Download SRF - Journal of Cell Science

3029
Journal of Cell Science 107, 3029-3036 (1994)
Printed in Great Britain © The Company of Biologists Limited 1994
Nuclear import of serum response factor (SRF) requires a short aminoterminal nuclear localization sequence and is independent of the casein
kinase II phosphorylation site
Jocelyne Rech, Isabelle Barlat, Jean Luc Veyrune, Annick Vie and Jean Marie Blanchard
Institut de Génétique Moléculaire de Montpellier, UMR 9942, CNRS BP 5051, 1919 route de Mende, 34033 Montpellier cedex 1,
France
SUMMARY
Serum stimulation of resting cells is mediated at least in
part at the transcriptional level by the activation of
numerous genes among which c-fos constitutes a model.
Serum response factor (SRF) forms a ternary complex at
the c-fos serum response element (SRE) with an accessory
protein p62TCF/Elk-1. Both proteins are the targets of
multiple phosphorylation events and their role is still
unknown in the amino terminus of SRF. While the transcriptional activation domain has been mapped between
amino acids 339 and 508, the DNA-binding and the dimerization domains have been mapped to between amino acids
133-235 and 168-235, respectively, no role has been
proposed for the amino-terminal portion of the molecule.
We demonstrate in the present work that amino acids 95
to 100 contain a stretch of basic amino acids that are sufficient to target a reporter protein to the nucleus.
Moreover, this sequence appears to be the only nuclear
localization signal operating in SRF. Finally, whereas the
global structure around this putative nuclear location
signal is reminiscent of what is found in the SV40 T antigen,
the casein kinase II phosphorylation site does not
determine the rate of cyto-nuclear protein transport of this
protein.
INTRODUCTION
vivo SRE occupancy (Herrera et al., 1989) can be demonstrated whatever the state of the cell. SRF is extensively phosphorylated following its synthesis in serum-stimulated fibroblasts (Prywes et al., 1988; Gauthier et al., 1991a; Misra et al.,
1991). The same sites that are phosphorylated in vivo
(Janknecht et al., 1992; Marais et al., 1992) are phosphorylated
in vitro by casein kinase II (CKII; Manak et al., 1990; Marais
et al., 1992). This phosphorylation event was first thought to
enhance SRF binding to DNA (Prywes et al., 1988; Manak et
al., 1990), thus activating its function (Gauthier et al., 1991a).
It has been subsequently demonstrated that CKII phosphorylation profoundly affected both on and off rates for SRF binding
to its target without affecting the overall equilibrium dissociation constant (Marais et al., 1992). More recently, Manak and
Prywes (1993) have even presented evidence against a role in
growth factor regulation of c-fos expression via phosphorylation of SRF by CKII. To understand the role of CKII phosphorylation of SRF we expressed a series of SRF-β-galactosidase fusion proteins by transient transfection in rodent
fibroblasts. This has allowed us to characterize a nuclear localization signal next to the CKII phosphorylation site, a situation
encountered in several other nuclear proteins. However, this
CK II site does not seem to control nuclear import, at variance
with what has been proposed for SV40 T.
