Download "RNA Interference in Caenorhabditis elegans".

RNA Interference in Caenorhabditis
elegans
UNIT 26.3
Darryl Conte, Jr.,1 Lesley T. MacNeil,2 Albertha J.M. Walhout,2
and Craig C. Mello1,3
1
RNA Therapeutics Institute and Program in Molecular Medicine, University of
Massachusetts Medical School, Worcester, Massachusetts
2
Programs in Systems Biology and Molecular Medicine, University of Massachusetts
Medical School, Worcester, Massachusetts
3
Howard Hughes Medical Institute, Chevy Chase, Maryland
RNAi has become an essential tool in C. elegans research. This unit describes
procedures for RNAi in C. elegans by microinjecting with dsRNA, feeding
with bacteria expressing dsRNA, and soaking in dsRNA solution, as well as
C 2015 by John Wiley &
high-throughput methods for RNAi-based screens. Sons, Inc.
Keywords: RNAi r microinjection r feeding r soaking r high-throughput
screening assays r C. elegans
How to cite this article:
Conte, D., MacNeil, L.T., Walhout, A.J.M., and Mello, C.C., 2015.
RNA Interference in Caenorhabditis elegans. Curr. Protoc. Mol.
Biol. 109:26.3.1-26.3.30.
doi: 10.1002/0471142727.mb2603s109
INTRODUCTION
The nematode C. elegans is a useful genetic model system to study a variety of biological
processes (see Wood, 1988; Hope, 1999). Embryonic development, from fertilization to
hatching, occurs in just 12 hr at room temperature, resulting in a first-stage larva with
just over 550 cells. Newly hatched larvae progress through four larval molts to reach
adulthood in 3 days, and adult hermaphrodites produce 300 self-progeny over the
next 3 days. Both larval and adult worms have remarkably simple anatomies, consisting
of an inner tube comprising the pharynx and intestine, surrounded by a hydrostatic,
fluid-filled body cavity and an outer tube that consists of the musculature, hypodermis,
and a collagenous cuticle. Remarkably, the diverse tissues that comprise the adult are
specified by a total of only 1000 somatic cells. Due to the highly stereotyped celldivision patterns, the origins and fates of each cell in the embryo and adult are known
(Sulston and Horvitz, 1977; Sulston et al., 1983). Consequently, perturbations of the
developmental program can be traced to changes in the fates of individual cells.
The ability to generate mutants in C. elegans has made this species a powerful model
genetic organism. Since its discovery, RNA interference (RNAi) has become an important
tool for C. elegans research and the scientific community in general. RNAi is a potent,
specific, rapid, and simple method for determining loss-of-function phenotypes of genes
in C. elegans, and has been the basis of several genome-wide screens (Fraser et al., 2000;
Gonczy et al., 2000; Piano et al., 2000; Maeda et al., 2001; Ashrafi et al., 2003; Kamath
et al., 2003, Watson et al., 2013). RNAi is also an excellent way to examine genetic
interactions. For example, a dsRNA of interest can be delivered to a battery of mutants
that potentially represent sensitized genetic backgrounds (Lehner et al., 2006b; Byrne
Gene Silencing
Current Protocols in Molecular Biology 26.3.1-26.3.30, January 2015
Published online January 2015 in Wiley Online Library (wileyonlinelibrary.com).
doi: 10.1002/0471142727.mb2603s109
C 2015 John Wiley & Sons, Inc.
Copyright 26.3.1
Supplement 109
et al., 2007). Thus, even though RNAi in wild-type animals fails to give a phenotype,
one might detect suppression or enhancement of phenotypes in mutant strains.
In C. elegans, RNAi can be induced by delivering dsRNA by microinjection (see Basic
Protocol 1 and Alternate Protocol 1), feeding (see Basic Protocols 2, 3, and 4 and
Alternate Protocol 2), or soaking (see Basic Protocol 5). Though not covered in this unit,
RNAi can also be induced by in vivo transcription of dsRNA from hairpin or co-injected
sense and antisense transgenes (promoter-driven RNAi; Tabara et al., 1999; Tavernarakis
et al., 2000). In the microinjection and soaking protocols, in vitro preparations of dsRNA
are delivered mechanically using a needle to inject dsRNA directly into the body or
passively by soaking worms in dsRNA solution. In the feeding protocols, dsRNA is
transcribed in E. coli and ingested by animals. The protocols provided in this unit are
meant to help the novice at worm culture select and apply the appropriate RNAi delivery
method. Toward that end, protocols are also provided for transferring and propagating
(see Support Protocol 1) and for sexing and mating (see Support Protocol 2) C. elegans.
References for more in-depth discussion of these topics as well as C. elegans in general
are provided at the end of the unit (see Key References and Internet Resources).
The RNAi method of choice depends on the experimental goal. Though it can be technically challenging at first, microinjection of dsRNA offers a quick turnaround, since
dsRNA can be prepared in vitro using a PCR product as a template and stored at −80°C,
and special bacterial strains or plates are not required. It is also possible to simultaneously
inhibit two or more genes by co-injecting a mixture of dsRNAs (Dudley et al., 2002).
Feeding dsRNA is simple and requires no special microinjection system. Furthermore,
by feeding dsRNA to a large population of worms, a sufficient volume of mutant lysate
can be obtained for biochemical extracts or molecular analyses, such as immunoprecipitation. RNAi-based genetic screens, including whole-genome screens, can be performed
in microtiter format by feeding or soaking worms with dsRNA (Fraser et al., 2000;
Maeda et al., 2001). In principle, promoter-driven RNAi can be used to silence a gene
in a constitutive or regulated fashion, depending on the promoter used to drive dsRNA
synthesis and if the transgene is integrated into the genome.
NOTE: All solutions and equipment coming into contact with organisms must be sterile,
and proper sterile technique should be used accordingly.
NOTE: In this unit, the term “egg” is synonymous with “embryo.”
BASIC
PROTOCOL 1
RNA Interference
in C. elegans
MICROINJECTING WORMS WITH dsRNA
Using a capillary needle, dsRNA can be microinjected anywhere into the body of a
worm, and RNAi will spread systemically throughout the injected animal, including the
germline, and thereby into the next generation (Fire et al., 1998). To perform RNAi by
microinjection, it is essential to have access to a microscope equipped with a micromanipulator for holding and maneuvering the microinjection needle. Because it is not
necessary to deliver dsRNA directly to the germline, however, injections need not be
performed at high magnification or using differential interference contrast microscopy
(DIC; Nomarski optics). Therefore, even if expertise in C. elegans microinjection is
unavailable, it should be possible to master dsRNA microinjection with only a few hours
of practice.
In this procedure, healthy L4 or adult hermaphrodites are immobilized under halocarbon
oil on a dry agarose pad and microinjected with dsRNA, causing the body of the animal
to noticeably inflate with the dsRNA solution. Injected animals are removed from the
pad using a mouth pipet and a small amount of sterile M9 buffer, and then placed onto
a C. elegans culture dish. After a period of recovery, animals that have moved (i.e., are
26.3.2
Supplement 109
Current Protocols in Molecular Biology
alive) are transferred to individual plates and allowed to lay eggs for several days. The
injected animals and their progeny are examined/scored for phenotypes resulting from
gene silencing. In a successful RNAi by microinjection experiment, ten viable injected
hermaphrodites should be recovered to obtain a high degree of confidence in the results.
In addition to the standard equipment for manipulating worms (e.g., stereomicroscope,
platinum wire pick, media; Hope, 1999), this procedure requires microinjection equipment, including an inverted microscope equipped with a 10× objective, micromanipulator, N2 gas, and microinjection assembly to regulate the pressure and flow of the microinjection solution. The procedure described here utilizes a Nikon inverted microscope
equipped with 10× objectives, gliding stage, and Narishige MN151 micromanipulator
with fine z-axis adjustments, as well as a Tritech microinjector system for pressurizing
the microinjection needle. Injections are normally carried out using the 10× objective for
a total magnification of 100×. As noted above, it should be possible, with some practice,
to perform microinjections with a range of different microinjection systems.
NOTE: The experimenter should become familiar with the microinjection setup before
proceeding with the experiment.
Materials
0.1 to 1 μg/μl dsRNA
Halocarbon oil Series 700 (Halocarbon Products)
L4 to young-adult staged C. elegans (e.g., strain N2; CGC)
M9 buffer (see recipe)
NGM plates seeded with E. coli (see recipe)
Loading capillary (see recipe)
Microinjection needle (see recipe)
Inverted microscope (Nikon) with micromanipulator and microinjection assembly
with N2 gas supply (e.g., TRITECH Research Microinjector System)
Agarose microinjection pads (see recipe)
30-mm Petri dish lid
Dissecting microscope
Platinum wire pick flattened at the end
Additional reagents and materials for transferring and propagating C. elegans (see
Support Protocol 1)
Load and mount the microinjection needle
1. Pellet insoluble material that may clog the microinjection needle by centrifuging the
0.1 to 1 μg/μl dsRNA solution 5 min at 10,000 × g, 20°C.
2. Touch the drawn-out end of the Pasteur pipet portion of the loading capillary to
the dsRNA solution, allowing a small volume to be drawn into the pipet. Deposit
the RNA solution just behind the drawn-out tip of the needle by threading the
loading pipet all the way into the needle and gently blowing through the mouth pipet
(Fig. 26.3.1).
Needles can be loaded and stored up to several hours inside a humidifying chamber
constructed from a Petri dish containing a wet piece of filter paper. It is often prudent
to load two needles for each microinjection solution and store one in the humidifying
chamber as a backup in case of problems.
3. Attach the loaded microinjection needle to the microinjection assembly, sliding the
tubing over the back end of the needle (Fig. 26.3.2).
Gene Silencing
26.3.3
Current Protocols in Molecular Biology
Supplement 109
loading
capillary
dsRNA
solution
to mouth
pipet
microinjection
needle
gently blow
and withdraw
loading capillary
Figure 26.3.1
Loading the microinjection needle.
tubing
from microinjection
assembly
microinjection
needle
N2 gas
flow
tight seal between
tubing and needle
Figure 26.3.2
Attaching the microinjection needle to the microinjection assembly via tubing.
The tubing should fit snugly over the needle, making a tight seal. If the seal is not tight
enough, the N2 gas will escape around the needle when pressure is applied, and the
dsRNA solution will not flow from the needle.
4. Turn on the light source of an inverted microscope. Mount the loaded needle onto
the micromanipulator and roughly align the tip of the needle into the center of the
light beam.
The needle should be positioned such that it has a downward angle of 15° to 20°.
RNA Interference
in C. elegans
Prepare worms for microinjection
5. Working at a dissecting microscope, prepare a microinjection pad by placing a small
(10-μl) drop of halocarbon oil Series 700 on the glass surface of the coverslip
adjacent to the region coated with dry agarose. Place the microinjection pad onto an
inverted 30-mm Petri dish lid resting on the stage of a dissecting microscope.
26.3.4
Supplement 109
Current Protocols in Molecular Biology
This will hold the microinjection pad at approximately the same height as the worms on
a small plate, so that minimal focusing will be required while transferring worms to the
microinjection pad.
6. Briefly flame a platinum wire pick that has been flattened at the end for picking up
worms.
7. Touch the pick to the surface of the halocarbon oil on the pad. Using this viscous oil
drop on the end of the wire, pick up several L4–to young adult–staged C. elegans for
microinjection. Transfer the worms to a dry portion of the pad by gently touching
the underside of the pick to the agarose surface of the pad and sliding the pick along
to gently push the worm down to the surface of the pad, making a mental note of
the configuration of the animals.
Pick up the worms by gently touching the oil-coated undersurface of the pick to the top
of the worm on the Petri dish. When the pick is raised, the worm should be transferred
from the plate to the underside of the pick by surface tension. Move to another worm and
repeat the procedure.
Beginners should start with two or three worms, but experts will pick up as many as
twenty worms on the same pick. If possible, choose worms that are either off the E. coli
lawn or on a thin area.
It is not necessary to place the worms in a row, or even to separate the worms from one
another, but it is helpful if the majority of the worms are angled with the long axis of their
bodies oriented in the same general direction.
8. Go back to the oil drop with the pick and obtain additional oil to spread over the
worms as necessary, making sure that all of the worms are completely covered.
