Download Supplementary methods

Supplementary methods
Isolation of opaA suppressor strains
By plating GM3817 cells on media lacking xylose, we isolated suppressor strains of the
opaA deletion which lost the covering plasmid pJT157 and contained no opaA DNA as
assessed by PCR. These suppressor strains have rich PYE media doubling times that are
1.9 ± 0.2 times longer than WT and faster growth can be stimulated by restoring opaA on
a plasmid (data not shown). Therefore OpaA performs functions which are essential, but
can be bypassed by suppressor mutations. Yet OpaA is still required for optimal growth
as would be expected for a coordinator of cell cycle functions.
Plasmid and Strain Construction
To create a construct for disruption of opaA with the omega antibiotic resistance cassette,
two regions of approximately 1 kb of DNA upstream and downstream of the opaA coding
sequence, including 6 codons in the 5' region and 11 codons in the 3' region of opaA,
were inserted into pNPTS128, and an omega cassette placed between them to create
pJT154.
Construction of the opaA depletion strain GM3817 was initially attempted by
transformation of GM1609 with pJT154 followed by two step homologous recombination
as described (Skerker, Prasol et al. 2005), but using Spectinomycin/Streptomycin
selection rather than tetracycline to select for knockout constructs. As deletion of opaA
proved impossible, we sought to create the deletion in the presence of a complementing
plasmid. Therefore GM1609 was transformed with pJT156 (carrying opaA) and colonies
isolated on chloramphenicol, prior to transformation with pJT154. The two-step knockout
process was then repeated, successfully creating chromosomal deletions. This
complemented deletion strain was transformed with pJT157 carrying opaA under the
control of Pxyl. In the presence of xylose to induce OpaA selection, we then screened for
loss of pJT156, finally isolating strain GM3817.
The CoriUP mutation was created by site-directed mutagenesis (Quikchange, Stratagene)
of Cori as previously described (Taylor, Ouimet et al. 2011) using the UP fwd & rev
oligonucleotide pair (Table S4).
To generate parAK20R, the parA gene was amplified from GM1609 genomic DNA using
the parA fwd & rev primer pair, cloned using the pJET cloning kit (Thermo) and
subjected to site-directed mutagenesis using the parAK20R fwd & rev primer pair. The
mutated gene was then moved into pMT676 to create pJT203. This plasmid was then
transformed into GM3905 and GM3920 to create strains with parAK20R integrated at
Pvan which were isolated on media containing chloramphenicol.
The opaA coding sequence was amplified by PCR (primer pair opaA fwd and rev, Table
S4) and inserted into pET28 to encode an N-terminal fusion to a His-tag (pJT160).
Mutations described in Fig. S6 were introduced into opaA in the expression vector
pJT160 by site-directed mutagenesis using primer pairs "opaAR26A fwd & rev" or
"opaAY82A fwd & rev".
The mCherry-opaA fusion construct was created by amplifying opaA by PCR using the
primer pair "opaA N-fusion" and "opaA rev" (Table S4). This product was then placed in
pMT699, thus encoding mCherry-OpaA under the control of Pxyl in a plasmid that
allows integration at Pxyl on the C. crescentus chromosome. To create GM3921, pJT200
was transformed into GM3905 and colonies were selected on media containing
chloramphenicol.
Protein purification
Recombinant His-OpaA was purified in the following manner: E. coli BL21 (DE3)
carrying pJT160 was grown with selection (kanamycin) in LB at 30 ˚C with shaking to an
OD600 of 0.3. IPTG was added to a final concentration of 0.5 mM, and expression was
allowed to continue for 5 hours. Cells were harvested by centrifugation and the cell
pellets stored at -80 ˚C. For purification, the pellet was thawed, resuspended and
incubated on ice for 30 mins in buffer B (Fig. S1) lacking DTT and containing 0.5 M
NaCl, 40 mM imidazole and 1 mg ml-1 lysozyme. Cells were then lysed by sonication.