Serum response factor (SRF) is a ubiquitous transcription
factor that binds to the DNA sequence CC(A/T)6GG, which
has been identified as an essential regulatory serum response
element (SRE) of the c-fos proto-oncogene promoter (for
reviews see Rivera and Greenberg, 1990; Treisman, 1990,
1992; Piechaczyk and Blanchard, 1994). Numerous experiments suggest that SRF is directly involved in signal transduction through transcriptional activation: (i) overexpression
of SRF transactivates a cotransfected SRE in certain cell types
(Gutman et al., 1991); (ii) activity of a mutated, uninducible
SRE can be rescued by an SRF mutant with altered specificity
(Hill et al., 1993); (iii) a GAL4-SRF fusion containing the
carboxy-terminal part of SRF is sufficient to render a GAL4
site-containing reporter gene growth factor responsive
(Johansen and Prywes, 1993); (iv) microinjection of titrating
amounts of double-stranded SRE oligonucleotides or immunodepletion of SRF from cell nuclei prevents the chromosomal
c-fos gene from being activated by serum or the ras oncogene
(Lamb et al., 1990; Gauthier et al., 1991a,b). Regulatory SRFDNA-binding activity does not seem to be a necessary step in
SRE-mediated serum or growth factor gene regulation, since
both in vitro DNA-binding activity (Treisman, 1990) and in
Key words: SRF, nuclear localization signal, nuclear import kinetics,
casein kinase
3030 J. Rech and others
MATERIALS AND METHODS
Vectors and cloning strategies
The β-galactosidase-containing pCH110 (Hall et al., 1983) and the
human SRF cDNA-containing T7∆ATG (generous gift from
R.Treisman) plasmids were used as starting materials for all constructs described in this paper. Various portions of SRF were fused
in-frame with the bacterial enzyme by insertion between the HindIII
and KpnI sites of pCH110. SRF cDNA was fragmented using either
existing restriction sites or selective amplification by PCR with the
following oligonucleotides:
(1) 5′-GGAAGCTTAGAATGGCGCCCACCGCGGGG;
(2) 5′-GGGAAGCTTAGAATGAGCCTGAGCGAGATG;
(3) 5′-GGGAAGCTTAGAATGGGCGCCGAGCGGCGC;
(4) 5′-GGAAGCTTCTAGAATGGTGGTCGGTGGGCCC;
(5) 5′-CCCGGTACCGGCTTCAGTGTGTCCTTGG;
(6) 5′-CCCGGTACCTCGGGCCCACCGACCAC;
(7) 5′-CCCGGTACCTCCTCCTCCTCGCC;
(8) 5′-GCGAAGCTTAGAATGGACACACTGAAGCCG;
(9) 5′-CGCGGTACCCATTCACTCTTGGTGCT.
The pSV-NLSlacZ vector was obtained by insertion within the
same sites of the double stranded oligonucleotide:
linked anti-mouse antibody and signals were visualized using ECL
protocol from Amersham.
Experiements were carried out at least three times for each
construct.
SRF and SV40-β-galactosidase fusion proteins:
purification and microinjection
Recombinant proteins were purified after in vivo biotinylation
(Cronan, 1990; Germino et al., 1993). pCH110-derived vectors
expressing the SRF domain corresponding to amino acids 69 to 115
linked to β-galactosidase, under the wild-type or mutated casein
kinase site configuration, were restricted with HindIII and BamHI.
The inserts were cloned into the same sites of the Pin Point Xa3 vector
(Promega), which gives rise to the expression in E. coli of a fusion
protein linked to a peptide specifically biotinylated in vivo, thus
allowing a rapid purification through binding to an avidin-containing
resin (Softlink, Promega). Protein purity was monitored by SDS-polyacrylamide gel electrophoresis and Coomasie Blue staining, and
estimated to be more than 95%. Rat embryo fibroblasts (REF-52) cells
were injected in the cytoplasm with 50-100 µg/ml solutions of pure
SRF-β-galactosidase fusion proteins in 50 mM HEPES pH 8, 1 mM
MgCl2. Cells were fixed at different times after injection and β-galactosidase activity was monitored as described above.
5′-AAGCTTTCTAGAATGGCTCCAAAAAAGAGAAAGGTACC.
The region of SV40 DNA between map coordinates 4414 and 4521,
containing the CKII site and the NLS, was amplified by PCR using
the following oligonucleotides:
5′-GGGAAGCTTGAGGAAAACCTGTTTTGC;
5′-CGCGGTACCGGGTCTTCTACCTTTCTC.
Site-directed mutagenesis was carried out on double-stranded DNA
according to Deng and Nickoloff (1992) with the Pharmacia USE kit.