9. If the worms are not sticking to the microinjection pad, gently pat the worms along
the length of the body to encourage them to stick to the agarose pad.
IMPORTANT NOTE: Once the animals have been transferred to the microinjection pad,
work as quickly as possible to prevent them from drying out.
Use pads that are thoroughly dry to immobilize the worms. If necessary, rebake pads 1 hr
in a 50°C oven. Check to make sure that the agarose side of the pad is facing up. This
can be accomplished by breathing lightly on the pad; if the correct side is up, the agar
will block condensation on the coverslip. The worms will not stick to bare glass.
Inject the dsRNA into worms
10. Place the microinjection pad with immobilized worms onto the stage of the inverted
microscope and focus on the worms.
11. Move the tip of the microinjection needle into the center of the field of view, being
careful to keep the needle above the worms (Fig. 26.3.3A). Maintain this needle
position and only move the needle into or out of the focal plane (i.e., toward or away
from the microinjection pad) using the z-axis control knob on the micromanipulator.
12. Orient the pad so that the general body axis of the animals parallels the orientation
of the needle (Fig. 26.3.3).
If the needle is perpendicular to the body axis of the animal, it may completely penetrate
the animal or cause it to roll over during the microinjection procedure.
13. Using the 10× objective, choose a worm at one end of the cluster of worms and
position the worm directly under the needle tip by moving the stage.
Keep in mind the configuration of worms placed on the pad (step 7). Move from one end
of the cluster to the other systematically.
Gene Silencing
26.3.5
Current Protocols in Molecular Biology
Supplement 109
Figure 26.3.3 Overview of the microinjection technique. (A) The injection needle enters the field
of view from the left of the image and is oriented above and roughly parallel to the body axis of the
worm. (B to D) The needle is lowered until the tip touches the worm, forming a slight indentation.
The worm is pushed against the needle until the tip of the needle penetrates the cuticle. (E to G)
The dsRNA solution is injected into the body cavity of the worm and flows in both directions away
from the tip (indicated by the bars and arrows). (H) The needle is then backed out of the worm by
moving the worm away from the needle.
Some investigators prefer to move the stage by hand, while others prefer to use the stage
dials. Try both and use whichever method is more comfortable.
14. Focus carefully and lower the needle directly down on top of the first animal’s body.
With the needle pressing against the body of the animal (creating an indentation),
push on the stage to gently move the worm into the needle tip (Fig. 26.3.3B to D).
RNA Interference
in C. elegans
15. Once the needle penetrates the cuticle, apply pressure to the needle and allow the
dsRNA solution to flow into the animal.
26.3.6
Supplement 109
Current Protocols in Molecular Biology
With a successful microinjection, the flow of the solution from the needle tip will be easily
observable in both directions (i.e., towards the mouth and anus; Fig. 26.3.3E to G), and
a slight increase in size near the point of injection may even be observed. Injecting too
much solution will rapidly increase the size of the worm in both diameter and length, and
the animal may not survive. Decrease the duration of the pulse and, if necessary, give
several quick pulses to deliver the dsRNA into the animal.
16. Remove the needle from the worm by pulling back on the sliding stage (Fig. 26.3.3H).
Raise the needle slightly using the z-axis knob on the micromanipulator and move
to the next worm.
17. Repeat steps 13 to 16 until all of the worms are injected. Carefully remove the pad
from the microinjection microscope and transfer to a dissecting microscope.
Recover injected animals for phenotype analysis
18. Recover the animals by placing a small drop of M9 buffer directly under the halocarbon oil so that it contacts the worms and gently floats them off of the agarose.
The loading capillary can be used for this purpose. Simply break off the very thin drawnout end of the loading capillary, creating an opening just slightly larger in diameter than
a worm. Using the capillary, blow M9 against the worms to loosen them from the pad
and suck each worm up into the capillary.
Generally, it is wise to transfer worms in small groups, approximately five animals at a
time, as occasionally worms become stuck to the glass inside the capillary.
19. Deposit the worms on a fresh NGM plate seeded with E. coli, and allow the worms
to recover (i.e., incubate at 20°C) overnight (see Support Protocol 1).
Healthy worms that survive the microinjection should begin to move vigorously in the
M9 buffer or shortly after transfer to the NGM plate.
20. Transfer each injected animal to a fresh NGM plate (day 1) and incubate an additional
24 hr at 20°C (see Support Protocol 1). Transfer the injected animals to a fresh NGM
plate once more (day 2).
21. Monitor the injected animals and their progeny for phenotypes (see Wood, 1988;
Hope, 1999).
The presence of embryos on day-1 plates 24 hr after removing the adult indicates that
the microinjected dsRNA produces an embryonic lethal phenotype. However, always be
sure to compare the injected animals and their progeny to uninjected or control-injected
animals.
In some cases, postembryonic phenotypes can easily be determined by comparing the
progeny of injected animals to the progeny of uninjected or control injected animals.
These may include phenotypes such as uncoordinated (Unc), slow growth (Gro), sterility
(Ste), larval lethal (Lvl), larval arrest (Lva), lethality (Let; any stage), egg-laying defective
(Egl), high incidence of males (Him), dumpy (Dpy), small (Sma), long (Lon), blister (Bli),
protruding vulva (Pvl), multivulva (Muv), and body morphology defects (Bmd).
MICROINJECTION INTO unc-42 rde-1 ANIMALS CROSSED TO N2 MALES
TO EXAMINE ZYGOTIC RNAi PHENOTYPES
ALTERNATE
PROTOCOL 1
If RNAi by microinjection (see Basic Protocol 1) results in embryonic arrest, this could
reflect a maternal function for the targeted gene. Zygotic activity of a targeted gene can be
examined by injecting dsRNA into an RNAi-deficient (rde mutant) hermaphrodite mated
to a wild-type N2 male (Fig. 26.3.4). In this scenario, maternal activity of the targeted
gene will be unaffected since RNAi is not functional in the rde mutant hermaphrodite.
However, wild-type males that successfully mate with the rde mutant hermaphrodite
will provide RNAi activity in the cross progeny, thereby silencing zygotic expression of
Gene Silencing
26.3.7
Current Protocols in Molecular Biology
Supplement 109
×
PO
unc-42 rde -1
unc -42 rde -1
+ (N2)
+
non-Unc
Unc; RNAi-deficient
(no silencing of maternal expression)
F1
unc -42 rde -1
+
non-Unc; RNAi-competent
(silencing of zygotic expression)
Figure 26.3.4
Schematic of the zygotic RNAi procedure.
the targeted gene. To facilitate the identification of rde/+ cross progeny, an rde mutant
that is marked with a recessive visible mutation—e.g., uncoordinated (Unc)—is mated
to N2 males and injected with dsRNA, and the non-Unc cross progeny examined for
phenotypes resulting from loss of zygotic activity of the targeted gene.
Additional Materials (also see Basic Protocol 1)
Male N2 C. elegans (CGC)
unc-42 rde-1 C. elegans (WM36; CGC)
Mating plates (see recipe)
Additional reagents and equipment for transferring and propagating (see Support
Protocol 1), and mating C. elegans (Support Protocol 2)
1. Mate wild-type (N2) C. elegans males with an unc-42 rde-1 mutant strain overnight
(see Support Protocol 2; Hope, 1999).
2. Inject dsRNA into the mated Unc hermaphrodites (see Basic Protocol 1).
3. Transfer (see Support Protocol 1) each injected hermaphrodite to individual mating
plates with males to recover (i.e., incubate at 20°C) overnight and to continue mating
(see Support Protocol 2).
4. Transfer the hermaphrodite alone to a fresh NGM plate and score non-Unc cross
progeny for RNAi phenotypes as described above.
BASIC
PROTOCOL 2
RNA Interference
in C. elegans
FEEDING WORMS dsRNA
RNAi can be induced by feeding worms bacteria expressing dsRNA (Timmons et al.,
2001). First, a cDNA corresponding to the gene of interest is cloned into a bacterial
expression vector between opposing phage T7 polymerase promoter sites. The feeding
vector is then transformed into the E. coli HT115 strain carrying the DE3 lysogen (UNIT
1.8; Seidman et al., 1997), providing IPTG-inducible expression of the phage T7 RNA
polymerase. The HT115(DE3) strain also lacks the Rnc gene, which encodes RNase III
and is therefore deficient in degrading dsRNA. The RNAi food is prepared and seeded
onto NGM plates containing IPTG. Animals are placed onto the RNAi food, and both
the hermaphrodite and progeny are examined and scored for phenotypes.
26.3.8
Supplement 109
Current Protocols in Molecular Biology
T7 promoter
BglII
EcoRV ClaI
EcoRI
SacI
SacII
NotI
TAATACGACTCACTATAGGGAGACCGGCAGATCTGATATCATCGATGAATTCGAGCTCCACCGCGGTGGCGGCCGC
A TTA TGC TGAGTGATA T C C CTC TGGCCGTC TAGAC TATA GTAGCTAC T TAAGCTCGAGGTGGCGCCACCGCCGGCG
Xbal
NcoI
SpeI BamHI
BamHI
SmaI
PstI
EcoRI
TCTAGAACTAGTGGATCCACCGC T TCC ATGGC TAGCCACGTGACGCGTGGATCCCCCGGGCTGCAGGAATTC
AGATCTT GATCA C C TAGGTG GCGAAGGTACCGATCGGTG CAC T GCGCACC TAGGGGGCCCGACG TCCT TA AG
EcoRVHinDIII
ClaI
SaII
XhoI
KpnI
GATATCAAGCT TATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCAAT TCGCC C TAT A G TGAGTCGTATTA
CTAT A GTTCGAATAGCTATGGCAGCTGGAGCTCC C CCC CGGGCCATGGGT TA AGCGGGATA T C ACTCAGCATAAT
T7 promotor
Figure 26.3.5 Multiple cloning site of the double T7 RNAi feeding vector L4440. Opposing phage T7
promoters flank the multiple cloning site of L4440. The restriction sites specific to the MCS are shown,
and unique sites are indicated in bold.
To simultaneously target two genes by feeding, we and others (Min et al., 2010) have
found it best to fuse two cDNA fragments, one from each gene, into a single feeding
vector. Mixing of two E. coli strains also works, but is more prone to error caused by
unequal mixing or unequal RNA expression in the two different feeding strains. Do not
attempt to feed animals that were previously injected with dsRNA; for unknown reasons,
the microinjection of dsRNA (even nonspecific dsRNA) will suppress RNAi by feeding.
This protocol can be easily scaled up to examine the molecular and biochemical consequences of depleting a particular gene product.
RNAi by feeding in microtiter format—the topic of Basic Protocols 3 and 4 and Alternate
Protocol 2—allows systematic screens to be performed (Fraser et al., 2000; Sönnichsen
et al., 2005; Lehner et al., 2006c; Watson et al., 2013).
Materials
cDNA
L4440 double T7 RNAi feeding vector (Fig. 26.3.5; Addgene)
E. coli RNAi feeding strain HT115(DE3) (CGC)
Terrific broth (TB; UNIT 1.1; Elbing and Brent, 2002b) containing 50 μg/ml each
ampicillin and tetracycline (UNIT 1.4; Raleigh et al., 2002)
TB containing 50 μg/ml ampicillin
M9 buffer (see recipe)
M9 buffer with 15% (v/v) glycerol (see recipe)
NGM/amp/IPTG plates (see recipe)
Gravid/young adult, L1 larvae, or L4 larvae C. elegans of appropriate strain(s)
(e.g., N2, CGC)
NGM/amp/IPTG plates (see recipe) seeded with HT115 containing empty L4440
RNAi feeding vector
Additional reagents and equipment for subcloning DNA fragments (UNIT 3.16;
Struhl, 1987), transforming E. coli (UNIT 1.8; Seidman et al., 1997), growing E.
coli (UNIT 1.2; Elbing and Brent, 2002a), and transferring and propagating C.
elegans (see Support Protocol 1)
NOTE: Perform each RNAi experiment in triplicate.
Prepare the RNAi feeding strain
1. Clone a cDNA for the gene of interest into the L4440 double T7 RNAi feeding
vector (UNIT 3.16; Struhl, 1987).
Gene Silencing
26.3.9
Current Protocols in Molecular Biology
Supplement 109
Avoid introns—the presence of introns in the feeding construct may reduce the efficiency
of interference.