The lysate was cleared by centrifugation at 104 x g and the cleared lysate was applied to a
HisTrap column using an AKTA system (GE Healthcare). An imidazole gradient was
then applied to elute the protein. A further purification was then performed on fractions
containing His-OpaA using a step gradient on a Heparin-agarose column (BioRad) from
buffer B to buffer B + 0.5 M NaCl (both lacking DTT). The same purification strategy
was used for the mutant proteins described in Fig. S6. For antibody preparation (see
Immunoblotting below), the purified protein was re-concentrated on the HisTrap column
and transferred into 50 mM phosphate buffer (pH 7.4) with 0.5 M NaCl using a HiTrap
Desalting column (GE Healthcare).
In order to raise antibodies against CtrA, recombinant GST-CtrA protein was purified by
insertion of the ctrA gene into pGEX-4T-1 (GE Healthcare) which was transformed into
E. coli BL21 (DE3) with selection on media containing ampicillin. Overexpression, lysis
and purification were performed using a HiTrap-GST column (GE Healthcare) as
recommended by the manufacturer.
qRT-PCR
Reverse transcription was performed using and random hexamer primer (Fermentas) or a
gene specific primer (as indicated) with the M-MuLV reverse transcriptase (Fermentas)
as recommended by the manufacturer. qPCR was performed using gene specific pirmers
(Table S5) as described in the qChIP methods section. Expression levels were calculated
using the comparative Ct method (Schmittgen and Livak 2008) with the 16S rRNA gene
as a reference gene.
Chromatin ImmunoPrecipitation coupled to deep Sequencing (ChIP-Seq)
Mid-log phase cells (O.D.660nm~0.5), cultivated in PYE or preincubated for 10 min with
antibiotics (Rifampicin 30µg/ml; Novobiocin 100µg/ml), were then cross-linked in 10
mM sodium phosphate (pH 7.6) and 1% formaldehyde at room temperature for 10 min
and thereafter on ice for 30 min, then washed three times in phosphate buffered saline
(PBS) and lysed in a Ready-Lyse lysozyme solution (Epicentre Biotechnologies,
Madison, WI) according to the manufacturer’s instructions. Lysates were sonicated
(Bioruptor® Pico, www.diagenode.com) at 4°C using 15 bursts of 30 sec to shear DNA
fragments to an average length of 0.3-0.5 kbp and cleared by centrifugation at 14,000
rpm for 2 min at 4°C. Lysates were then diluted to 1 mL using ChIP buffer (0.01% SDS,
1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl [pH 8.1], 167 mM NaCl plus
protease inhibitors (Roche, www.roche.com) and pre-cleared with 80 μL of protein-A
agarose (Roche, www.roche.com) and 100 µg BSA. Polyclonal antibodies to OpaA were
added to the remains of the supernatant (1:1,000 dilution), incubated overnight at 4°C
with 80 μL of protein-A agarose beads pre-saturated with BSA, washed once with low
salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl (pH 8.1), 150
mM NaCl), high salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM TrisHCl (pH 8.1), 500 mM NaCl) and LiCl buffer (0.25 M LiCl, 1% NP-40, 1% sodium
deoxycholate, 1 mM EDTA, 10 mM Tris-HCl (pH 8.1)) and twice with TE buffer (10
mM Tris-HCl (pH 8.1) and 1 mM EDTA). The protein•DNA complexes were eluted in
500 μL freshly prepared elution buffer (1% SDS, 0.1 M NaHCO3), supplemented with
NaCl) to a final concentration of 300 mM and incubated overnight at 65°C to reverse the
crosslinks. The samples were treated with 2 μg of Proteinase K for 2 h at 45°C in 40 mM
EDTA and 40 mM Tris-HCl (pH 6.5). DNA was extracted using
phenol:chloroform:isoamyl alcohol (25:24:1), ethanol-precipitated using 20 μg of
glycogen as a carrier and resuspended in 100 μl of water.