Briefly, two oligonucleotides were used: one introduces the desired
mutation(s) and the second mutates a unique non-essential restriction
site (ScaI) into another one (MluI). Elimination of this site renders the
mutated plasmid DNA resistant to restriction, thus providing a
selection based on the differential transforming efficiency of linear vs
circular DNA in a mutS Escherichia coli strain. Two successive
rounds of transformation-recutting were carried out prior to plating
the cells. The casein kinase II site (CKII), the putative nuclear localization signal (NLS) and the ScaI restriction site of pUC19 were,
respectively, mutated using the following oligonucleotides:
5′-GGGAAGCTTAGAATGGCCGTCGGCGTCGAGGGCGACGTGGAGGTGGGCGAGGAGGAGGAG (CKII);
5′-CTCAGGCTCCCCATCAGGCCGCCCAGCTCGGCGCC (NLS);
5′-CTGTGACTGGTGACGCGTCAACCAAGTC (ScaI, Pharmacia).
All mutants and fusion constructs were confirmed by sequencing.
Cell culture, transfection and β-galactosidase detection
HeLa and 293 human cells, or rat embryo (REF52), mouse (Ltk−) and
hamster (CCL39) fibroblasts, were cultured in DMEM (Gibco) containing 5% fetal calf serum under a 5% CO2-containing atmosphere.
A total of 105 cells in 3 cm2 plastic dishes were transiently transfected
with 4 µg DNA by the standard calcium phosphate procedure. At 20
hours later, cells were washed thrice with ice-cold PBS, fixed for 5
minutes with 2% formaldehyde/0.2% glutaraldehyde in PBS and
stained with 1 mg/ml X-Gal, 2 mM MgCl2, in the presence of 5 mM
each of potassium ferrocyanide and ferricyanide for at least one hour
at 37°C. The sizes of the fusion proteins expressed in 293 cells were
estimated by western blot analysis. Nitrocellulose membranes were
saturated for 1 hour in 10 mM Tris-HCl, pH 8 (25°C), 150 mM NaCl,
0.2% Tween-20 (TBST), 6% non-fat milk, and then incubated for 2
hours in TBST containing mouse anti-β-galactosidase antibody. After
4 washes in TBST, filters were probed with horseradish peroxidase-
RESULTS
Expression of SRF-β-galactosidase fusion proteins
in transfected cells
We have shown previously that the portion of SRF containing
its DNA-binding and dimerization domains, SRF-DB
(spanning from amino acid 133 to 264, see Fig. 1), worked as
a negative dominant effector of c-fos expression when microinjected into serum-stimulated fibroblasts (Gauthier-Rouvière et
al., 1993). To discriminate between endogenous SRF and
recombinant protein we resorted to gene tagging using β-galactosidase as an easily detectable marker. We used as controls
for cytoplasmic and nuclear localization, respectively, vectors
expressing either β-galactosidase alone (pCH110, Fig. 2A) or
a chimera containing the SV40-T NLS, CPKKRKV, linked at
the amino terminus of the same enzyme (pSV-NLSLacZ, Fig.
2B). To our surprise, the SRF-DB-β-galactosidase fusion
protein did not localize to the nucleus (Fig. 2C) despite the
presence of several stretches of basic amino acids reminiscent
of known nuclear localization sequences (NLS; for reviews see
Garcia-Bustos et al., 1991; Silver, 1991; Laskey and Dingwall,
1993). This result clearly did not depend upon the level at
which the recombinant proteins were expressed: the same
localizations were obtained whether a SV40 or a rat β-actin
promoter was used, or whether X-gal staining was carried out
6 hours or 24 hours post-washing of calcium phosphate precipitates (results not shown). Moreover, the same results were
also invariant, whether human HeLa, Chinese hamster CCL39
or mouse Ltk− cells were used for transfection (not shown).
This prompted us to design a set of deletion mutants containing various portions of human SRF fused in-frame to β-galactosidase. Vector construction is described in Materials and
Methods, and β-galactosidase activity was monitored as above
after transient transfection into REF cells. Characterization of
recombinant proteins was carried out in parallel by western
blotting on total cellular extracts after transient transfection in
human 293 cells (not shown).