Alternatives to L4440 include Litmus 28i and 38i (NEB) and Gateway-compatible versions of L4440, L4440-dest-RNAi (Rual et al., 2004), and L4440-gtwy (Caldwell et al.,
2006). L4440 and L4440-gtwy are available through Addgene.
2. Transform the RNAi feeding construct into the E. coli feeding strain HT115(DE3)
(UNIT 1.8; Seidman et al., 1997).
3. Pick a colony and inoculate 2 ml terrific broth (TB) containing 50 μg/ml each
ampicillin and tetracycline, and grow overnight at 37°C (UNIT 1.2; Elbing and Brent,
2002a).
4. Seed the starter culture into 1 liter TB containing 50 μg/ml ampicillin and incubate
with shaking at 37°C for 8 to 16 hr (UNIT 1.2; Elbing and Brent, 2002a).
Tetracycline in this culture is unnecessary and, in fact, may reduce the efficiency of RNAi
(Kamath et al., 2001).
Cultures can be scaled down; however, excess food from large cultures can be stored at
−80°C, for several months.
Harvest the bacteria
5a. For centrifugation: Centrifuge bacteria 10 min at 800 × g, 4°C. Resuspend the
bacterial pellets in M9 buffer (use 25 ml for each liter of culture) and transfer to a
50-ml conical tube.
Harvest food by centrifugation if food is needed urgently.
If time permits, allow the bacteria to precipitate passively to reduce the likelihood of
contaminating the dsRNA food.
5b. For passive precipitation: Replace TB medium with M9 buffer as follows:
i. Allow bacteria to settle to the bottom of the culture flask overnight at 4°C.
Carefully aspirate as much of the medium from the flask as possible without
disturbing the bacteria, which form a soft layer at the bottom of the flask.
Swirl the flask to suspend the bacteria in the remaining volume of TB and
pour into a 50-ml conical tube.
ii. Pellet the bacteria in a clinical centrifuge 10 min at 800 × g, 20°C. Remove
broth by aspiration.
These pellets tend to be soft, and pouring off the medium could result in loss of the
bacterial pellet.
iii. Wash the bacteria in 5 pellet volumes M9 buffer by vortexing until the clumps
are dissolved.
6. Pellet the bacteria in a clinical centrifuge 10 min at 800 × g, 20°C.
7a. For immediate/short term use: Resuspend washed bacteria in 5 pellet volumes of
M9 buffer. Store up to 1 month at 4°C.
RNAi food is ready to use after resuspension in either buffer.
7b. For storage: Resuspend washed bacteria in M9 with 15% glycerol. Store in 10-ml
aliquots for several months at −70°C.
RNA Interference
in C. elegans
8. Seed an appropriate number of NGM/amp/IPTG plates with one drop (100 μl) each
RNAi food.
9. Allow plates to dry overnight at room temperature.
26.3.10
Supplement 109
Current Protocols in Molecular Biology
This also allows induction of dsRNA production and consistently produces the most penetrant RNAi phenotypes by feeding.
Seeded plates can be stored in a sealed container up to several weeks at 4°C. Warm the
RNAi plates to room temperature prior to use.
Cultivate worms on RNAi food and analyze phenotypes
10a. Test for embryonic and post-embryonic phenotypes: Place single gravid adult C.
elegans onto NGM/amp/IPTG plates. As a control, place single gravid adults
onto HT115(DE3) containing the empty L4440 RNAi feeding vector. After 24 hr,
transfer each RNAi-fed or control-fed adult to a fresh plate of the same type and
count the number of progeny (eggs and larvae) on each plate.
By placing gravid adults onto RNAi plates, one can assess the ability of the RNAi to
produce embryonic as well as postembryonic phenotypes on the same plate.
10b. Test for embryonic lethal phenotypes: Place single L4 animals onto
NGM/amp/IPTG (RNAi) and control—i.e., seeded with HT115(DE3) containing the empty L4440 RNAi feeding vector—plates. After 24 hr, transfer each adult
to a fresh plate of the same type onto which it was seeded (i.e., RNAi or control)
and count the number of progeny (eggs and larvae) on each plate.
10c. Test for postembryonic phenotypes: Place 20 newly hatched L1 larvae onto RNAi
and control plates.
11. Examine the plates each day to determine whether the RNAi food produces any
embryonic and/or postembryonic phenotypes.
The presence of embryos on RNAi plates 24 hr after removing the adult indicates that
the RNAi produces an embryonic lethal phenotype. However, always be sure to compare
RNAi plates to control plates.
In some cases, postembryonic phenotypes can easily be determined by comparing the
RNAi-fed progeny with the control-fed progeny.
RNAi BY FEEDING IN 96-WELL AGAR PLATES
The ability to perform RNAi knockdown by feeding makes genome-scale RNAi screens
feasible. The principles are the same as described in Basic Protocol 2, but the protocol must be adapted for use in high-throughput, 96-well format. Because a single
hermaphrodite can produce 300 embryos, however, the wells would become overcrowded and the animals would quickly consume all of the food, making it unfeasible to
examine second-generation adults in 96-well format. High-throughput screens therefore
are typically performed within a single generation or focus on phenotypes that can be
scored in early larval stages, before the population runs out of food.
BASIC
PROTOCOL 3
Genome-scale RNAi screens can easily be performed in 96-well format with liquid or
agar, or on 24-well agar plates. The choice of platform depends on many factors including
the ability to visualize the phenotype of interest in liquid versus agar and the variability
and penetrance of phenotypes to be scored. For screens in 96-well format, phenotypes
to be screened should be robust, because the number of animals per well (10 to 20) is
limited. Worms grown on solid substrate appear healthier and are easier to visualize than
those grown in liquid, where the bacterial turbidity and worm thrashing can obstruct
cellular detail and fluorescence.
A genome-scale RNAi screen requires an RNAi clone library, equipment and space to
incubate 96-well deep-well plates, and access to a suitable microscope for scoring phenotypes of interest. Genome-scale libraries have been created (Kamath et al., 2003; Rual
et al., 2007) and can be purchased as a collection of clones carried in E. coli HT115(DE3)
Gene Silencing
26.3.11
Current Protocols in Molecular Biology
Supplement 109
and frozen in 96- or 384-well format (Source Bioscience and GE Dharmacon). These
libraries should be maintained at −80°C. Sub-genomic libraries are also available for
specific gene sets, including transcription factors, phosphatases, and chromatin factors
(Ackerman and Gems, 2012, and Source Bioscience), and custom libraries, e.g., intestinally expressed genes, can be created by hand picking the desired clones from available
libraries and re-arraying them into new 96-well plates. A genome-scale screen requires
the growth and examination of over two hundred 96-well plates, and thus the screen is
usually broken up into a series of smaller screens, staggered over multiple days. The
number of plates to set up and screen in a single round will depend both on the available
space for growth of bacteria and the number of plates that can be screened in a single day.
The protocol below outlines large-scale screening on solid medium within a single generation, focusing on phenotypes that can be observed using a dissection microscope.
We use this protocol extensively to identify regulators of gene expression using fluorescent reporter strains and to examine post-embryonic phenotypes. In this procedure, eggs
or early larval animals (L1s) are placed on the RNAi feeding strains and screened for
phenotypes after 2 to 4 days, once control animals have reached the adult stage.
This protocol can be made more efficient through the use of high-throughput liquid
handling or pipetting systems. The Viaflow 96 (Integra Biosciences), or similar 96-well
pipetting tool, can be used to dispense media and bacteria. In addition, a COPAS Biosort
instrument (Union Biometrica) can be used to dispense a specific number of animals into
each well of a 384-, 96-, or 24-well plate. However, these high-tech approaches are not
essential. Although more laborious, an 8-channel repeat pipettor can be used to dispense
media, and multichannel pipettors can be used to inoculate and dispense bacteria and
worms. Thus, genome-scale screens need not be limited to labs equipped with expensive
liquid handling systems and the COPAS biosort robot.
Materials
Eggs or L1-stage C. elegans
NGM liquid medium and 10-cm agar plates (see recipe)
Ampicillin (or carbenicillin)
Isopropyl β-D-1-thiogalactopyranoside (IPTG)
LB liquid medium (UNIT 1.1; Elbing and Brent, 2002b)
Tetracycline
RNAi library frozen at −80°C (Source Bioscience or GE Dharmacon; see Internet
Resources)
M9 buffer (see recipe)
LB plates containing 50 μg/ml ampicillin (UNIT 1.1; Elbing and Brent, 2002b)
Primers for PCR: RNAiRv:TGGATAACCGTATTACCGCC and RNAiFw:
GTTTTCCCAGTCACGACGTT
RNA Interference
in C. elegans
60°C water bath
Large-volume reservoirs for dispensing media (purchased or home-made using
autoclaved micropipet tip boxes)
Flat-bottom 96-well plates
96-well deep-well plates (2 ml/well)
Vibrating platform or shaking incubator
Liquid handling system or 96-channel pipetting system (optional)
Aluminum plate sealers for frozen stocks
Breathable lids, such as Airpore tape sheets (Qiagen)
Zip-lock bags
50-ml reagent reservoirs for eggs and L1s
Dissecting microscope
26.3.12
Supplement 109
Current Protocols in Molecular Biology
Additional reagents and equipment for spectrophotometric determination of
bacterial density by A600 (UNIT 1.2; Elbing and Brent, 2002a), collecting C.
elegans eggs by hypochlorite bleaching (Support Protocol 3), and the
polymerase chain reaction (PCR, UNIT 5.1; Kramer and Coen, 2001)
Grow worms to collect eggs
Calculate the number of eggs required for the experiment. For each 96-well plate to
be screened, you will need approximately 2500 eggs. A 10-cm plate containing 1000
adult wild-type animals fed E. coli OP50 will provide at least 50,000 eggs. Prepare an
appropriate number of 10-cm NGM plates for the experiment, and seed each 10-cm
NGM plate with 1000 hatched L1s. Incubate the worms at 20°C for about 3 days. The
cultures will be ready for hypochlorite bleaching (Support Protocol 3; see step 17 of this
protocol) when you see a lot of embryos on the plate or in the mothers.
Prepare 96-well NGM-agar/amp/IPTG screening plates
1. Prepare NGM agar containing 50 μg/ml ampicillin and 5 mM IPTG. Keep the
NGM/amp/IPTG medium hot while plates are being poured by placing the medium
in a 60°C water bath and pouring into reservoirs for dispensing as needed.
96-well NGM/amp/IPTG-agar plates should be prepared just prior to use, 1 day before
seeding them with bacteria. The small volume of these wells makes them prone to dehydration, which can cause the agar to crack or pull away from the sides of wells, allowing
worms to leave the agar surface.
25 μg/ml carbenicillin can be used in lieu of ampicillin. Although more expensive than
ampicillin, carbenicillin is more stable.
2. Dispense 200 μl NGM/amp/IPTG-agar medium into each well of a flat-bottom
96-well plate. Move quickly to ensure that medium remains hot during dispensing.
Medium can be dispensed using liquid handling systems, 96-channel pipettors, such as
the Viaflow 96, or an 8-channel repeat pipettor with large-bore (P-1000) tips.
Tips need to be changed regularly, as they will start to clog, resulting in uneven dispensing
of agar. We recommend using barrier tips to ensure that agar is not sucked into the
dispensing machinery.
Prepare bacteria
3. Prepare the required number of 96-well deep-well plates by filling each well with
1 ml LB liquid medium containing 50 μg/ml ampicillin and 15 μg/ml tetracycline
using a liquid handling system or 96-channel pipetting system.
If controls are not present within the library plates, prepare a separate plate for controls.
The L4440 vector without insert in HT115(DE3) is used as a negative control, and
positive controls can be phenotypic RNAi, such as unc-22 (twitching) or lin-26 (larval
arrest, lethality ), or RNAi targeting a fluorescence marker such as GFP.
4. Remove library stock plates from the −80°C freezer and place on dry ice.
5. Remove aluminum seals carefully to avoid the generation of aerosols that could
cross-contaminate stock wells.
6. Inoculate starter cultures by gently scraping frozen bacteria from the wells of the
stock plate using a 96-well pipetting system or multichannel pipettor equipped with
sterile pipet tips, and then dip the scraped bacterial cells into the deep-well plates
containing LB plus ampicillin and tetracycline prepared in step 3.