HiSeq 2000 runs of barcoded ChIP-Seq libraries yielded several million reads that were
mapped to the Caulobacter crescentus NA1000 (NC_011916, circular form) using
Bowtie version 0.12.9 (http://bowtie-bio.sourceforge.net/). The standard genomic
position format files (BAM, using Samtools, http://samtools.sourceforge.net/) were
imported into SeqMonk version 0.21.0 (Braham
http://www.bioinformatics.babraham.ac.uk/projects/seqmonk/) to build sequence read
profiles. The initial quantification of the sequencing data was done in SeqMonk to allow
the normalization and the comparison of different experiments. Briefly, the genome was
subdivided into 1 bp (isolated regions) or 50 bp (full chromosome) probes, and for every
probe we calculated the percentage of reads per probe as a function of the total number of
reads (using the Red Count Quantitation option). The overall average read count (for all
probes) plus twice the standard deviation was used to establish the lower cut-off that
separates the background from candidate peaks. Analyzed data illustrated in Figure 3A
using the Circos Software (Krzywinski, Schein et al. 2009) are provided in Dataset S1
(50 bp resolution). Figure 3B focuses on the par and the Cori regions (4026155 to 1150
bp on the circular Caulobacter crescentus genome), analyzed dataset are provided in
Dataset S2 (full chromosome at 50 bp resolution) and Dataset S3 (par and Cori regions at
1 bp resolution).
Whole genome sequencing
Genomic DNA from suppressor strains selected for whole genome sequencing was
isolated using the DNeasy kit (Qiagen). Whole genome sequencing (Illumina MiSeq) was
performed at the Tufts University Core Facilty (TUCF). SNP detection (Table S2) was
performed using the Bowtie2 aligner (Langmead and Salzberg 2012), Burrows-Wheeler
aligner (Li and Durbin 2009) and Samtools software package (Li, Handsaker et al. 2009).
To detect insertions/deletions, genomes were assembled and ordered using the Edena
(Hernandez, Francois et al. 2008) and Contiguator (Galardini, Biondi et al. 2011)
packages and compared to the NA1000 consensus sequence using WebACT (Abbott,
Aanensen et al. 2005).
Supplementary Tables
S1 Table. Frequencies of sucrose resistant secondary recombinants that were deleted for
the opaA gene following the two-step knockout procedure described in the methods
section
Strain background
GM1609 (wild type parent strain)
GM1609 + pJT156 (carrying opaA gene)
GM3921 [gfp-parB Pxly::mCherry-opaA]
opaA deletion recovery frequency
0% (n=120)
45% (n=20)
60% (n=20)
S2 Table. Candidate suppressor mutations in independently derived opaA null suppressor
strains
Suppressor
strain
3920
Parent strain
3875
3817
3918
3981
3817
3982
3817
3983
3817
Candidate
mutation target
ccna_r0066
(23S rRNA)
Genomic coordinates
(NA1000 genome)
2863779 (T->C)
ccna_00850
Deletion 926240..926304
ccna_r0066
(23S rRNA)
Intergenic
between
ccna_r0021 and
ccna_r0022
ccna_r0066
(23S rRNA)
2862895 (C->CG)
1057160 (C->T)
2862930 (A->C)
ccna_00809
873065 (A->C)
(quinone
oxidoreductase)
rpoB
550721 (A->G)
ccna_02820
2976487 (IS insertion)
S3 Table. C. crescentus strains used in this study.
Strain
Genetic description
Reference
NA1000 Δbla
(Zweiger, Marczynski et al.
name
GM1609
1994)
GM3817
Δbla opaA::omega; pJT157 [Pxyl::opaA]
This study
GM3875
Δbla opaA::omega suppressor strain
This study
GM3905
gfp-parB (MT174 from Thanbichler and
(Thanbichler and Shapiro
Shapiro, 2006)
2006)
gfp-parB opaA::omega; pJT157 [Pxyl-
This study
GM3918
opaA]
GM3920
gfp-parB opaA::omega suppressor strain
This study
GM3921
gfp-parB Pxyl::mCherry-opaA
This study
GM3880
CoriUP mutation opaA::omega; pJT157
This study
S4 Table. Plasmids used in this study.