Nuclear import of SRF 3031
Fig. 1. Summary of the various mutants analyzed in this
work. (A) The global structure of human serum response
factor (SRF) is schematized at top of the figure. The
sequence of the casein kinase II phosphorylation site (CK II,
rectangle with dots) and of the nuclear localization signal
(NLS, filled rectangle) are shown below. DNA stands for
‘DNA-binding domain’, which is shaded in the various
deletion mutants shown below. Numbers refer to the last
amino acid removed by the deletion. β-Galactosidase, which
is fused in-frame at the carboxy terminus of each fragment
of SRF, is not represented. (B) Point mutations generated in
the domain spanning from amino acid 69 to 115, fused at
the amino terminus of β-galactosidase. A portion of the
sequence of the wild-type protein is shown line a+b. - in the
sequence refers to an invariant amino acid; and a and b refer
to small peptides containing, respectively, CK II and NLS;
+ and − stand, respectively, for a nuclear or cytoplasmic
localization of the fusion protein.
While neither carboxy-terminal (amino acids 262 to 508,
Fig. 3F) nor DNA-binding (amino acids 133 to 264, Fig. 2C)
domain-containing fusion proteins were found specifically in
the nucleus, the amino-terminal half (amino acids 1 to 264, Fig.
3A) was very efficient in targeting β-galactosidase to the
nucleus. A series of progressive amino-terminal deletions was
carried out: amino acids 1 to 68 (Fig. 3B), 1 to 91 (Fig. 3C),
1 to 100 (Fig. 3D), and 1 to 115 (not shown), which suggested
that amino acids spanning from 91 to 100 were essential in this
phenomenom. This was confirmed by the internal deletion of
residues 69 to 115, which gave rise to a cytoplasmic locale
(Fig. 3E).
We then generated a series of point mutations starting with
the construct expressing residues 69 to 115. When fused to βgalactosidase this domain is able to direct the protein to the
nucleus (Fig. 4A). It contains the SRF casein kinase II (CK-II)
phosphorylation site, SGSEGDSESGEEEE, and a stretch of
basic amino acids, RRGLKR, which is a good candidate for a
NLS. For sake of simplicity these two motifs were named,
respectively, a and b and the various combinations of
mutations summarized in Fig. 1, where am and bm stand for the
mutated counterpart of each motif. Mutation of the a motif did
not affect the nuclear localization of the fusion protein (Fig.
4B) while mutation of b alone (Fig. 4C) or in conjunction with
a (Fig. 4D) changed it dramatically. When fused alone a was
insufficient to drive the protein to the nucleus (Fig. 4E), while
b was very potent in doing so (Fig. 4F). Finally, when we
expressed an influenza hemagglutinin epitope-tagged entire
SRF, mutation of the RRGLKR stretch was sufficient to
abolish its nuclear location (not shown), thus strongly suggesting the uniqueness of the NLS.
The casein kinase phosphorylation site next to the
NLS is not important for the modulation of nuclear
entry kinetics
It had previously been demonstrated that the rate at which
recombinant SV40 T antigen/β-galactosidase fusion proteins
are transported to the nucleus is dependent on the presence of
a phosphorylation site next to the NLS (Rihs and Peters, 1989;
Rihs et al., 1991). An analysis carried out both in vitro and in
vivo identified the CK-II site S111/S112 to be the determining
factor in the efficiency of the cytonuclear transport. Many
proteins harbor a NLS that is close to amino acids known to
be phosphorylated either in the cytoplasm or in the nucleus and
which are putative CK II phosphorylation sites (reviewed by
Rihs et al., 1991). This invited us to speculate that phosphorylation at this site in the SRF is similarly involved in regulating
nuclear import. We generated recombinant proteins containing
3032 J. Rech and others
Fig. 2. Cytoplasmic localization of an SRF DNA-binding
domain/β-galactosidase fusion protein in REF cells. REF
52 cells were transiently transfected and stained with Xgal as described in Materials and Methods. Vectors
expressed β-galactosidase alone (A); SV40 NLS linked to
the amino terminus of β-galactosidase (B); and the SRF
DBD (amino acids 133 to 264) fused to the same enzyme
(C). Bar, 10 µm.
Fig. 3. Subcellular
localization of fusion
proteins containing
various portions of
human SRF linked to βgalactosidase. REF 52
cells were transiently
transfected with βgalactosidase fusion
protein expressing
vectors, which
contained: SRF residues
1 to 264 (A); 69 to 264
(B); 91 to 264 (C); 101
to 264 (D); 1 to 264 with
the internal deletion of
residues 69 to 115 (E);
and 262 to 508 (F).