Depending on the number of screens to be done, it may be more economical to purchase
a pin tool (V & P Scientific offers several options), which can be washed, bleached, and
Gene Silencing
26.3.13
Current Protocols in Molecular Biology
Supplement 109
flamed with ethanol to sterilize the tool between plates. If purchasing a pinner, be certain
to purchase one with pins long enough to be used with deep-well plates.
Repeated freezing and thawing of stocks is not recommended. However, we find that it is
often easier and more reliable to inoculate from thawed stocks than frozen, and thus we
recommend making a working copy if the library will undergo repeated cycles of freezing
and thawing. Working copies can be regenerated regularly from original stocks.
7. Cover library stock plates with new aluminum seals, and return the plates to the
−80°C freezer immediately.
8. Cover the starter cultures with breathable sealing film and incubate at 37°C overnight
on a vibrating platform or shaking incubator.
Vibrating platforms are available that can be placed in an incubator or warm room,
allowing multiple 96-well deep-well plates to be processed simultaneously. Stacking
adapters are available for shaking platforms that allow four to five 96-well deep-well
plates to be stacked together in the incubator.
9. The next day, prepare an appropriate number of 96-well deep-well plates (one for
each starter plate) containing 1 ml LB plus 50 μg/ml ampicillin.
10. Remove 50 μl from each well of starter culture and inoculate into the corresponding
wells of deep-well plates containing LB/amp. Incubate with shaking at 37°C for
6 hr; A600 (see UNIT 1.2; Elbing and Brent, 2002a) should be approximately 0.8.
11. Pellet bacteria in a tabletop centrifuge 15 min at 1500 × g, room temperature,
and remove supernatant by rapidly inverting the plate over a container to catch the
supernatant, which should be disposed of appropriately.
12. Suspend each bacterial pellet in 100 μl (1/10th volume) M9 buffer by pipetting up
and down five to six times.
This can be done using the mix function on many electronic pipetting systems or by hand
using a multichannel pipettor.
Seed NGM-agar/amp/IPTG screening plates with bacteria
13. Using a 96-well liquid dispenser or a multichannel pipettor, transfer 10 to 15 μl of
the bacterial suspension from each well of the deep-well plates to the corresponding
wells of a 96-well NGM/amp/IPTG-agar plate, being careful not to touch the top of
the agar with the pipet tips.
Touching the agar surface can create holes or depressions in the agar that worms will
crawl into.
14. Dry plates in a laminar flow hood, checking central wells for liquid at 15-min
intervals. Remove plates as soon as central wells are dry.
Overdrying will cause agar to crack. If cracking of peripheral wells is a problem, an
additional 5 to 10 μl of sterile water or M9 can be added to these wells to prevent
overdrying.
15. Once plates are sufficiently dry, wrap plates with plastic film or seal in zip-lock bags
to prevent further drying.
16. Leave plates overnight at room temperature to induce expression of dsRNA.
RNA Interference
in C. elegans
Add worms to screening plates
17. Collect eggs from worms growing on 10-cm plates by hypochlorite bleaching (see
Support Protocol 3). Animals can be added to screening plates as eggs or L1s; if
L1s will be used, allow the embryos to hatch overnight in M9.
26.3.14
Supplement 109
Current Protocols in Molecular Biology
A benefit of using L1s is that the viability of embryos can be monitored after bleaching
and prior to plating, ensuring that an intended number of viable worms are plated. In
addition, the cultures will be more synchronous.
18. Determine the number of embryos or L1s per 7 μl of suspension, and dilute the
suspension of worms using M9 buffer so that 7 μl contains between 20 and 25
embryos or L1s.
19. Put the worm suspension into a sterile 50-ml reagent reservoir and, using a multichannel pipettor, dispense 7 μl (20 to 25 embryos or L1s) into each well of each
screening plate. Agitate the reservoir frequently to prevent embryos or larvae from
settling to the bottom.
20. Allow the plates seeded with worms to dry in a laminar flow hood as described in
step 14.
21. Once the plates with worms are dry, invert plates, seal them in zip-lock bags to
maintain humidity, and incubate 3 to 4 days.
22. Use the remaining worm suspension to inoculate 10-cm NGM plates for the next
round of screening.
23. After 3 to 4 days, screen plates for worms with desired phenotypes using a dissecting
microscope.
24. For wells that give a positive phenotype, streak the bacterial clones from frozen
stocks onto LB plates containing 50 μg/ml ampicillin and isolate single colonies for
retesting and sequencing.
Due to the risk of cross-contamination between wells of RNAi libraries stored in 96- or
384-well plates, we suggest that positive clones be streaked for single colonies and that
individual colonies be picked, grown, and used for retesting.
25. Amplify individual clones (including the Arhinger and ORFeome library clones)
that retest as positive from bacteria by PCR (UNIT 15.1; Kramer and Coen, 2001) using the primers RNAiRv:TGGATAACCGTATTACCGCC and RNAiFw: GTTTTCCCAGTCACGACGTT.
SCREENING IN 24-WELL AGAR PLATES
For some screens, the expected phenotypes (e.g., those with variable penetrance) require
examination of a larger number of animals than can be grown in 96-well format. These
screens can be adapted to high-throughput using 24-well plates, as described below.
ALTERNATE
PROTOCOL 2
Additional Materials (see also Basic Protocol 3)
24-well plates
Wheaton Unispence dispenser
3-mm tubing
12-channel pipettor
1. Prepare NGM agar containing 50 μg/ml ampicillin and 5 mM IPTG.
2. Using a Wheaton Unispence dispenser equipped with 3-mm tubing, dispense 2 ml
NGM/amp/IPTG agar into each well of a 24-well plate. Prepare four 24-well plates
for each 96-well plate from the library to be screened.
2 liters of NGM agar will produce 40 plates (enough to screen ten 96-well plates).
3. Prepare bacterial RNAi feeding strains in 96-well deep well plates as described in
steps 3 to 6 of Basic Protocol 3.
Gene Silencing
26.3.15
Current Protocols in Molecular Biology
Supplement 109
Figure 26.3.6 Transferring a library from 96-well to 24-well plates. A 12-channel pipet loaded
with tips on alternating channels is used to withdraw bacterial culture from the odd number wells
in the top row of a 96-well deep-well plate (A) and transfer the cultures to the top row of a 24well plate (B). Bacteria from the even number wells in the top row of the 96-well plate are then
transferred to the second row of the 24-well plate. (C) Following this pattern, it takes two rows of
a 96-well plate to fill a 24-well plate.
4. After resuspending bacteria in M9 buffer, add 30 μl of each bacterial suspension per
well of the 24-well plates.
Although there are a number of strategies to go from 96-well to 24-well plates, using a 12channel pipettor with tips added to every other channel is the simplest. In this configuration,
each row of a 96-well plate is transferred to two rows of a 24-well plate; for example,
samples from the odd-numbered wells in row A of the 96-well plate are transferred to row
A of a 24-well plate, and samples from the even-numbered wells in row A from the 96-well
plate are transferred to row B of the 24-well plate, and so on (Fig. 26.3.6).
5. Seed plates with 50 eggs or L1s per well.
BASIC
PROTOCOL 4
RNA Interference
in C. elegans
RNAi IN 96-WELL LIQUID CULTURE
Performing large-scale RNAi knockdown in liquid has many advantages over solidmedia-based assays, including the ease of setup, the ability to transfer worms more
rapidly for further processing, and the ease of compound addition. High-throughput
image-acquisition pipelines have been developed using liquid cultures, and for some
applications, RNAi feeding and image analysis can be done in a single plate without
having to transfer animals (Cipriani and Piano, 2011; Rohde and Yanik, 2011). Some
strains do not grow well in liquid, so it is prudent to test mutants for their ability to grow
in liquid before using them to set up a large-scale screen. The level of detail that can be
observed in liquid is also decreased relative to solid medium. Thrashing of animals in
liquid can make it difficult to see cellular details.
To perform these assays, we use an adaptation of the protocol described by Lehner et al.
(2006c).
26.3.16
Supplement 109
Current Protocols in Molecular Biology
This protocol requires the use of a 15° to 25°C shaking incubator with room for incubation
of 96-well plates, and access to a dissecting or inverted compound microscope for scoring
phenotypes of interest.
Materials
RNAi library frozen at −80°C (Source Bioscience or GE Dharmacon; see Internet
Resources)
Isopropyl β-D-1-thiogalactopyranoside (IPTG)
NGM liquid medium and 10-cm agar plates (see recipe)
Ampicillin (or carbenicillin)
L1-stage C. elegans or eggs
M9 buffer (see recipe)
Centrifuge
96-well flat-bottom plates
Breathable lids, such as Airpore tape sheets (Qiagen)
Additional reagents and equipment for preparing bacteria from library (Basic
Protocol 3, steps 3 to 6)
1. Inoculate an overnight culture from frozen library stocks as described in steps 3 to 6
of Basic Protocol 3, but do not use tetracycline in the overnight cultures.
2. Following overnight incubation of bacteria, induce expression of dsRNA by addition
of IPTG to a final concentration of 5 mM. Incubate for 4 hr at 37°C with shaking.
3. Pellet bacteria by centrifugation for 15 min at 1500 × g, room temperature, and
suspend in 200 μl of NGM liquid medium containing 50 μg/ml ampicillin plus
1 mM IPTG.
4. Transfer 90 μl of bacteria from each well to 96-well flat-bottom plates.
Do not use round-bottom plates.
Anti-fungals (fungizone) can be added if desired.
Bacteria can be suspended in a smaller volume to generate a more concentrated bacterial
suspension if food becomes limiting for the assay.
5. Dilute eggs or L1s to approximately 1 animal per μl using M9 buffer. Using a
multichannel pipettor, add 10 μl of egg or L1 suspension per well.
6. Seal 96-well plates with breathable sealing film and then cover with plate lids.
The breathable film will limit condensation and evaporation.
Although we find that covering the plate with both a breathable sealing film and a plate
lid limits evaporation, the amount of evaporation will likely depend on the air flow and
the relative humidity in the incubator. Others have suggested placing 96-well plates into
plastic containers or humid chambers to combat evaporation (Lehner et al., 2006c).
7. Incubate with shaking at 100 rpm, 20°C. After 4 to 5 days, score phenotypes.
SOAKING WORMS IN dsRNA
Soaking worms in dsRNA solution can also induce RNAi (Tabara et al., 1998). In this
simple procedure, L4-stage animals are placed in soaking solution containing dsRNA
corresponding to the gene to be silenced. Animals are soaked for up to 24 hr and recovered
on Petri dishes. The exposed animals and their progeny are then examined for phenotypes.
BASIC
PROTOCOL 5
Gene Silencing
26.3.17
Current Protocols in Molecular Biology
Supplement 109
The soaking procedure is capable of being scaled up or performed in microtiter format
(Maeda et al., 2001). Another variation of the procedure is to soak L1-stage animals to
examine postembryonic phenotypes.
Materials
dsRNA
Nonspecific dsRNA—i.e., dsRNA that is nonhomologous to any C. elegans
sequence and which is comparable in length to the experimental dsRNA (e.g.,
gfp; optional)
Soaking solution (see recipe)
C. elegans (e.g., N2, CGC)
M9 buffer (see recipe)
NGM plates (see recipe) with and without seeded E. coli OP50 (see recipe)
65°C water bath
0.2- and 2.0-ml microcentrifuge tubes
5-ml glass pipet
Additional reagents and equipment for ethanol precipitation (UNIT 2.1A; Moore and
Dowhan, 2002)
1. Ethanol precipitate (UNIT 2.1A; Moore and Dowhan, 2002) an appropriate amount of
dsRNA sample and, if available, nonspecific dsRNA. Dissolve the pellet in soaking
solution to a final concentration of 0.5 to 5.0 mg/ml.
It may be necessary to try several different concentrations of dsRNA to determine the
concentration required to generate a phenotype.
2. Denature the RNA by heating 15 min at 65°C. Anneal the dsRNA by cooling the
sample to room temperature for 15 to 30 min.
3. Pipet 5 μl sample dsRNA into an appropriately labeled 0.2-ml microcentrifuge tube.
Do the same for the nonspecific dsRNA control, or if this is not available, use soaking
solution alone.