Plasmid name
Genetic description
Reference
pMT375
Low copy number plasmid carrying Pxyl
(Thanbichler, Iniesta et al.
2007)
pJS14
High copy number broad host range
J. Skerker, unpublished
vector
pRK290
Low copy number broad host range
(Ditta, Stanfield et al. 1980)
vector
pNPTS128
kanR sacB for two-step genetic knockout (Alley 2001)
pJT90
pUC19 based vector carrying Cori and
(Taylor, Ouimet et al. 2011)
gusA; reporter of Cori activity
pJT90UP
pJT90, with CoriUP mutation
This study
pJT154
Knockout construct to replace opaA with
This study
omega cassette, based on pNPTS128
pJT156
pJS14 carrying opaA under its native
This study
promoter
pJT157
pRXMCS-5 carrying opaA under the
This study
control of Pxyl
pJT160
pET28 (EMD Biosciences) derivative
This study
encoding his-opaA
pJT165
pRK290 carrying opaA under its native
This study
promoter
pMT699
N-terminal mCherry fusion vector,
(Thanbichler, Iniesta et al.
integrative at Pxyl
2007)
pJT200
Pxyl::mCherry-opaA
This study
pMT676
Expression vector integrative at Pvan
(Thanbichler, Iniesta et al.
2007)
pJT203
Pvan::parAK20R
This study
S5 Table. Oligonucleotides used in this study. Oligonulceotide sequences are listed 5'-3'.
Oligonucleotide name
Sequence
WT fwd
gcagg gcaag tggtt aagca gccgt taacg gatga tccac agg
WT rev
cctgt ggatc atccg ttaac ggttg cttaa ccact tgccc tgc
UP fwd
gcagg gcaag tggtt aagca tatgt taacg gatga tccac agg
UP rev
cctgt ggatc atccg ttaac atatg cttaa ccact tgccc tgc
parAK20R fwd
gggtggggtggggcgcaccacgaccgcg
parAK20R rev
cgcggtcgtggtgcgccccaccccaccc
opaAR26A fwd
gaagt cgatc atcga ggccg tcgag cgcct g
opaAR26A rev
caggc gctcg acggc ctcga tgatc gactt c
opaAY82A fwd
cgatc ctcga cctcg ccctg tcggc gatcg g
opaAY82A rev
ccgat cgccg acagg gcgag gtcga ggatc g
qparB fwd
cgccctcgatgatttgcttg
qparB rev
gtacctggtcagtggtgagc
qccna_2005 fwd
tttctatgccgacccggaag
qccna_2005 rev
tgtcgtccatagaccgtcct
qhemE fwd
catataggtcgcgacggtc
qhemE rev
ctttcgcttgtcggggaaa
qrodA fwd
ctggcggatcatcttcgcgg
qrodA rev
gcctcggggttcaggaaggt
qCoriL fwd
gacgtcatggaccgggttaaa
qCoriL rev
cttccgctccctccttcaatc
qCoriM fwd
aacgtcctgagacacgacag
qCoriM rev
tcgcattgctcgcctatcat
qCoriR fwd
tgtcacgacgctgttggg
qCoriR rev
cggttgcttaaccacttgcc
opaA fwd
acatatggccgacgacgccatt
opaA rev
gaattccaggacacgtccaacaagg
opaA N-fusion
aaggtacc ggcggcggcggctcg atggccgacgacgccattcc
KOopaA L fwd
acaagaaagacgcgacgatc
KOopaA L rev
gatatcaatggcgtcgtcggccatgg
KOopaA R fwd
gatatcctcgacctctatctgtc
KOopaA R rev
gaattccaggacacgtccaacaagg
Supplementary figure legends
S1 Fig. Purification of a Cori binding protein. A workflow diagram showing the
various fractionation methods used to purify a protein with replication origin binding
activity from a cleared lysate of C. crescentus cells. Start and elution buffers for each
column step are shown, together with the length of the linear gradient applied to each
column. 1 – Methods used to separate proteins (1 ml HiTrap FPLC column used).