While several hundreds
of positive cells were
obtained for each
transfection only a few
representative examples
are shown. Arrowheads
point to some negative
cells for comparison.
Bar, 10 µm.
Nuclear import of SRF 3033
Fig. 4. Point mutagenesis carried out on the SRF domain spanning from amino acid 69 to 115. Mutagenesis was carried out as described in
Materials and Methods and the fusion proteins were analyzed as shown in the preceding figures. (A) Wild-type protein, ab; (B) residues
77SGSEGDSES85 mutated into VGVEGDVEV, mutant a b; (C) residues 95RRGLKR100 mutated into LGGLMG, mutant ab ; (D) combined
m
m
mutations, mutant ambm; (E) fusion protein containing amino acids spanning from residue 75 to 90, mutant a; (F) fusion protein containing
residues 91 to 111, mutant b. As mentioned in Fig. 2 only representative examples are shown. Arrowheads, see Fig. 3. Bar, 10 µm.
SRF sequences spanning from amino acid 69 to 115 fused to
β-galactosidase in the Pin Point Xa vector (Promega), which
encodes a peptide biotinylated in E. coli, thus functioning as a
purification tag (Cronan, 1990; Germino et al., 1993). Biotinylated proteins produced in this system were affinity-purified
using a monomeric avidin resin that allows an elution of the
fusion protein under non-denaturing conditions, providing us
with native proteins that were readily used through microinFig. 5. SDS-polyacrylamide gel electrophoresis of purified
recombinant proteins. Purified proteins (2 µg) were labeled in vitro
with pure CKII from rabbit reticulocytes (generous gift from C.
Gauthier-Rouvière) and [γ-32P]ATP in a standard kinase reaction
mix. Proteins were then separated through a 7% SDS-polyacrylamide
gel, stained with Coomassie Blue R250 (lanes 1, 2, 3, 4) and dried
before autoradiography. Lanes 1, total bacterial extract after
induction (only the wild-type fusion protein is shown); 2 and 5, pure
wild-type ab protein; 3 and 6, pure mutant amb protein; 4, protein
standards (myosin, 200 kDa; β-galactosidase, arrow, 116 kDa;
phosphorylase b, 97 kDa; serum albumin, 66 kDa; glutamic
dehydrogenase, 55 kDa); 5 and 6, autoradiogram of the in vitro
phosphorylated proteins.
jection in REF cells. Protein purity was assessed by SDS-gel
electrophoresis and the ability of the wild type to function, at
least in vitro, as a substrate for CKII determined (Fig. 5).
Recombinant proteins were injected in the cytoplasm and βgalactosidase activity was assayed as described above. Injected
kDa
3034 J. Rech and others
Fig. 6. Transport kinetics of fusion proteins
containing SRF amino acids 69 to 115. REF
52 cells were microinjected with either a
wild-type: ab (A,B,C,D) or a mutated: amb
(E,F,G,H) bacterially expressed fusion
protein, fixed at different time intervals and
stained with X-gal; 20-30 cells were
microinjected for each time point and cells
were fixed either immediately (A and E), or
30 (B and F), 60 (C and G) and 120 (D and
H) minutes after injection. Only
representative examples are shown.
Arrowheads point to uninjected cells for
comparison.
proteins relocalized rapidly into the the nucleus, where more
than 90% of the β-galactosidase activity was found within 6090 minutes (Fig. 6). This result did not depend upon the
presence of the tag and a fusion protein containing a mutated
NLS (abm) remained cytoplasmic (not shown). Within the
limits of the technique no gross difference was observed
between the wild type (Fig. 6A,B,C,D) and the mutated form
(Fig. 6E,F,G,H) of the fusion protein, suggesting that the CK
II site is not regulatory for nuclear import kinetics, at least in
rodent fibroblasts.
When the same experiment was carried out with a β-galactosidase fusion protein containing only the SV40 T NLS, the
protein migrated much more slowly to the nucleus (Fig.