It may also be useful to set up a positive control (i.e., a dsRNA proven to demonstrate a
phenotype) to determine that the procedure is working as expected.
4. Using a 5-ml glass pipet, rinse a healthy mixed-stage population of C. elegans with
2 ml M9 buffer and transfer to a 2.0-ml microcentrifuge tube.
5. Pellet the animals by microcentrifuging 30 sec at 800 × g, 20°C. Remove M9 buffer
with a 1-ml pipet tip and wash again.
6. Transfer the worms to an unseeded NGM plate and let them crawl around for 5 to
10 min at 20°C to allow complete digestion of bacteria in the gut.
7a. To test for embryonic lethal phenotypes: Pick and transfer five to ten L4-stage
animals to each sample or control tube (step 3). Incubate 24 hr at 20°C. Recover
the soaked worms by plating them onto an NGM plate seeded with E. coli OP50,
transfer each worm to an individual plate, and incubate 24 hr at 20°C. Transfer each
worm to a fresh plate and count the number of progeny.
7b. To test for postembryonic phenotypes: Place 20 newly hatched L1 larvae into each
sample or control tube and incubate 24 hr at 20°C. Recover soaked worms by plating
them onto an NGM plate seeded with E. coli OP50. When the L1-soaked animals
reach L4 stage, transfer each animal to an individual plate.
RNA Interference
in C. elegans
8. Monitor the treated animals and their progeny for phenotypes resulting from dsRNA
treatment.
26.3.18
Supplement 109
Current Protocols in Molecular Biology
PICKING AND PROPAGATING C. ELEGANS
C. elegans can be transferred from one plate to another using a worm pick—a short
piece of platinum wire with one end flattened and the other end mounted onto a Pasteur
pipet. Commercially manufactured worm picks are also available (Genesee Scientific).
Platinum wire heats and cools rapidly, so the wire can and should be flamed before and
after every pick to avoid contamination.
SUPPORT
PROTOCOL 1
Label the bottom half of an NGM plate (see recipe) with the appropriate strain name and
the date. Working under a dissecting microscope, pick up a dab of E. coli OP50 food (see
recipe) on the underside of the flattened end of the worm pick. Gently touch the food on
the bottom of the pick to the top of a worm. The worm should stick to the food on the
worm pick by surface tension. Quickly transfer the worm to a new NGM plate, gently
touching the worm to the plate and allowing the worm to crawl off of the worm pick.
For those unfamiliar with C. elegans, propagating worms may be difficult at first, but
with practice picking and maintaining worms will be routine. See Support Protocol 2,
Wood (1988), and Hope (1999) for additional details on propagating, staging, cleaning,
synchronizing, and mating C. elegans.
SEXING AND MATING C. ELEGANS
C. elegans comes in two sexes, hermaphrodite and male, which are determined by
the number of X chromosomes. Males can be distinguished from hermaphrodites under the dissecting microscope as they lack hermaphrodite sex organs (e.g., vulva and
uterus containing developing embryos) and the male tail has a barbed appearance.
Hermaphrodites (XX) produce both sperm and oocytes and can reproduce by selffertilization. Hermaphrodites can also be cross-fertilized by C. elegans males (XO),
which produce sperm only. If a C. elegans male successfully mates with a hermaphrodite,
the majority of the progeny will be cross-progeny because male sperm out-compete
hermaphrodite sperm. As such, one half of the cross-progeny will be males and the other
half will be hermaphrodites. For a detailed description of hermaphrodites and males and
their identification, refer to Wood (1988) and Riddle et al. (1997).
SUPPORT
PROTOCOL 2
Males arise by spontaneous X-chromosome nondisjunction at a frequency of 0.1%
(Riddle et al., 1997). This frequency can be increased by heat-shock treatment of L4
hermaphrodites at 30°C for 4 hr. Once a male stock is obtained, the population should be
maintained by periodically setting up crosses. In addition, we find that we can also freeze
animals from these plates once starved using standard protocols (Steirnagle, 2006), and
recover males once thawed. Thus, once the population of males has been expanded,
frozen stocks containing males can be generated for later use.
Genetic crosses in C. elegans are typically set up between a phenotypically wild-type
male and a hermaphrodite that is homozygous for a visible mutation—e.g., uncoordinated
(Unc). This allows cross-progeny (non-Unc) to be easily distinguished from self-progeny
(Unc). Multiple (e.g., ten) young healthy males and multiple (e.g., five) L4 or young adult
hermaphrodites should be chosen when crossing C. elegans strains.
COLLECTION OF C. ELEGANS EGGS BY HYPOCHLORITE TREATMENT
C. elegans embryos, but not larvae or adults, are resistant to hypochlorite, and thus eggs
can be collected by hypochlorite treatment to generate a semi-synchronous population.
SUPPORT
PROTOCOL 3
Materials
10-cm plates with gravid adult worms (Basic Protocol 3)
Gene Silencing
26.3.19
Current Protocols in Molecular Biology
Supplement 109
Buffered bleach, prepared fresh (see recipe)
M9 buffer (see recipe)
15-ml conical centrifuge tubes (e.g., BD Falcon)
1. Wash worms and eggs off 10-cm agar plates using 5 ml of water, and transfer to a
15-ml conical tube.
2. Check the plates under a dissecting microscope to ensure that you have washed all
the eggs off.
3. Pellet worms and eggs in a tabletop centrifuge for 2 min at 800 × g, room temperature,
and discard supernatant.
4. Add buffered bleach and mix gently (do not vortex). Check worms regularly by
placing tube under a dissecting microscope. When most adult carcasses have broken
open and dissolved, add M9 up to 10 ml, mix by inversion, and pellet by centrifugation
as above. Hypochlorite treatment typically takes 4 to 5 min and should not exceed
7 min.
Overbleaching will kill embryos.
5. Wash eggs 3 times with 10 ml M9 buffer, and suspend the embryos in 5 ml M9 buffer.
Animals can be further synchronized to L1 arrest by incubating them in M9 with gentle
rocking for 12 to 18 hr. To prevent hypoxia, the buffer should not exceed 7 ml.
REAGENTS AND SOLUTIONS
Use deionized, distilled water in all recipes and protocol steps. For common stock
solutions, see APPENDIX 2; for suppliers, see APPENDIX 4.
Agarose microinjection pads
Prepare injection pads by sandwiching a couple of drops of melted 2% (w/v) agarose
between two 22 × 50–mm glass coverslips. Once the agarose hardens (<1 min),
carefully remove one of the coverslips. Dry the agarose pad onto the remaining
coverslip by baking at 50°C for 1 hr. A large number of microinjection pads can be
made at one time and stored indefinitely at room temperature in a closed container
(e.g., a Petri dish or empty coverslip box) to prevent dust from accumulating on the
surface.
Baking dries the agarose to the coverslip. One of the coverslips must be removed
before baking. The popped-off coverslip can then be reused for another microinjection
pad.
Buffered bleach
7 ml H2 O
2 ml commercial bleach (5% to 6% sodium hypochlorite)
1 ml 5 M NaOH
Prepare fresh
Commercial bleach varies in strength: be sure to check the percent sodium
hypochlorite.
RNA Interference
in C. elegans
E. coli OP50 food
Inoculate (UNIT 1.2; Elbing and Brent, 2002a) 100 ml of L broth (see recipe in UNIT 6.12;
Kurnit, 1994) with a single colony of OP50 (CGC) using sterile technique. Incubate
the culture overnight at 37°C with shaking. Store the liquid culture at 4°C for several
weeks
26.3.20
continued
Supplement 109
Current Protocols in Molecular Biology
The uracil auxotrophic E. coli OP50 strain is typically used as a food source for
C. elegans, as the limited growth of E. coli OP50 on NGM plates provides easier
observation of the worms.
Loading capillary
The loading capillary consists of a drawn-out Pasteur pipet connected via tubing to
a mouth pipet. The diameter of the drawn-out end of the Pasteur pipet must be less
than that of the inner diameter of the non-drawn-out portion of the microinjection
needle (see recipe) to facilitate loading.
M9 buffer with and without 15% glycerol
3.0 g monobasic potassium phosphate (KH2 PO4 )
6.0 g dibasic sodium phosphate (Na2 HPO4 )
5.0 g NaCl
1 ml 1 M magnesium sulfate (MgSO4 )
Add 150 ml glycerol (15% v/v) if appropriate
Adjust volume to 1 liter with H2 O
If using glycerol, prepare 100-ml aliquots
Sterilize by autoclaving
Store up to 2 months at 20°C
Mating plates
Flame the end of a Pasteur pipet until the edges of the tip curl in and nearly close
the opening. This rounded end will be less likely to scratch the surface of the NGM
plate during seeding. Using the Pasteur pipet, withdraw some E. coli OP50 food (see
recipe) from an overnight culture. Touch the rounded tip of the Pasteur pipet to the
center of a 30-mm NGM plate (see recipe), dispensing a very small droplet of the E.
coli OP50 food. Incubate the plates at room temperature 2 to 3 hr and store at 4°C in
a sealed container for several weeks.
Mating plates are NGM plates seeded with a very thin and small (5 mm) spot of E.
coli OP50 in the center.
Alternatively, a small dab of E. coli OP50 food can be transferred from a dry seeded
plate to an unseeded 30-mm NGM plate just prior to setting up a cross.
See UNIT 1.2 (Elbing and Brent, 2002a) for more information regarding culture of E.
coli.
Microinjection needles
The ideal microinjection needle (i.e., borosilicate glass capillaries, World Precision
Instruments) should taper to a sharp and stiff point and can be pulled using 1.2- or 1mm capillary blanks and a wide variety of needle-pulling devices (e.g., Narishige PN30). After pulling the first two needles, examine them under a dissecting microscope.
The needles should taper gradually and steadily to a very sharp point. Using one of
the first two needles, gently touch the other needle just behind the tip while watching
through a dissecting microscope. If the needle tips bend easily without breaking, then
it is probably not stiff enough for penetrating the cuticle of the worm. A common
problem is a needle that is hair-like at the tip. To correct this problem, reduce the heat
setting on the needle puller. It may also be necessary to adjust the pull strength. Get
advice from someone experienced in pulling capillaries if problems persist. Most
needles will be closed at the tip after pulling, and thus it will be necessary to gently
break the needle tip prior to microinjection. Alternatively, the needle tips can be
etched with acid (Mello and Fire, 1995).
Gene Silencing
26.3.21
Current Protocols in Molecular Biology
Supplement 109
NGM plates or NGM/amp/IPTG plates
Prepare the following in a 2-liter Erlenmeyer flask:
3.0 g NaCl
17 g agar
2.5 g Bacto-peptone
975 ml H2 O
Add a stir bar and sterilize by autoclaving. Cool to 55°C and add 25 ml of 1 M
potassium phosphate buffer, pH 6 (APPENDIX 2), 1 ml of 1 M CaCl2 , 1 ml of 5 mg/ml
cholesterol in 100% ethanol, and 1 ml of 1 M MgSO4 . For NGM/amp/IPTG plates,
also add 50 μg/ml ampicillin and 1 mM (final) IPTG (UNIT 1.4; Raleigh et al., 2002).
Dispense into petri dishes (3 ml per 30-mm plate or 20 ml per 10-cm plate). Dry
the plates at room temperature for 1 to 2 days before seeding with OP50. Store up to
1 month at 4°C in a sealed container.
NGM plates seeded with OP50
Seed each 30-mm NGM plate (see recipe) with one drop (100 μl) of E. coli OP50
food (see recipe). Allow the E. coli OP50 drop to dry into the plate and to grow
overnight at room temperature or for 8 hr at 37°C (UNIT 1.2; Elbing and Brent, 2002a).
Store seeded plates in a sealed container for several weeks at 4°C.