Fractions with peak binding activity assessed by EMSA were pooled and applied to the
next purification step.
2
– Buffer A is 50 mM Tris pH 7.9, 100 mM NaCl, 1mM dithiothreitol (DTT), 1 mM
EDTA, 5 % glycerol. Buffer B is 50 mM Na-phosphate pH 7.4, 10 mM NaCl, 1 mM
DTT.
3
– Linear gradients were applied using an AKTA prime FPLC system (GE Healthcare).
S2 Fig. OpaA depletion causes cell death. A) A cartoon showing the genetic disruption
in GM3817, complemented by the conditional expression vector pJT157. B) Optical
density (OD660) of a culture of GM3817 grown in PYE/xylose and shifted to
PYE/glucose to shut off expression of opaA (open circles, solid line) and colony forming
units CFU/ml (solid squares, dotted line) from the same culture.
S3 Fig. Degradation of cell cycle marker protein McpA. Western blots performed on
samples from the synchronies presented in Fig. 2A probed with anti-McpA. As for CtrA,
McpA removal at the Sw-St transition is unaffected by the lack of OpaA, but reaccumulation later in the cell cycle is delayed.
S4 Fig. Direct in vivo binding of OpaA to Cori affects replication. A) Increased OpaA
binding at Cori allows Sw cells to initiate replication in the presence of lower
concentrations of OpaA. As in Fig. 2, the traces represent histograms from flow-
cytometry analysis of synchronized cultures of GM3880, with propidium iodide
fluorescence on the x-axis. The fluorescence intensities corresponding to one or two
chromosomes are indicated. The opaA deletion was transduced into a strain in which the
WT Cori sequence is replaced with the CoriUP mutation (Fig. 1) and which carries
pJT157 in order to create an OpaA depletion strain with CoriUP at Cori. This strain is
able to initiate replication without induction of new OpaA expression, suggesting that
Cori is using low concentrations of OpaA more efficiently. B) OpaA is responsible for
the increased replication of the CoriUP mutation. The opaA null suppressor strain
GM3875 does not show the increased replication phenotype of the CoriUP mutation that is
seen in the parental GM1609 wild type strain. C) A suppressor mutation bypasses the
requirement for OpaA in replication initiation. Histograms as in (A) from a synchronous
culture of GM3875, a strain derived from GM3819 that does not require xylose for
growth and that has lost pJT157, behaves similarly to the wild type strain GM1609 in the
replication initiation assay. As before, the 1 and 2 chromosome peaks are indicated, but
here low-fluorescence background debris was not gated.
S5 Fig. qChIP experiments supporting ChIP-seq data in Fig. 2. A) Charts reporting
OpaA binding assayed by qChIP (cross-linking and immunoprecipitation against OpaA,
followed by analysis of enrichment by qPCR) at parB and hemE (located within Cori)
Cori_right (CtrA binding site 'e'/ccna_00001)) which show OpaA binding by ChIP-seq
(Fig. 3C), as well as a locus (rodA) predicted to not be enriched in OpaA binding. To the
right, the same data for rodA with an altered scale on the y-axis. B) Changes in the
fraction of parB (black bars) and hemE (grey bars) immuno-precipitated by anti-OpaA in
untreated GM1609 and GM1609 treated with rifampicin (10 ug/ml, 10 mins) or
novobiocin (10 ug/ml, 10 mins), normalized to the fraction immuno-precipitated in the
untreated condition in GM1609. As a control, the normalized fraction of various loci
immuno-precipitated from GM3875, a null opaA suppressor strain, is shown.