7A,B,D). In contrast, the control protein containing both CKII
and NLS sequences was readily found in the nucleus two hours
after microinjection (Fig. 7E,F).
Nuclear import of SRF 3035
Fig. 7. Transport kinetics of fusion
proteins containing SV40 T NLS. REF 52
cells were microinjected with fusion
proteins containing either SV40 T NLS
alone (A,B,C,D) or a CKII
phosphorylation site next to the NLS
(E,F), and processed as described for Fig.
5. Cells were fixed either immediately (A
and E) or 2 (B,F), 4 (C) and 24 hours (D)
after injection.
DISCUSSION
The switch from quiescence to proliferation is characterized by
the induction of several waves of genes coding for proteins that
will be required for the onset of DNA synthesis. One of these
early response genes involved in the G0-G1 transition is the
proto-oncogene c-fos. Its promoter contains a DNA regulatory
sequence: the serum response element (SRE), which plays a
major role in the transcriptional induction of c-fos in response
to extracellular stimuli. The SRE is the target for the binding
of several proteins among which is a family of 62-67 kDa
dimeric proteins (Pollock and Treisman, 1991). Its generic
element p67SRF is associated with chromatin throughout the
cell cycle (Gauthier-Rouvière et al., 1991a) and is extensively
modified both by phosphorylation, immediately after its
synthesis (Prywes et al., 1988; Manak et al., 1990; Gauthier et
al., 1991a; Misra et al., 1991; Janknecht et al., 1992; Marais et
al., 1992), and by glycosylation (Schröter et al., 1990). Phosphorylation of SRF by CK II was first proposed to be necessary
for its binding to SRE (Prywes et al., 1988; Manak et al., 1990)
and involved in c-fos induction by serum (Gauthier et al.,
1991a), although this point is debated (Manak and Prywes,
1993). The role(s) of this phosphorylation is not known but it
clearly increases the in vitro rate of exchange of SRF without
affecting its affinity very much (Janknecht et al., 1992; Marais
et al., 1992). However, there is still the possibility that phosphorylation modulates the interactions of SRF with other
proteins like p62TCF/ Elk-1 (Schröter et al., 1990; Hill et al.,
1993; Marais et al., 1993). We have mapped close to the CK
II site a stretch of basic amino acids, RRGLKR, which is
necessary and sufficient to target SRF very efficiently to the
nucleus. This NLS sequence is at least as potent as that of SV40
T (PKKKRKV), which is often taken as a reference (Kalderon
et al., 1984; Landford et al., 1986). A similar result has been
recently obtained by chemically coupling a peptide containing
this sequence to rabbit immunoglobulin G (Gauthier-Rouvière,
personal communication). The SRF NLS is present in the
amino-terminal part of the molecule, outside its DNA-binding
domain, which surprisingly contains several stretches of basic
amino acids that are totally dispensable as far as nuclear
transport is concerned. Comparison of human SRF with SRF
from Xenopus as well as with other SRF-related proteins shows
that, while the NLS per se is grossly conserved between human
and Xenopus, the amino terminus of the SRF family is poorly
conserved (Mohun et al., 1991; Pollock and Treisman, 1991;
Chambers et al., 1992; Treisman and Ammerer, 1992). This
suggests that even though clear homologies are encountered
within SRF-related proteins with respect to their DNA-binding
properties, SRF harbors some specific properties like, for
example, its nuclear import. Interestingly, SV40 T NLS is also
close to a CK II site that is phosphorylated both in vitro and
in vivo, and which has been shown to be instrumental in the
control of the rate of nuclear import (Rihs and Peters, 1989;
Rihs et al., 1991). Using recombinant fusion proteins expressed
in bacteria and microinjected into growing REF cells, we have
shown that the rate of nuclear entry is unchanged whether the
CK II site is intact or mutated. This latter result again makes
the SRF conspicuous with regard to cyto-nuclear transport and
is consistent with its constitutive chromatin location (Gauthier
et al., 1991b). More recently, p90rsk kinase, a growth factor-
3036 J. Rech and others
inducible kinase, has been proposed to phosphorylate SRF in
vitro at serine 103, which is transiently phosphorylated in vivo
upon serum stimulation (Rivera et al., 1993). Whether this has
anything to do with transport or transcriptional modulation of
SRF remains to be investigated.