Soaking buffer, 10×
1.55 g dibasic sodium phosphate (Na2 HPO4 )
0.75 g monobasic potassium phosphate (KH2 PO4 )
0.12 g NaCl
0.25 g ammonium chloride (NH4 Cl)
0.5 g gelatin
Adjust volume to 100 ml with H2 O
Sterilize by autoclaving
Store up to 2 months at room temperature
Soaking solution
0.5 ml 10× soaking buffer (see recipe)
15 μl 1 M spermidine (Sigma)
4.5 ml H2 O
Use immediately
COMMENTARY
Background Information
RNA Interference
in C. elegans
RNA interference (RNAi) is a form of
sequence-specific, post-transcriptional gene
silencing (PTGS) that is triggered by the introduction of dsRNA [UNIT 6.1 (Baulcombe,
2003); Fire et al., 1998]. RNAi is related to
a number of gene-silencing phenomena in a
variety of organisms. Genetic and biochemical studies have revealed that the underlying
mechanisms of these silencing phenomena are
remarkably conserved [for reviews, see UNIT
6.1 (Baulcombe, 2003) and Hannon (2002)].
The specificity and potency of RNAi provided
researchers with an efficient means of inactivating gene expression in model organisms
where conventional gene-replacement techniques were unavailable, such as C. elegans,
Drosophila, fungi, plants, and trypanosomes
(Bosher and Labouesse, 2000). The ability
to perform RNAi in human cells (Elbashir
et al., 2001) has rapidly transformed basic research, and a number of clinical trials are underway using RNAi as a therapy for human
disease.
RNAi can inhibit gene function in worms
injected with dsRNA (see Basic Protocol 1 and
Alternate Protocol; Fire et al., 1998), soaked in
solution containing dsRNA (see Basic Protocol 3; Tabara et al., 1998), fed bacteria expressing dsRNA (see Basic Protocol 2; Timmons
et al., 2001), or engineered to express dsRNA
in vivo (Tabara et al., 1999). Interference by
dsRNA is sequence-specific and potent (Fire
et al., 1998). Worms that are injected in the gut
26.3.22
Supplement 109
Current Protocols in Molecular Biology
with 60,000 dsRNA molecules targeting the
muscle-specific unc-22 gene exhibit an unc22(–) twitching phenotype (Fire et al., 1998).
Moreover, F1 progeny of injected worms also
exhibit a severe twitching phenotype. These
findings indicate that dsRNA, or a secondary
silencing factor, is transported from one tissue to another and that interference can be
inherited. The specific, potent, systemic, and
heritable features of RNAi make this an ideal
method for assaying the function of genes in
C. elegans.
The ability to induce RNAi by a variety of
methods allows researchers of different skill
levels to apply the technique and to characterize gene function under a variety of conditions.
Typically, investigators determine whether a
particular gene has an RNAi phenotype first
by microinjection, simply because the preparation of dsRNA is straightforward and takes
less time to prepare than RNAi food and plates
(see Time Considerations). However, this does
not necessarily mean that RNAi by microinjection is superior to other methods. While some
genes are indeed silenced more effectively by
microinjection than by feeding, the converse
is also true (Kamath et al., 2001), and other
genes are equally sensitive to both methods
(Kamath et al., 2003). Therefore, if microinjection does not work, feeding and/or soaking
should be attempted. For RNAi by feeding,
Kamath et al. (2003) generated a library of
16,757 RNAi bacterial feeding clones, which
has since been expanded to 19,763 clones
(available from Source Bioscience). An independent library of 11,560 ORFeome RNAi
clones (available from GE Dharmacon), targeting 10,499 individual genes, has also been
generated (Rual et al., 2004). Together, the
coverage of libraries is approaching 90% of the
20,466 predicted protein-coding genes, based
on the recent genome release (WS244).
Due to the requirement of a balancer chromosome for viability, a null mutation in an
essential gene limits the ability to perform
biochemistry or applications that require large
populations. The ability to silence a gene in
large populations of C. elegans using RNAi
by feeding or soaking should make C. elegans
more amenable to such applications.
RNAi is also a simple way to examine genetic interactions between genes. Sequential
microinjection, microinjection or soaking with
multiple dsRNAs simultaneously, exposure of
mutant strains to dsRNA, and feeding constructs containing more than one insert have all
been successfully used to determine whether
two genes interact (Grishok et al., 2001; Bei
et al., 2002; Dudley et al., 2002; Lehner et al.,
2006b; Byrne et al., 2007).
Despite its success, RNAi in C. elegans
does have its limitations. RNAi does not work
for every gene. In particular, pharyngeal, vulval, sperm, and neuronal genes are often difficult to silence (Fire et al., 1998). The reasons
for this are not entirely known, but could include inefficient transport or maintenance of
trigger dsRNA or secondary signals to these
tissues. In some cases, efficient silencing can
be triggered for refractory genes by driving
the expression of hairpin dsRNA from a transgene in the worm (Tavernarakis et al., 2000).
The enhancement of RNAi in the nervous system has been of particular interest. For example, expression of sid-1 in the nervous system
is reported to enhance the efficiency of neuronal RNAi (Calixto et al., 2010), and mutations that enhance RNAi, including rrf-3,
eri-1 and lin-15 mutants, as well as combinations of these mutations, have also proved
useful (Simmer et al., 2003; Lehner et al.,
2006a; Schmitz et al., 2007). In the latter case,
the enhancement of RNAi is not restricted to
the neuronal tissue, and these RNAi-sensitized
strains have been used to uncover RNAiinduced phenotypes not observed in wild-type
backgrounds.
A large amount of RNAi data is being generated in C. elegans. The data
can be accessed and searched from Wormbase (http://www.wormbase.org) to determine
whether a particular gene exhibits an RNAi
phenotype or to identify genes that show a particular phenotype. In general, the quality of the
data is good, but keep in mind that a negative
result does not necessarily mean that a particular gene does not exhibit an RNAi phenotype. It simply means that under the conditions
tested, no phenotype was observed. Investigators should try the experiment by additional
methods before accepting a negative RNAi
result.
A common problem with all RNAi methods is the possibility of inadvertently silencing
related genes. Generally, so-called off-target
silencing only occurs when a few segments
of at least 25-nucleotide identity exist within
the gene (Parrish et al., 2000). As a standard
control for this problem in RNAi studies, it is
always important to identify related genes in
the genome and assay each of these for similar
or overlapping phenotypes (Rual et al., 2007).
Although RNAi can be inherited (Fire
et al., 1998; Grishok et al., 2000), it is not
Gene Silencing
26.3.23
Current Protocols in Molecular Biology
Supplement 109
permanent. While this may be considered as a
benefit to some, to the classical geneticist this
is a drawback: genetic mutants remain the gold
standard in C. elegans research. Variability is
typically not a problem with RNAi, but a range
of phenotypes is possible, so animals should be
observed carefully. Because the feeding strategy (see Basic Protocol 2) requires less actual
worm manipulation, it may be the more consistent protocol, provided care is taken when
preparing the dsRNA food and media. When
possible, it is a good idea to confirm RNAi
phenotypes by obtaining a genetic mutant, and
the advent of CRISPR-mediated genome engineering in C. elegans (Friedland et al., 2013)
leaves little excuse not to generate mutants.
In fact, RNAi and CRISPR-mediated genome
engineering provide worm researchers with
an outstanding one-two punch. For example,
RNAi can be used as a rapid approach to assign
gene function or to screen for candidate genes
in a pathway (Basic Protocols 3 and 4 and
Alternate Protocol 2), and CRISPR-mediated
genome engineering can be used to quickly
obtain genetic mutants if they are not already
available (Friedland et al., 2013; Dickinson
et al., 2013; Kim et al., 2014).
Critical Parameters
RNA Interference
in C. elegans
Target selection
There are few hard and fast rules for determining the region of a gene to target. Since introns and untranslated regions are not efficient
targets of the RNAi machinery (Montgomery
et al., 1998), the dsRNA should be designed to
target the coding region of the mature mRNA.
Although 500 to 1000 bp is sufficient, if feasible, target the entire coding region of the
gene of interest or several different regions.
The sensitivity of worms to RNAi targeting
different regions of a particular gene can be
determined in a relatively short period of time
by microinjection.
As mentioned above, care should be taken
when performing RNAi on members of a gene
family. Experiments should be designed such
that the targeted region of a gene of interest
does not overlap with the other member(s) of
the gene family. This may be difficult if extensive homology exists, but in most cases this
should not be a problem. Use BLAST [UNIT 9.3
(Wolfsberg and Madden, 1999)] to identify related sequences in C. elegans and to determine
whether there is significant identity to complicate the analysis. If there is significant identity
between two sequences, attempt to find and
target regions that are divergent.
Obtaining cDNA clones
Gateway-compatible open-reading-frame
(ORF) clones have been generated for a
many C. elegans genes (Reboul et al., 2003;
Lamesch et al., 2004). Individual clones can
be purchased from Source BioScience or GE
Dharmacon, and the entire library is available from GE Dharmacon (see Internet Resources). Information related to the amplification and cloning of ORFeome clones can
be found on the WorfDB Web site (see Internet Resources). The laboratory of Yuji Kohara ([email protected]) has also generated a library of C. elegans cDNAs. In addition, they have generated sequence tags for
a large number of these clones and assigned
them to the corresponding genes. If cDNAs
for a particular gene have been identified, a
clone or yk (for Yuji Kohara) number will
be listed on the Gene report page in Wormbase (http://www.wormbase.org; see Internet
Resources) under the subheading Reagents:
Matching cDNAs. The Kohara cDNA clones
are made available to the C. elegans community and are provided as a small aliquot
of Lambda ZAP II bacteriophage. A kit provided by Stratagene can be used to amplify
the phage and to excise the pBluescript SK(–)
phagemid. Each insert is flanked by the phage
T3 and T7 RNA polymerase promoters, which
can be used to synthesize sense and antisense
RNA strands in vitro [UNIT 3.8 (Paschal et al.,
2008)]. If a cDNA clone is not available, a
cDNA can be generated by RT-PCR from total worm RNA or poly(A)-selected mRNA
using sequence-specific oligonucleotides and
cloned into an appropriate expression vector
(e.g., pBluescript).
Transcription templates can also be generated by PCR from genomic DNA using
oligonucleotides with 5 tails containing phage
T7 RNA polymerase promoter sequences. In
this case, try to identify and amplify the longest
contiguous stretch of exon sequence possible,
minimizing the inclusion of introns. The resultant PCR product will contain a portion of
the gene of interest flanked by opposing T7
promoter sites. Using such a template, both
sense and antisense strands of RNA can be
produced simultaneously in a single in vitro
transcription reaction.
When generating clones for RNAi by feeding, inserts should be exon rich. The authors
have had success with a variety of feeding constructs, targeting sequences from 300 to 2400
nt long. The optimal length of the targeted region for RNAi by feeding is likely to be gene
specific and should be determined empirically;
26.3.24
Supplement 109
Current Protocols in Molecular Biology
however, the parameters discussed above represent a good starting point.
dsRNA preparation
Sense and antisense RNA strands are prepared using standard protocols and kits, and
then annealed to make dsRNA. Several companies now provide high-yield in vitro transcription kits. The Megascript Kit from Ambion is outstanding, and the instruction manual provides a lot of useful information, from
designing oligonucleotides containing phage
promoters to troubleshooting transcription reactions.
Efficient RNAi will be achieved for many
genes over a very broad range of dsRNA concentrations (0.01 to 5 mg/ml). Initially, higher
concentrations (i.e., 1 mg/ml) are preferred because some genes are less sensitive to RNAi
than others, for unknown reasons. A small
percentage (<5%) of nonspecific embryonic
lethality among progeny of the injected animals is sometimes observed; however, there
are no other noticeable side effects from injecting high dsRNA concentrations.
At very low concentrations of dsRNA, one
may be able to induce hypomorphic phenotypes. Mixing two different RNAi feeding
strains has been shown to dramatically reduce the penetrance of mutant phenotypes observed with one feeding strain alone (Kamath
et al., 2001). These authors also found that a
1:1 mixture of unc-37 RNAi food and normal
OP50 (which does not express the dsRNA)
completely abolished the embryonic lethality
induced by unc-37 RNAi; however, 100% of
the progeny displayed hypomorphic postembryonic phenotypes, which was also observed
when the RNAi food was induced with very
low levels of IPTG. Therefore, adjusting the
levels of dsRNA delivered to the animals can
alter the penetrance and spectra of RNAi phenotypes.
