Download VECTOR SYSTEMS XXVII.indd

VECTOR SYSTEMS
Distributed
by: BOCASCIENTIFIC INC.
950 PENINSULA CORPORATE CIRCLE
SUITE 1025
BOCA RATON, FL 33497
1-866-227-6335
FAX 561-995-5018
[email protected] www.bocascientific.com
© MoBiTec GmbH, 2009
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Vector Systems from MoBiTec
Contents
Page 1
Page
NICE® Expression System for Lactococcus lactis
2
Bacillus megaterium Expression Systems
3
Bacillus subtilis Expression Vectors
6
pBacTag Tagging Vectors
8
Yeast Expression Vectors
9
pORF-CLONE Vector System
10
pPICHOLI Shuttle Vector System
12
Mammalian Expression Vectors
13
CMV Expression Vectors
13a
Fusion Protein Cloning System PheBo
14
Fusion Protein Cloning System pAX
16
BRP Plasmids and Competent BRP Cells
18
PCR Cloning Vector p3T
20
Poly(His)-tag Cloning Vector pEG-His1
21
Exontrap Cloning Vector
22
ssDNA-Production and Expression in pMEX
24
Promoter-Trap Vector pBBR RESO (Broad-Host-Range)
25
Broad-Host-Range Vectors pBBR122 and pBHR1
26
Suicide Vector pCorrectClone
27
Multiple Cloning Site Vector pMCS5
28
Standard Cloning Vectors
30
EosFP - Green to Red Photoconvertible Fluorescent Protein
32
Related Products
Endoproteases, ideal for Removal of Fusion Tags
MobiTEV Protease
33
IgA Protease, HRV3C Protease
34
Kex2 Protease, Pro39 Protease
35
Factor Xa Protease, HS-Nuclease
36
MobiSpin Columns for DNA Purification
37
For detailed information: www.mobitec.com
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
NICE® Expression System for Lactococcus lactis
Page 2
The Effective & Easy-to-Operate NIsin Controlled Gene Expression System
Features
 Expression of membrane proteins

 Tightly controlled gene expression allows produc-
tion of toxic proteins
Secretion of proteins into the medium
Less endogenous and no exogenous proteases
No inclusion bodies
Endotoxin-free food grade expression system
Simple fermentation, scale-up and downstream
processing

Product Description
L. lactis is increasingly used in modern biotechnology
for the production of recombinant proteins for food, feed,
pharma and biocatalysis applications. Essential is the
easy genetic accessibility of L. lactis. Protein expression
is controlled by Nisin.