S6 Fig. Preliminary analysis of the DNA binding determinants in OpaA. The
sequence of OpaA from C. crescentus (plain text) is shown together with a sequence logo
(top) showing amino-acid conservation in OpaA, generated using Weblogo (Crooks, Hon
et al. 2004) from the 100 sequences most similar to OpaA in the NCBI protein database.
A schematic shows a structural prediction of alpha-helical content (cylinders) of OpaA
generated using the SSpro8 program (Pollastri, Przybylski et al. 2002) below the
sequence logo. A region with a high probability (p > 0.8) of forming a coiled-coil is
shown under the OpaA sequence (coil cartoon) predicted using the PCoil program
(Gruber, Soding et al. 2005). Two individual mutations were introduced at conserved
residues (arrows) and assessed for DNA binding. B) Purified WT His-OpaA, HisOpaAR26A and His-OpaAY82A were used at equal concentrations in EMSA reactions to
shift WT oligonucleotides. Lane marked "-" contains no protein, while other lanes
contain a set of ten-fold dilution series of each protein.
S7 Fig. ChIP-seq plots surrounding additional selected peaks of OpaA binding. As
in Fig. 3C, ChIP-seq binding intensity (arbitrary units) is plotted against genome position,
with a schematic showing local CDS position and direction below the graph. To aid the
reader, one CDS close to the untreated OpaA binding peak is highlighted in red and
named on the left of each graph. ChIP-seq data from untreated cells (blue) and cells
treated as described (see Methods) with rifampicin (pink) and novobiocin (yellow) are
plotted.
S8 Fig. Complete set of images at 15 minute time-points for the first 90 minutes of a
synchronized culture of GM3921, a subset of which are shown in Fig. 7.
S9 Fig. OpaA protein. A) A representative Western blot showing OpaA levels over the
cell cycle in PYE. Equal volumes of culture were sampled at the indicated times
(minutes) and loaded in each lane. B) Quantification of OpaA levels by Western blot
(n=3) with anti-OpaA in synchronous cultures of GM1609 cells (top panel) along with a
non-specific cross-reacting band as a loading control (bottom panel). OpaA abundance
relative to that in newly isolated swarmer cells is plotted, showing that levels in St cells
are higher than in Sw cells.
S10 Fig. Quantification of the location of parS loci in a synchronous culture of GM1609.
Cells were treated for 10 minutes with rifampicin (30 μg/ml), chloramphenicol (1 μg/ml),
or no antibiotic after 30 minutes of synchronous growth. After treatment, samples from
each condition were subjected to flow-cytometry analysis with outgrowth (as in Fig. 2
and described in Methods) to determine the fraction of cells that had initiated replication.
No sample showed a greater than 5% difference in the number of cells that had initiated
replication. ** indicates a significant difference (z-test; p<0.01).
S11 Fig. OpaA phylogeny. A phylogenetic tree generated using Clustal Omega
(Sievers, Wilm et al. 2011) from homologues of OpaA from selected alpha-
proteobacteria and from phage sequences. Phage sequences are indicated, and generally
cluster with organisms that they infect. However, the Roseobacter phage RDJL Phi1
clustered instead with sequences from Zymomonas mobilis. Interestingly, opaA
homologues in Zymomonas mobilis are encoded on plasmids. The host organism of
EBPR Siphovirus 2 has not been specifically determined (Skennerton, Angly et al. 2011).
References for Supplementary Information
Abbott, J. C., D. M. Aanensen, K. Rutherford, S. Butcher and B. G. Spratt (2005).
"WebACT--an online companion for the Artemis Comparison Tool." Bioinformatics
21(18): 3665-3666.
Alley, M. R. (2001). "The highly conserved domain of the Caulobacter McpA
chemoreceptor is required for its polar localization." Mol Microbiol 40(6): 1335-1343.
Crooks, G. E., G. Hon, J. M. Chandonia and S. E. Brenner (2004). "WebLogo: a
sequence logo generator." Genome Res 14(6): 1188-1190.