Silencing multiple genes simultaneously
As discussed above, care should be taken
when designing RNAi experiments so that simultaneous silencing of related genes does
not occur inadvertently. Nevertheless, there
may be instances when it is desirable to silence multiple genes simultaneously. For instance, two related genes that function redundantly in a particular process might show no
phenotype or produce an incompletely penetrant phenotype when silenced individually by
RNAi. On the other hand, simultaneous RNAi
targeting of both genes may dramatically produce a completely penetrant phenotype (Gr-
ishok et al., 2001). As mentioned above, RNAi
is also a simple and rapid method for examining genetic interactions. In principle, each
of the dsRNA delivery methods is amenable
to simultaneous RNAi; however, microinjection is the most widely used technique for this
purpose. Simultaneous RNAi by feeding also
works, although it is somewhat limited relative to microinjection. As mentioned above,
mixing two different RNAi feeding strains together dramatically reduces the penetrance of
phenotypes resulting from RNAi, but by engineering the feeding vector to contain two inserts, the authors and others (Min et al., 2010)
have been able to silence two genes simultaneously by double RNAi feeding without an
apparent reduction in the penetrance of RNAi
relative to either single RNAi food. The combined inserts so far have not exceeded 1.5 kb in
length, so presumably additional genes could
be targeted, for example in a triple RNAi feeding construct.
Cell- or tissue-specific RNAi
Silencing a gene in a specific cell or tissue may be desirable when the gene of interest is essential or expressed in all tissues
and the function in a particular tissue is being investigated. Tissue-specific RNAi strains
have been developed by tissue-specific transgene rescue of an RNAi-deficient mutant. For
example, rde-1 mutants are completely resistant to RNAi in all tissues (Tabara et al., 1999),
but tissue-specific expression of rde-1 has been
used to rescue RNAi in intestinal, muscle, neuronal, and hypodermal tissues (Espelt et al.,
2005; Qadota et al., 2007; Firnhaber and Hammerlund, 2013).
Troubleshooting
Table 26.3.1 presents a guide to some of the
common problems of achieving RNAi in C.
elegans, as well as their causes and solutions.
Anticipated Results
Regardless of the delivery method, if RNAi
produces a phenotype, the animals will typically be affected for one generation—i.e., the
F1 progeny of animals exposed to dsRNA.
However, for RNAi by feeding, as long as
the animals are cultivated on RNAi food, they
are exposed to dsRNA and the phenotype will
persist. Investigators have observed persistent
RNAi by microinjection into the F2 generation, although the penetrance is reduced.
In a typical RNAi microinjection experiment, early embryos developing within the
Gene Silencing
26.3.25
Current Protocols in Molecular Biology
Supplement 109
Table 26.3.1 Troubleshooting Guide for C. elegans RNAi Studies
Problem
Possible cause
Solution
Needle is closed
Etch or break the needles after
pulling to open
Needle is clogged
Break the tip of the needle to
restore flow
RNAi by microinjection
dsRNA solution does not
flow from the needle
Use a new needle
Centrifuge dsRNA solution prior to
use
Worms do not stick to
agarose injection pad
Agarose is not dry enough
Bake agarose pads at least 1 hr at
50°C
No RNAi phenotype
observed
dsRNA is degraded
Prepare fresh dsRNA and analyze
on 1% agarose gel to check quality
(UNIT 2.5A)a
Perform positive control for RNAi
by injection
Target gene is refractory to
RNAi
Try another region of the gene
Attempt to achieve RNAi by
feeding or soaking
RNAi by feeding
No RNAi phenotype
observed
dsRNA production is not
induced
Test the plates by performing a
positive control for RNAi
Prepare fresh NGM/amp/IPTG
plates
RNAi food is
contaminated
Prepare fresh RNAi food. Be sure
to include both ampicillin and
tetracycline in the starter culture to
prevent contamination with another
bacterial species. Perform all food
preparation carefully.
dsRNA is degraded
Prepare fresh dsRNA and soaking
solution
RNAi by soaking
No RNAi phenotype
observed
a Voytas
RNA Interference
in C. elegans
(2001).
uterus may be unaffected, but may carry the
silencing signal into the subsequent generation. These unaffected and carrier progeny
will be laid on the initial recovery plate after microinjection. After transferring an injected animal from the recovery plate to a fresh
plate (16 hr), the remaining portion of the
brood should be completely affected by the
RNAi.
For uncharacterized genes, it is difficult
to know what to expect from an RNAi experiment; however, if the expression pattern or localization is known (e.g., from in
situ hybridization), then an educated guess
can be made about the type of phenotype
for which to look. For example, if in situ
analysis indicates that the gene product is
expressed in the germline, one might expect to see an embryonic-lethal phenotype or
postembryonic-sterile phenotype. For a gene
product expressed in muscle cells, one might
expect defects in motility. In situ expression
data can be searched from Wormbase or from
the Nematode Expression Pattern Database
(NEXTDB; see Internet Resources).
It is recommended that the novice enlist the
aid of individuals with expertise in C. elegans
biology when phenotyping animals.
26.3.26
Supplement 109
Current Protocols in Molecular Biology
Time Considerations
RNAi by microinjection
A complete microinjection experiment
from injecting animals to scoring phenotypes
will take 3 to 6 days. On day 0, the novice
should expect to spend about 1 to 2 hr at the
injection microscope performing microinjection. With practice, this time can be shortened
to 15 min for each dsRNA and strain. The
amount of time to transfer animals to individual NGM plates on days 1 and 2 will vary
depending on the number of worms to transfer
(5 to 30 min). Expect to spend several hours
counting progeny and analyzing phenotypes.
RNAi by feeding
Growth, preparation, and induction of the
RNAi food will take 2 to 4 days. The remainder of the feeding experiment will take 3 to
6 days to complete. As for microinjection, plan
to spend several hours counting progeny and
analyzing phenotypes.
RNAi-library screening
A typical experiment will take 2 to 3 days
to set up, followed by 3 to 4 days of growth.
The amount of time it will take to screen for
a desired phenotype will depend on the number of plates to be screened. Conversely, the
number of plates that can be screened in a reasonable amount of time will vary depending on
the ability to screen for the desired phenotype.
Selection strategies are the most efficient and
powerful assays. Screens in which fluorescent
reporters go from completely “off” to “on” are
also effective, and can be scored quite quickly.
Incubator space may also limit the number of
plates. Typically, we stagger the start of largescale screens over several days, and screen accordingly. Expect to spend several hours per
day for 1 to 2 weeks scoring.
RNAi by soaking
The amount of time it will take to perform
the entire soaking procedure will be similar to
that for microinjection.
Acknowledgements
The authors wish to thank Amy Holdorf,
Gina Caldas, and Krishna Ghanta for helpful comments on the manuscript. This work
was supported in part by Ruth L. Kirschstein
fellowship GM63348 (to D.C.), a Canadian
Institutes of Health Research postdoctoral fellowship (to L.T.M.), and National Institutes of
Health grants DK068429 (to A.J.M.W) from
the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) and
GM58800 (to C.C.M.) from the National Institute of General Medical Sciences (NIGMS).
C.C.M is a Howard Hughes Medical Institute
Investigator.
Literature Cited
Ashrafi, K., Chang, F.Y., Watts, J.L., Fraser,
A.G., Kamath, R.S., Ahringer, J., and Ruvkun, G. 2003. Genome-wide RNAi analysis
of Caenorhabditis elegans fat regulatory genes.
Nature 421:268-272.
Baulcombe, D. 2003. Overview of RNA interference and related processes. Curr. Protoc. Mol.
Biol. 62:26.1.1-26.1.6.
Bei, Y., Hogan, J., Berkowitz, L.A., Soto, M.,
Rocheleau, C.E., Pang, K.M., Collins, J., and
Mello, C.C. 2002. SRC-1 and Wnt signaling
act together to specify endoderm and to control cleavage orientation in early C. elegans embryos. Dev. Cell 3:113-125.
Bosher, J.M. and Labouesse, M. 2000. RNA interference: Genetic wand and genetic watchdog.
Nat. Cell. Biol. 2:E31-E36.
Byrne, A.B. Weirauch, M.T., Wong, V., Koeva, M, Dixon, S.J., Stuart, J.M., and Roy,
P.J. 2007. A global analysis of genetic interactions in Caenorhabditis elegans. J. Biol.
6:8.
Caldwell, G.A., Williams, S.N., and Caldwell, K.A.
2006. Integrated Genomics: A Discovery-Based
Laboratory Course. Wiley, New York.
Calixto, A., Chelur, D. Topalidou, I, Chen, X.,
Chalfie, M. 2010. Enhanced neuronal RNAi in
C. elegans using SID-1. Nat. Methods 7:554559.
Cipriani, P.G. and Piano, F. 2011. RNAi methods
and screening: RNAi based high-throughput genetic interaction screening. Methods Cell Biol.
106:89-111.
Dickinson, D.J., Ward, J.D., Reiner, D.J., and Goldstein, B. 2013. Engineering the Caenorhabditis
elegans genome using Cas9-triggered homologous recombination. Nat. Methods 10:10281034.
Dudley, N.R., Labbe, J.C., and Goldstein, B. 2002.
Using RNA interference to identify genes required for RNA interference. Proc. Natl. Acad.
Sci. U.S.A. 99:4191-4196.
Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin,
A., Weber, K., and Tuschl, T. 2001. Duplexes of
21-nucleotide RNAs mediate RNA interference
in cultured mammalian cells. Nature 411:494498.
Elbing, K. and Brent, R. 2002a. Growth in liquid
media. Curr. Protoc. Mol. Biol. 59:I:1.2:1.2.1–
1.2.2.
Elbing, K. and Brent, R. 2002b. Media preparation and bacteriological tools. Curr. Protoc. Mol.
Biol. 59:1.1.1–1.1.7.
Espelt, M.V., Extevez, A.Y., Yin, X., Strange, K.
2005. Oscillatory Ca2+ signaling in the isolated Caenorhabditis elegans intestine: Role
of the inositol-1,4,5-triphosphate receptor and
Gene Silencing
26.3.27
Current Protocols in Molecular Biology
Supplement 109
phospholipases C beta and gamma. J. Gen. Physiol. 126:379-392.
Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A.,
Driver, S.E., and Mello, C.C. 1998. Potent
and specific genetic interference by doublestranded RNA in Caenorhabditis elegans. Nature 391:806-811.
Firnhaber, C. and Hammarlund, M. 2013. Neuronspecific feeding RNAi in C. elegans and its use in
a screen for essential genes required for GABA
neuron function. PLoS Genet. 9:e1003921.
Fraser, A.G., Kamath, R.S., Zipperlen, P., MartinezCampos, M., Sohrmann, M., and Ahringer, J.
2000. Functional genomic analysis of C. elegans
chromosome I by systematic RNA interference.
Nature 408:325-330.
Friedland, A.E., Tzur, Y.B. Exvelt, K.M., Colaiacovo, M.P., Church, G.M., and Calarco, J.A.
2013. Heritable genome editing in C. elegans via
a CRISPR-Cas9 system. Nat. Methods 10:741743.
Gonczy, P., Echeverri, C., Oegema, K., Coulson, A.,
Jones, S.J., Copley, R.R., Duperon, J., Oegema,
J., Brehm, M., Cassin, E., Hannak, E., Kirkham,
M., Pichler, S., Flohrs, K., Goessen, A., Leidel, S., Alleaume, A.M., Martin, C., Ozlu, N.,
Bork, P., and Hyman, A.A. 2000. Functional
genomic analysis of cell division in C. elegans
using RNAi of genes on chromosome III. Nature
408:331-336.
Grishok, A., Tabara, H., and Mello, C.C. 2000. Genetic requirements for inheritance of RNAi in C.
elegans. Science 287:2494-2497.
Grishok, A., Pasquinelli, A.E., Conte, D., Li, N.,
Parrish, S., Ha, I., Baillie, D.L., Fire, A., Ruvkun, G., and Mello, C.C. 2001. Genes and
mechanisms related to RNA interference regulate expression of the small temporal RNAs that
control C. elegans developmental timing. Cell
106:23-34.
Hannon, G.J. 2002. RNA interference. Nature
418:244-251.
Hope, I.A., ed. 1999. C. elegans: A Practical Approach. The Practical Approach Series. Oxford
University Press, New York.
Kamath, R.S., Martinez-Campos, M., Zipperlen,
P., Fraser, A.G., and Ahringer, J. 2001. Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in
Caenorhabditis elegans. Genome Biol. 2:RESEARCH0002.