Areas of application
Production of homologous and heterologous proteins
for food, feed, pharma and biocatalysis applications
Production of prokaryotic and eukaryotic membrane
proteins
Production of exo-polysaccharides
Production of ingredients through metabolic engineering: e.g. alanine, folate, diacetyl
Preparation of L. lactis as a biocatalyst by expression
of a suitable enzyme as e.g. dehydrogenases and in
situ co-factor regeneration
High throughput screening for enzyme evolution or enzyme comparison.
Electron microscope image of Lactococcus lactis
The effective & easy-to-operate Nisin Controlled gene
Expression system (NICE®) for Lactococcus lactis is
perfectly suited for a food grade protein expression.
The patented NICE® system was developed by NIZO food research BV. NICE® is a trademark of NIZO food research BV. Patent EP0712935, EP0355036, EP0228726.
Order Information, Shipping & Storage
Order No.
Description
VS-ELV00100-01
NICE® pNZ8008 Reference plasmid with gusA gene
VS-ELV00200-01
NICE® pNZ8148 Lactococcus lactis expression vector, NcoI site
VS-ELV00250-01
NICE® pNZ8150 Lactococcus lactis expression vector, ScaI site
VS-ELV00300-01
NICE® pNZ8149 Lactococcus lactis expression vector, food grade, NcoI site
Shipped at RT, store at 4 °C
VS-ELV00500-01
NICE® pNZ9530 Lactococcus lactis nisRnisK vector, in Stain NZ9000
VS-ELS09000-01
NICE® Lactococcus lactis expression Strain NZ9000
VS-ELS03900-01
NICE® Lactococcus lactis expression Strain NZ3900, food grade
VS-ELS10610-01
NICE® E. coli host Strain MC1061
Shipped on dry ice, store at -80 °C
VS-ELK01000-02
NICE® Nisin kit, 1 g nisin, concentration: 2.5%, (balance sodium chloride
and denatured milk solids), 1 ml 5% acetic acid
Shipped at RT, store at 4 °C
Amount
10 µg
10 µg
10 µg
10 µg
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
1 ml
1 ml
1 ml
1 ml
1 kit
Bacillus megaterium Expression System
Page 3
High Yield T7 RNA Polymerase Gene Expression System for Bacillus megaterium
Features
 Tightly regulated and efficiently inducible xylA
operon/T7 RNA polymerase
 Strong T7 RNAP promoter with unique sequence
 Stable, high yield protein production up to 8-fold
increased in comparison to common xylose inducible expression
 Easy transformation by use of pretransformed
B. megaterium protoplasts
 Control vector with GFP-sequence included in the
kit
Product Description
This system combines the benefits of the tightly regulated
and strong T7 RNA polymerase expression system and
alkaline protease free Bacillus megaterium. Our system is
based on two parallel-replicating plasmids: pT7-RNAP and
pPT7 (Gamer et al. 2009). In addition to the t7 rnap gene
under control of the strong xylA promoter pT7-RNAP contains the genes of ampicillin and chloramphenicol for easy
selection in E. coli (AmpR) and B. megaterium (CmR).
pPT7 is responsible for the T7 RNAP-dependent expression of the target gene. Downstream of the T7 promoter it
comprises a multiple cloning site with ten unique restriction
enzyme cleaving sites. Additionally the plasmid carries two
resistances to ampicillin (for E. coli) and tetracycline (for
B. megaterium).
For your convenience we offer B. megaterium protoplasts
pretransformed with pT7-RNAP in the kit, so that you just
have to insert your gene of interest into pPT7 and transform
the pretransformed protoplasts with this plasmid.
For control purposes the GFP-expressing vector pPT7-GFP
is included in the kit.
Reference
Gamer, M., Fröde, D., Biedendieck, R., Stammen, S., und Jahn,
D. (2009). A T7 RNA polymerase-dependent gene expression
system for Bacillus megaterium. Appl. Microbiol. Biotechnol 82,
1195-1203.
Order Information, Shipping & Storage
Order No.
Description
Amount
BMEGT702 Bacillus megaterium protoplasts, strain MS941, pretransformed with pT7-RNAP
5x500 µl
BMEGT701 Bacillus megaterium high yield T7 gene expression kit, includes pretransformed protoplasts BMEGT702
(5x500µl), pPT7 cloning vector and pPT7-GFP control vector (vectors lyophilized, 10 µg each)
1 Kit
BMEGT710 Bacillus megaterium pPT7 cloning vector, lyophilized
10 µg
BMEG50
Bacillus megaterium protoplasts, strain MS941
5 x 500 µl
Shipped at RT, protoplasts and kit shipped on dry ice.
Store lyophilized vectors at 4 °C, reconstituted vectors at -20 °C, protoplasts at -70 °C. Vectors are E. coli / B. megaterium shuttle vectors.
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Bacillus megaterium Expression System
Page 4
Expression Vectors for B. megaterium
Features
 Stable protein expression, high yield
 Xylose operon: tightly regulated and efficiently in