We thank R. Treisman for the gift of T7∆ATG plasmid and C.
Gauthier-Rouvière for communicating results prior to publication.
This work was supported by grants from CNRS, INSERM and the
Association pour la Recherche contre le Cancer.
REFERENCES
Chambers, A. E., Kotecha, S., Towers, N. and Mohun, T. J. (1992). Musclespecific expression of SRF-related genes in the early embryo of Xenopus
leavis. EMBO J. 11, 4981-4991.
Cronan, J. E. Jr (1990). Biotination of proteins in vivo. J. Biol. Chem. 265,
10327-10333.
Deng, W. P. and Nickoloff, J. A. (1992). Site-directed mutagenesis of virtually
any plasmid by eliminating a unique site. Anal. Biochem. 200, 81-88.
Garcia-Bustos, J., Heitman, J. and Hall, M. N. (1991). Nuclear protein
localization. Biochem. Biophys. Acta 1071, 83-101.
Gauthier, R. C., Basset, M., Blanchard, J. M., Cavadore, J. C., Fernandez,
A. and Lamb, N. J. (1991a). Casein kinase II induces c-fos expression via
the serum response element pathway and p67SRF phosphorylation in living
fibroblasts. EMBO J. 10, 2921-2930.
Gauthier, R. C., Cavadore, J. C., Blanchard, J. M., Lamb, N. J. and
Fernandez, A. (1991b). p67SRF is a constitutive nuclear protein implicated
in the modulation of genes required throughout the G1 period. Cell Regul. 2,
575-588.
Gauthier-Rouvière, C., Caï, Q. Q., Lautredou, N., Fernandez, A., M., B. J.
and Lamb, N. J. C. (1993). Expression and purification of the DNA-binding
domain of SRF: SRF-DB, a part of a DNA binding protein which can act as a
dominant negative mutant in vivo. Exp. Cell Res. 209, 208-215.
Germino, F. J., Wang, Z. X. and Weissman, S. M. (1993). Screening for in
vivo protein-protein interactions. Proc. Nat. Acad. Sci. USA 90, 933-937.
Gutman, A., Wasylyk, C. and Wasylyk, B. (1991). Cell-specific regulation of
oncogene-responsive sequences of the c-fos promoter. Mol. Cell. Biol. 11,
5381-5387.
Hall, C. V., Jacob, P. E., Ringold, G. M. and Lee, F. (1983). Expression and
regulation of Escherichia coli lacZ gene fusions in mammalian cells. J. Mol.
Appl. Genet. 2, 101-109.
Herrera, R. E., Shaw, P. E. and Nordheim, A. (1989). Occupation of the c-fos
serum response element in vivo by a multi-protein complex is unaltered by
growth factor induction. Nature 340, 68-70.
Hill, C. S., Marais, R., John, S., Wynne, J., Dalton, S. and Treisman, R.
(1993). Functional analysis of a growth factor-responsive transcription factor
complex. Cell 73, 395-406.
Janknecht, R., Hipskind, R. A., Houthaeve, T., Nordheim, A. and
Stunnenberg, H. G. (1992). Identification of multiple SRF N-terminal
phosphorylation sites affecting DNA binding properties. EMBO J 11, 10451054.
Johansen, F. E. and Prywes, R. (1993). Identification of transcriptional
activation and inhibitory domains in serum response factor (SRF) by using
GAL4-SRF constructs. Mol. Cell. Biol. 13, 4640-4647.
Kalderon, D., Richardson, W. D., Markham, A. F. and Smith, A. E. (1984).
Sequence requirements for nuclear location of simian virus 40 large T
antigen. Nature 311, 33-38.
Lamb, N. J., Fernandez, A., Tourkine, N., Jeanteur, P. and Blanchard, J.
M. (1990). Demonstration in living cells of an intragenic negative regulatory
element within the rodent c-fos gene. Cell 61, 485-496.