Kamath, R.S., Fraser, A.G., Dong, Y., Poulin, G.,
Durbin, R., Gotta, M., Kanapin, A., Le Bot,
N., Moreno, S., Sohrmann, M., Welchman, D.P.,
Zipperlen, P., and Ahringer, J. 2003. Systematic
functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421:231-237;
comment 220-221.
RNA Interference
in C. elegans
Kim, H., Ishidate, T., Ghanta, K.S., Seth, M., Conte,
D. Jr., Shirayama, M., and Mello, C.C. 2014.
A Co-CRISPR strategy for efficient genome
editing in Caenorhabditis elegans. Genetics
197:1069-1080.
Kramer, M.F. and Coen, D.M. 2001. Enzymatic
amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol.
56:15.1.1-15.1.14.
Kurnit, D.M. 1994. Recombination-based assay
(RBA) for screening bacteriophage lambda libraries. Curr. Protoc. Mol. Biol. 27:6.12.16.12.12.
Lamesch, P., Milstein, S., Hao, T., Rosenberg, J., Li,
N., Sequerra, R., Bosak, S., Doucette Stamm, L.,
Vandenhaute, J., Hill, D.E., and Vidal, M. 2004.
C. elegans ORFeome version 3.1: Increasing the
coverage of ORFeome resources with improved
gene predictions. Genome Res. 14:2064-2069.
Lehner, B., Calixto, A., Crombie, C., Tischler, J.,
Fortunato, A., Chalfie, M., and Fraser, A.G.
2006a. Loss of LIN-35, the Caenorhabditis elegans ortholog of the tumor suppressor p105Rb,
results in enhanced RNA interference. Genome
Biol. 7:R4.
Lehner, B., Crombie, C., Tischler, J., Fortunato,
A., and Fraser, A.G. 2006b. Systematic mapping of genetic interactions in Caenorhabditis elegans identifies common modifiers of diverse signaling pathways. Nat. Genet. 38:896903.
Lehner, B., Tischler, J., and Fraser, A.G. 2006c.
RNAi screens in Caenorhabditis elegans in 96well liquid format and their application to the
systematic identification of genetic interactions.
Nat. Protoc. 1:1617-1620.
Maeda, I., Kohara, Y., Yamamoto, M., and Sugimoto, A. 2001. Large-scale analysis of gene
function in Caenorhabditis elegans by highthroughput RNAi. Curr. Biol. 11:171-176.
Mello, C. and Fire, A. 1995. DNA transformation.
Methods Cell. Biol. 48:451-482.
Min, K., Kang, J., and Lee, J. 2010. A modified
feeding RNAi method for simultaneous knockdown of more than one gene in Caenorhabditis
elegans. Biotechniques 48:229-232.
Montgomery, M.K., Xu, S., and Fire, A. 1998.
RNA as a target of double-stranded RNAmediated genetic interference in Caenorhabditis
elegans. Proc. Natl. Acad. Sci. U.S.A. 95:155021557.
Moore, D. and Dowhan, D. 2002. Purification
and concentration of DNA from aqueous solutions. Curr. Protoc. Mol. Biol. 59:2.1A.1.1–
2.1A.10.
Parrish, S., Fleenor, J., Xu, S., Mello, C., and Fire,
A. 2000. Functional anatomy of a dsRNA trigger: Differential requirement for the two trigger
strands in RNA interference. Mol. Cell 6:10771087.
Paschal, B.M., McReynolds, L.A., Noren, C.J. and
Nichols, N.M. 2008. RNA polymerases. Curr.
Protoc. Mol. Biol. 84:3.8.1-3.8.8.
Piano, F., Schetter, A.J., Mangone, M., Stein, L., and
Kemphues, K.J. 2000. RNAi analysis of genes
expressed in the ovary of Caenorhabditis elegans. Curr. Biol. 10:1619-1622.
26.3.28
Supplement 109
Current Protocols in Molecular Biology
Qadota, H., Inoue, M., Hikita, T., Koppen, M.,
Hardin, J.D., Amano, M., Moerman, D.G., and
Kaibushi, K. 2007. Establishment of a tissuespecific RNAi system in C. elegans. Gene
400:166-173.
Raleigh, E.A., Elbing, K., and Brent, R. 2002. Selected topics from classical bacterial genetics.
Curr. Protoc. Mol. Biol. 59:1.4.1-1.4.14.
Reboul, J., Vaglio, P., Rual, J.F., Lamesch, P., Martinez, M., Armstrong, C.M., Li, S., Jacotot, L.,
Bertin, N., Janky, R., Moore, T., Hudson, J.R.
Jr., Hartley, J.L., Brasch, M.A., Vandenhaute, J.,
Boulton, S., Endress, G.A., Jenna, S., Chevet,
E., Papasotiropoulos, V., Tolias, P.P., Ptacek, J.,
Snyder, M., Huang, R., Chance, M.R., Lee, H.,
Doucette-Stamm, L., Hill, D.E., and Vidal, M.
2003. C. elegans ORFeome version 1.1: Experimental verification of the genome annotation
and resource for proteome-scale protein expression. Nat. Genet. 34:35-41.
Riddle, D.L., Blumenthal, T., Meyer, B.J., and
Priess, J.R. 1997. C. ELEGANS II. Cold Spring
Harbor Laboratory Press. Cold Spring Harbor,
New York.
Rohde, C.B. and Yanik, M.F. 2011. Subcellular in
vivo time-lapse imaging and optical manipulation of Caenorhabditis elegans in standard multiwell plates. Nat. Commun. 2:271.
Rual, J.F., Ceron, J., Koreth, J., Hao, T., Nicot,
A.S., Hirozane-Kishikawa, T., Vandenhaute,
J., Orkin, S.H., Hill, D.E., van den Heuvel,
S., and Vidal, M. 2004. Toward improving
Caenorhabditis elegans phenome mapping with
an ORFeome-based RNAi library. Genome Res.
14:2162-2168.
Rual, J.F., Klitgord, N., and Achaz, G. 2007. Novel
insights into RNAi off-target effects using C.
elegans paralogs. BMC Genomics 8:106.
Schmitz, C., Kinge, P., and Hutter, H. 2007.
Axon guidance genes identified in a large-scale
RNAi screen using the RNAi-hypersensitive
Caenorhabditis elegans strain nre-1(hd20) lin5b(hd126). Proc. Natl. Acad. Sci. U.S.A.
104:834-839.
Seidman, C.E., Struhl, K., Sheen, J., and Jessen,
T. 1997. Introduction of plasmid DNA into
cells. Curr. Protoc. Mol. Biol. 37:1.8:1.8.11.8.10.
Simmer, F., Moorman, C., vander Linden, A.M.,
Kuijk, E., van der Berghe, P.V., Kamath, R.S.,
Fraser, A.G., Ahringer, J., and Plasterk, R.H.
2003. Genome-wide RNAi of C. elegans using
the hypersensitive rrf-3 strain reveals novel gene
functions. PLoS Biol. 1:E12.
Sönnichsen, B., Koski, L.B., Walsh, A., Marschall,
P., Neumann, B., Brehm, M., Alleaume, A.M.,
Artelt, J., Bettencourt, P., Cassin, E., Hewitson, M., Holz, C., Khan, M., Lazik, S., Martin,
C., Nitzsche, B., Ruer, M., Stamford, J., Winzi,
M., Heinkel, R., Röder, M., Finell, J., Häntsch,
H., Jones, S.J., Jones, M., Piano, F., Gunsalus,
K.C., Oegema, K., Gönczy, P., Coulson, A.,
Hyman, A.A., and Echeverri, C.J. 2005. Fullgenome RNAi profiling of early embryogenesis
in Caenorhabditis elegans. Nature 434:462-469.
Steirnagle, T. 2006. Maintenance of C. elegans. Wormbook Feb 11:1-11. Available at
http://www.wormbook.org/chapters/www_
strainmaintain/strainmaintain.html.
Struhl, K. 1987. Subcloning of DNA Fragments.
Curr. Protoc. Mol. Biol. 13:3.16.1-3.16.2.
Sulston, J.E. and Horvitz, H.R. 1977. Postembryonic cell lineages of the nematode,
Caenorhabditis elegans. Dev. Biol. 56:110-156.
Sulston, J.E., Schierenberg, E., White, J.G., and
Thomson, J.N. 1983. The embryonic lineage
of the nematode Caenorhabditis elegans. Dev.
Biol. 100:64-119.
Tabara, H., Grishok, A., and Mello, C.C. 1998.
RNAi in C. elegans: Soaking in the genome sequence. Science 282:430-431.
Tabara, H., Sarkissian, M., Kelly, W.G., Fleenor, J.,
Grishok, A., Timmons, L., Fire, A., and Mello,
C.C. 1999. The rde-1 gene, RNA interference,
and transposon silencing in C. elegans. Cell
99:123-132.
Tavernarakis, N., Wang, S.L., Dorovkov, M.,
Ryazanov, A., and Driscoll, M. 2000. Heritable
and inducible genetic interference by doublestranded RNA encoded by transgenes. Nat.
Genet. 24:180-183.
Timmons, L., Court, D.L., and Fire, A. 2001. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in
Caenorhabditis elegans. Gene 263:103-112.
Voytas, D. 2001. Agarose gel electrophoresis. Curr.
Protoc. Mol. Biol. 51:2.5A.1-2.5A.9.
Watson, E., MacNeil, L.T., Arda, H.E., Zhu,
L.J., and Walhout, A.J.M. 2013. Integration of
metabolic and gene regulatory networks modulates the C. elegans dietary response. Cell
153:253-266.
Wolfsberg, T.G. and Madden, T.L. 1999. Sequence
similarity searching using the BLAST family of
programs. Curr. Protoc. Mol. Biol. 46:19.3.119.3.29.
Wood, W.B. (ed.) 1988. The Nematode Caenorhabditis elegans. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York.
Key References
Hope, 1999. See above.
A very good source for general information on culturing and maintaining worms as well as a comprehensive microinjection protocol for germline
transformation.
Kamath et al., 2001. See above.
This manuscript provides an in depth analysis of
the RNAi by feeding technique as well as a comparison to RNAi by microinjection.
Riddle et al., 1997. See above.
C. ELEGANS II provides an extensive overview of
worm biology.
Wood, 1988. See above.
The predecessor of C. ELEGANS II (Riddle et al.,
1997). The Nematode is full of important information about the biology of C. elegans.
Gene Silencing
26.3.29
Current Protocols in Molecular Biology
Supplement 109
Internet Resources
http://worfdb.dfci.harvard.edu
http://www.wormbase.org
Worm ORFeome DataBase (WorfDB) is a searchable database for C. elegans ORF clones.
Wormbase is an essential tool for C. elegans biologists, and provides an abundance of useful
information regarding the genome and biology
of C. elegans. The curators at Wormbase have
provided annotations of each of the predicted
genes, including RNAi phenotypes and expression data as well as links to useful sites. The
curators are constantly updating and upgrading
the site.
http://www.wormatlas.org
Worm atlas is an online database featuring behavioral and structural anatomy of the worm, C.
elegans.
http://www.rnai.org
The RNAi database is a searchable database of
ovary or germline-enriched genes by gene or
by phenotype.
http://c.elegans.tripod.com/RNAi.htm
The [email protected] page has many informative links for RNAi in C. elegans and other
organisms.
http://www.cbs.umn.edu/research/resources/cgc
The Caenorhabditis Genetics Center (CGC),
funded by the National Institutes of Health Office of Research Infrastructure Programs (P40
OD010440), is the central repository for C. elegans strains and distributes strains at a minimal
cost to researchers.
http://www.lifesciences.sourcebioscience.com/cloneproducts/non-mammalian/c-elegans/
Source Bioscience sells ORFeome and RNAi
reagents, including the genome-wide RNAi feeding library and sub-libraries.
http://dharmacon.gelifesciences.com/geneexpression-cdnas-orfs/non-mammalian-cdnasand-orfs/c-elegans
GE Dharmacon provides ORFeome reagents,
including the ORFeome RNAi feeding
collection.
http://nematode.lab.nig.ac.jp/
NEXTDB is an expression pattern database based
on in situ hybridizations using expressed sequence tags.
RNA Interference
in C. elegans
26.3.30
Supplement 109
Current Protocols in Molecular Biology