Ditta, G., S. Stanfield, D. Corbin and D. R. Helinski (1980). "Broad host range DNA
cloning system for gram-negative bacteria: construction of a gene bank of Rhizobium
meliloti." Proc Natl Acad Sci U S A 77(12): 7347-7351.
Galardini, M., E. G. Biondi, M. Bazzicalupo and A. Mengoni (2011). "CONTIGuator: a
bacterial genomes finishing tool for structural insights on draft genomes." Source Code
Biol Med 6: 11.
Gruber, M., J. Soding and A. N. Lupas (2005). "REPPER--repeats and their periodicities
in fibrous proteins." Nucleic Acids Res 33(Web Server issue): W239-243.
Hernandez, D., P. Francois, L. Farinelli, M. Osteras and J. Schrenzel (2008). "De novo
bacterial genome sequencing: millions of very short reads assembled on a desktop
computer." Genome Res 18(5): 802-809.
Krzywinski, M., J. Schein, I. Birol, J. Connors, R. Gascoyne, D. Horsman, S. J. Jones and
M. A. Marra (2009). "Circos: an information aesthetic for comparative genomics."
Genome Res 19(9): 1639-1645.
Langmead, B. and S. L. Salzberg (2012). "Fast gapped-read alignment with Bowtie 2."
Nat Methods 9(4): 357-359.
Li, H. and R. Durbin (2009). "Fast and accurate short read alignment with BurrowsWheeler transform." Bioinformatics 25(14): 1754-1760.
Li, H., B. Handsaker, A. Wysoker, T. Fennell, J. Ruan, N. Homer, G. Marth, G. Abecasis,
R. Durbin and S. Genome Project Data Processing (2009). "The Sequence
Alignment/Map format and SAMtools." Bioinformatics 25(16): 2078-2079.
Pollastri, G., D. Przybylski, B. Rost and P. Baldi (2002). "Improving the prediction of
protein secondary structure in three and eight classes using recurrent neural networks and
profiles." Proteins 47(2): 228-235.
Schmittgen, T. D. and K. J. Livak (2008). "Analyzing real-time PCR data by the
comparative C(T) method." Nat Protoc 3(6): 1101-1108.
Sievers, F., A. Wilm, D. Dineen, T. J. Gibson, K. Karplus, W. Li, R. Lopez, H.
McWilliam, M. Remmert, J. Soding, J. D. Thompson and D. G. Higgins (2011). "Fast,
scalable generation of high-quality protein multiple sequence alignments using Clustal
Omega." Mol Syst Biol 7: 539.
Skennerton, C. T., F. E. Angly, M. Breitbart, L. Bragg, S. He, K. D. McMahon, P.
Hugenholtz and G. W. Tyson (2011). "Phage encoded H-NS: a potential achilles heel in
the bacterial defence system." PLoS One 6(5): e20095.
Skerker, J. M., M. S. Prasol, B. S. Perchuk, E. G. Biondi and M. T. Laub (2005). "Twocomponent signal transduction pathways regulating growth and cell cycle progression in
a bacterium: a system-level analysis." PLoS Biol 3(10): e334.
Taylor, J. A., M. C. Ouimet, R. Wargachuk and G. T. Marczynski (2011). "The
Caulobacter crescentus chromosome replication origin evolved two classes of weak
DnaA binding sites." Mol Microbiol 82(2): 312-326.
Thanbichler, M., A. A. Iniesta and L. Shapiro (2007). "A comprehensive set of plasmids
for vanillate- and xylose-inducible gene expression in Caulobacter crescentus." Nucleic
Acids Res 35(20): e137.
Thanbichler, M. and L. Shapiro (2006). "MipZ, a spatial regulator coordinating
chromosome segregation with cell division in Caulobacter." Cell 126(1): 147-162.
Zweiger, G., G. Marczynski and L. Shapiro (1994). "A Caulobacter DNA
methyltransferase that functions only in the predivisional cell." J Mol Biol 235(2): 472485.