNA’s copy of DNA’s code to make all necessary proteins. Takes place where? -at the ribosomes Slide 20 of 39 Copyright Pearson Prentice Hall Proteins are made up of: -long chains of amino acids Total number of different amino acids that make up all proteins: -20 Slide 21 of 39 Copyright Pearson Prentice Hall These 20 different amino acids bond in various orders (like the letters of the alphabet) to create all proteins. Slide 22 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis The Genetic Code A codon consists of three RNA nucleotides in a row on mRNA that code for a particular amino acid. Slide 23 of 39 Copyright Pearson Prentice Hall Slide 24 of 39 Copyright Pearson Prentice Hall Start codon: Three nitrogen bases in a row on mRNA that starts EVERY protein…..AUG Amino acid Methionine starts every protein Slide 25 of 39 Copyright Pearson Prentice Hall Stop codon: Three nitrogen bases in a row on mRNA that ends every protein. Three different codons: UAA, UAG, UGA Stop codon do not code for any amino acid Slide 26 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis Translation What is translation? Slide 27 of 39 Copyright Pearson Prentice Hall Translation Translation: -Process by which the ribosome reads mRNA’s code and makes a protein. Slide 28 of 39 Copyright Pearson Prentice Hall Translation Steps of translation: 1. mRNA leaves the nucleus and take its code to the ribosomes. Nucleus mRNA Slide 29 of 39 Copyright Pearson Prentice Hall 2. Ribosome attaches to mRNA and moves along it looking for a start codon/AUG. 3. Transfer RNA/tRNA travels through the cytoplasm locating the appropriate amino acid. Slide 30 of 39 Copyright Pearson Prentice Hall Anticodon: anti = opposite An anticodon is three nitrogen bases on the end of tRNA . Its code is opposite of mRNA’s codon. Slide 31 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis Translation 4. As the ribosome reads one codon at a time, tRNA brings down the appropriate amino acid. Phenylalanine tRNA Lysine Methionine Ribosome mRNA Slide 32 of 39 Start codon Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis Translation 5. Amino acids bind together with peptide bonds forming a long chain. Lysine tRNA Translation direction mRNA Ribosome Copyright Pearson Prentice Hall Slide 33 of 39 Translation 6. After a tRNA delivers its amino acid, it breaks away and goes out to find a new amino acid. 7. The process continues until the ribosome reads a stop codon. Polypeptide Ribosome tRNA mRNA Copyright Pearson Prentice Hall Slide 34 of 39 8. The long chain of amino acids -now a polypeptide/protein -breaks away and goes where? -to the golgi -Why to the golgi? -to be processes and to be given its 3-D shape Slide 35 of 39 Copyright Pearson Prentice Hall Codon Review: The sequence of bases in DNA is used as a template for mRNA. Codon Codon Single strand of DNA Codon Codon Codon The codons of mRNA specify the sequence of amino acids in a protein. mRNA Alanine Arginine Leucine Amino acids within a polypeptide Copyright Pearson Prentice Hall Slide 36 of 39 Hyperlink of translation Slide 37 of 39 Copyright Pearson Prentice Hall Sense Strand of DNA: CCAGTATACCCGAGTACCCCGCAGGAGCACCAGGAATTCCGCCATACACGCCCATCCCCACTCGAAAAAAAAAA TATA Box Poly-a-tail Promoter Region Termination Region Site where transcription begins Site where transcription ends. Start of a gene End of gene Primary mRNA or preRNA: Intron Exon Intron Exon Intron I------------------I------------------------------------------------I------------I-----------------------I-------------------------------------I AUAUGGGCUCAUGGGGCGUCCUCGUGGUCCUUAAGGCGGUAUGUGCGGGUAGGGGUGAGCUUUUUUUUUU Start codon Tells ribosome to start making protein Stop codon Start codon Stop codon Tells ribosome to stop making protein Mature mRNA: Exon Exon I-----------------------------------------------I-----------------------I AUGGGGCGUCCUCGUGGUCCUUAAAUGUGCGGGUAG Slide 38 of 39 Copyright Pearson Prentice Hall New vocabulary: Gene: has code for making 1 or more proteins. TATA box: code on DNA that tells mRNA to start the process of transcription. The start of a gene. Poly A tail: code on DNA that tells mRNA to stop the process of transcription. The end of a gene. AUG: code on mRNA that tells the ribosome to start making a protein UAA, UAG, UGA: code on mRNA that tells the ribosome to stop making a protein Copyright Pearson Prentice Hall Slide 39 of 39 Exon: mRNA that codes for one protein, it is the segment that will be EXPRESSED Intron: noncoding segments of mRNA that does not code for a protein, it is mRNA that copied junk