Landford, R. E., Kanda, P. and Kennedy, R. C. (1986). Induction of nuclear
transport with a synthetic peptide homologous to the SV40 T antigen
transport signal. Cell 46, 575-582.
Laskey, R. A. and Dingwall, C. (1993). Nuclear shuttling : the default pathway
for nuclear proteins ? Cell 74, 585-586.
Manak, J. R., de, B. N., Kris, R. M. and Prywes, R. (1990). Casein kinase II
enhances the DNA binding activity of serum response factor. Genes Dev. 4,
955-967.
Manak, J. R. and Prywes, R. (1993). Phosphorylation of serum response
factor by casein kinase. 2. Evidence against a role in growth factor regulation
of fos-expression. Oncogene 8, 703-711.
Marais, R. M., Hsuan, J. J., McGuigan, C., Wynne, J. and Treisman, R.
(1992). Casein kinase II phosphorylation increases the rate of serum response
factor-binding site exchange. EMBO J. 11, 97-105.
Marais, R. M., Wynne, J. and Treisman, R. (1993). The SRF accessory
protein Elk-1 contains a growth factor-regulated transcriptional activation
domain. Cell 73, 381-393.
Misra, R. P., Rivera, V. M., Wang, J. M., Fan, P. D. and Greenberg, M. E.
(1991). The serum response factor is extensively modified by
phosphorylation following its synthesis in serum-stimulated fibroblasts. Mol.
Cell. Biol. 11, 4545-4554.
Mohun, T. J., Chambers, A. E., Towers, N. and Taylor, M. V. (1991).
Expression of genes encoding the transcription factor SRF during early
development of Xenopus laevis; identification of a CArG box-binding
activity as SRF. EMBO J. 10, 933-940.
Piechaczyk, M. and Blanchard, J. M. (1994). c-fos proto-oncogene
regulation and function. Crit. Rev. Oncol./Hematol. 16, (in press).
Pollock, R. and Treisman, R. (1991). Human SRF-related proteins: DNAbinding properties and potential regulatory targets. Genes Dev. 5, 2327-2341.
Prywes, R., Dutta, A., Cromlish, J. A. and Roeder, R. G. (1988).
Phosphorylation of serum response factor, a factor that binds to the serum
response element of the c-FOS enhancer. Proc. Nat. Acad. Sci. USA 85,
7206-7210.
Rihs, H. P. and Peters, R. (1989). Nuclear transport kinetics depend on
phosphorylation-site-containing sequences flanking the kariophilic signal of
the simian virus 40 T-antigen. EMBO J. 8, 1479-1484.
Rihs, H. P., Jans, D. A., Fan, H. and Peters, R. (1991). The rate of nuclear
cytoplasmic protein transport is determined by the casein II site flanking the
nuclear localization sequence of the SV40 T-antigen. EMBO J. 10, 633-639.
Rivera, V. M. and Greenberg, M. E. (1990). Growth factor-induced gene
expression: the ups and downs of c-fos regulation. New Biol. 2, 751-758.
Rivera, V. M., Miranti, C. K., Misra, R. P., Ginty, D. D., Chen, R. H.,
Blenis, J. and Greenberg, M. (1993). A growth factor induced kinase
phosphorylates the serum response factor at a site that regulates its DNAbinding activity. Mol. Cell. Biol. 13, 6260-6273.
Schröter, H., Mueller, C. G. F., Meese, K. and Nordheim, A. (1990).
Synergism in ternary complex formation between the dimeric glycoprotein
p67SRF, polypeptide p62TCF and the c-fos serum response element. EMBO J.
9, 1123-1130.
Silver, P. (1991). How proteins enter the nucleus. Cell 64, 489-497.
Treisman, R. (1990). The SRE: a growth factor responsive transcriptional
regulator. Semin. Cancer Biol. 1, 47-58.
Treisman, R. (1992). The serum response element. Trends Biochem. Sci. 17,
423-426.
Treisman, R. and Ammerer, G. (1992). The SRF and MCM1 transcription
factors. Curr. Opin. Genet. Dev. 2, 221-226.
(Received 9 February 1994 - Accepted, in revised form,
25 July 1994)