DNA. It will be SLICED out Only the exons are taken to the ribosomes, so the ribosome only reads mRNA that codes for amino acids and nothing else. Slide 40 of 39 Copyright Pearson Prentice Hall Sense Strand of DNA: CCAGTATACCCGAGTACCCCGCAGGAGCACCAGGAATTCCGCCATACACGCCCATCCCCACTCGAAAAAAAAAA TATA Box Poly-a-tail Promoter Region Termination Region Site where transcription begins Site where transcription ends. Start of a gene End of gene Primary mRNA: Intron Exon Intron Exon Intron I------------------I------------------------------------------------I------------I-----------------------I-------------------------------------I AUAUGGGCUCAUGGGGCGUCCUCGUGGUCCUUAAGGCGGUAUGUGCGGGUAGGGGUGAGCUUUUUUUUUU Start codon Tells ribosome to start making protein Stop codon Start codon Stop codon Tells ribosome to stop making protein Mature mRNA: Exon Exon I-----------------------------------------------I-----------------------I AUGGGGCGUCCUCGUGGUCCUUAAAUGUGCGGGUAG Slide 41 of 39 Copyright Pearson Prentice Hall Mature mRNA: Exon Exon I-----------------------------------------------I-----------------------I AUGGGGCGUCCUCGUGGUCCUUAAAUGUGCGGGUAG Protein 1 Protein 2 Finally, mature mRNA is prepared by adding a protective cap to each end to protect it from harmful enzymes in a cells cytoplasm. Copyright Pearson Prentice Hall Slide 42 of 39 DNA Codon mRNA codon tRNA anticodon Amino Acid AAA UUU AAA PHENYL GTC GGA GLYCINE METH/START GAT GUG VALINE Slide 43 of 39 Copyright Pearson Prentice Hall CHNOPS LAB DNA: TAC AGG GCG ATT mRNA:____________________ tRNA:______________________ Amino Acid sequence: ____________________________________ Trait: _____________________ AMINO ACID SEQUENCE TRAIT Methionine-threonine-glycine-tyrosine- Hairless Methionine- threonine-glycine-glycine Hairy Methionine- threonine-proline-proline Plump Methionine- tyrosine-glycine-lysine Skinny Methionine-serine-arginine Four-eyed Methionine-serine-tyrosine Two-eyed Methionine-glycine-arginine-lysine-proline Long nose Methionine- proline-arginine-lysine-proline Short nose Methionine-phenylalanine-lysine No freckles Methionine- phenylalanine-asparagine Freckles Methionine- glycine-arginine-arginine Blue skin Methionine- glycine-arginine-phenylalanine Orange skin Methionine-isoleucine-isoleucine-leucine Male Methionine-isoleucine-isoleucine-glycine Female Copyright Pearson Prentice Hall Slide 44 of 39 Processing pre-mRMA into mature mRNA: 1. Cut out sections 1-3 of DNA and tape together in order. Section 1 C G G C T A A T Section 2 T A T A T A Section 3 A A A T T T G C C G A T A T A T T A A T C G G C A T A T T A T A A T A T A T T A A T T A C G A T T A G C A T C G C G T A A T A T T A C G A T T A C G G C A T A T T A A T G C A T T A T A C G C G A T C G T A G C G C G C T A A T A T T A T A T A G C T A T A C G A T G C Slide 45 of 39 Copyright Pearson Prentice Hall 2. Locate the beginning of the gene on the sense side of DNA (Top line) and underline it. How? TATA Box 3. Locate the end of the gene on the sense side of DNA and underline it. How? poly-A-tail Slide 46 of 39 Copyright Pearson Prentice Hall 4. Act like RNA polymerase….. How? Use your scissors to cut apart the sense and antisense sides of DNA beginning at the end of the TATA and going to the beginning of the poly-A-tail. Section 1 C G T A G A T A T A G C A T C T A T A T A T A T A T G C T T A C A T G A C A T G A A T T C C G A A T G T A C T G T A C T T A A G Slide 47 of 39 Copyright Pearson Prentice Hall 5. Number the DNA nucleotides 1-54 (start at end of TATA and to the beginning of the polya-tail. 6. Put in slashes, dividing it into 3’s or codons. Section 1 C G T A G A T A T A G C A T C T A T A T A T A T A T G C T T A C A T G A C A T G A A T T C C G A A T G T A C T G T A C T T A A G Slide 48 of 39 Copyright Pearson Prentice Hall 7. Cut out the two sections of pre-RNA and tape together. Put in slashes, dividing it into 3’s or codons. 8. Complete the process of transcription. How? You now have just made pre-mRNA Slide 49 of 39 Copyright Pearson Prentice Hall 9. Locate the beginning of a protein. How? Start codon AUG 10.Locate the end of a protein. How? Stop codon UAA UAG UGA 11. Locate the next set of start and stop codons. Copyright Pearson Prentice Hall Slide 50 of 39 12.Label the introns and exons. Introns: Non coding Exons: Express……codes for a protein 13.Cut out the introns. 14.Tape together the exons. 15.Add a protective 5’ cap to the front and a protective poly-A-tail tail to the end. These protect the mature mRNA from harmful enzymes in the cytoplasm. Copyright Pearson Prentice Hall Slide 51 of 39