ducible by xylose (up to 350-fold)
Polylinker downstream of promoter allows versatile cloning
No indication of proteolytic instability even up to
5 hours after induction, since alkaline proteases
(such as e.g. in B. subtilis) are not produced
Endotoxins are not found in the cell wall3
Suited for industrial large scale protein production
Compatible with all B. subtilis vectors
Product Description
Our Bacillus megaterium kit is a new easy-to-handle system for stable protein expression with high yield. It is not
only suited for industrial large scale protein production, but
offers also an interesting alternative to the standard host
E. coli. The kit comes with the E. coli/Bacillus megaterium
shuttle vector pWH1520 and B. megaterium protoplasts
ready for transformation.
B. megaterium has proven to be an excellent host for the
expression of non-homologous DNA. Over other bacilli strains it has the advantage, that none of the alkaline
proteases are present. This fact enables cloning and expression of foreign proteins without degradation. In addition, there are no endotoxins found in the cell wall. Protein
yields are exceptionally good, also if inexpensive substrates are used. Mutarotase (Mro) and glucose dehydrogenase (Gdh) e.g. were accumulated to 20% and 30% of the total soluble protein, respectively. Using the tightly regulated
xylose operon the genes were 130- to 350-fold induced
without proteolysis. The illustration shows the time dependence of the induced protein expression in hours after induction versus enzyme activity. A polylinker downstream
of the promoter allows versatile cloning in pWH1520. All
B. subtilis vectors are compatible with B. megaterium as
well.
The B. megaterium system offers unique possibilities for
the industrial production of proteins and is of great interest
to manufacturers in the biomedical field. In a diagnostic
test for AIDS e.g., the HIV coat protein is commercially
produced by B. megaterium (Ginsburgh et al., 1989).
Our special service for you:
B. megaterium protoplasts
ready for transformation!
Time dependence of induced expression of the enzymes Gdh
(glucose dehydrogenase) and Mro (mutarotase) in B. megaterium. Enzymatic activity given in U/mg protein.
Protein Yield
Protein yields vary depending on the protein expressed.
Rygus and Hillen (1991) have observed, that e.g. Gdh
and Mro accumulated to 20% and 30% of the total soluble
protein, respectively. The time dependence of the induced
expression of these enzymes is shown in the figure above.
Examples
Proteins successfully over-produced with this system are:
• catabolite control protein (ccpA)
• xylose repressor (XylR)
• trehalose repressor (TreR)
• heat shock protein (HPr) from PTS (phosphotransferase
• sugar transport system)
• mutarotase (Mro)
• glucose dehydrogenase (Gdh)
• β-galactosidase
• human single-chain urokinase-like plasminogen activa• tor (rscuPA)
• cellulase
A detailed handbook including all protocols is provided
with the product. It is also available for download.
»One of the most efficient expression systems
described in any organism so far!«
Rygus and Hillen
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Bacillus megaterium Expression System
���I���������I������������I
SpeI
SmaI
BspMI
SphI
BglII
Page 5
References
1. Rygus, T. and Hillen, W., Inducible high-level expression of
heterologous genes in Bacillus megaterium using the regulatory elements of the xylose-utilization operon, Appl. Microbiol.
Biotechnol. (1991), 35: 594-599
2. Hueck, C. P. et al., Cloning, expression and functional analyses of the catabolite control protein ccpA from Bacillus megaterium, Molecular Microbiology (1995), 16(5): 855-864
3. Vary, P., Prime time for Bacillus megaterium, Microbiology
(1994) 140: 1001-1013
Potential industrial & diagnostical applications:
4. Vary, P., Development of genetic engineering in Bacillus megaterium: an example of the versatility and potential of industrially important bacilli, Biology of bacilli: Applications to
Industry, pp. (1992), 251-310. Ed. by Doi and McGloughlin.
Boston: Butterworths-Heinemann
5. Ginsburgh et al., Sporulation promoter spoVG controlled
expression of PP42 gene of HIV-1 in Bacillus megaterium,
Abstr. International Conf. on AIDS, Montreal (1989)
Map of pWH1520. Shuttle vector for E. coli/B. megaterium. TetR
(Bac), tetracycline resistance Bacillus; TetR’,TetR’’, tetracycline
resistance, interrupted; AmpR, ampicillin resistance; xylR, xylose-dependent repressor; xylA’, xylose isomerase, gene incomplete; PA, xylA promoter; MCS, multiple cloning site; ori pBC16,
Bacillus origin of replication; pBR ori, ColE1 origin of replication.
Host Strains
The protoplasts we supply are Bacillus megaterium strains
WH320 and MS941.
The system has been developed by Prof. Dr. W. Hillen and
co-workers at the Institute of Microbiology in Erlangen,
Germany.
Order Information, Shipping & Storage
Order No.
Description
BMEG02
Bacillus megaterium protoplasts ready for transformation (strain WH320)
Material is sufficient for 4 transformations plus control experiment.
BMEG50
Bacillus megaterium protoplasts, strain MS941
Shipped on dry ice; store at -80 °C
BMEG03
BMEG10
BMEG11
BMEG12
BMEG13
BMEG14
BMEG15
pWH1520 shuttle Vector, original; lyophilized DNA
pMM1522 shuttle Vector, improved; lyophilized DNA
pMM1525 shuttle Vector with signal sequence; lyophilized DNA
pHIS1522 shuttle Vector, 6xHis-tagged; lyophilized DNA precursor of BMEG20
pHIS1525 shuttle Vector with signal sequence; 6xHis-tagged; lyophilized DNA
pSTREP1525 shuttle Vector with signal sequence; Strep-tagged; lyophilized DNA
pSTREPHIS1525 shuttle Vector with signal sequence; Strep/6xHis double-tagged;
lyophilized DNA
BMEG20
pC-His1622 shuttle vector, C-term. 6xHis-tag; lyophilized DNA
BMEG21
pC-Strep1622 shuttle vector, C-term. Strep-tag; lyophilized DNA
BMEG22
pN-His-TEV1622 shuttle vector, N-term. His-tag,TEV-site
BMEG23
pN-Strep-TEV1622 shuttle vector, N-term. Strep-tag,TEV-site
BMEG24
pN-StrepXa1622 shuttle vector, N-term. Strep-tag; Xa site; lyophilized DNA
BMEG25
pSTOP1622, shuttle vector, lyophilized DNA
Shipped at RT, protoplasts shipped on dry ice
Store lyophilized vectors at 4 °C, reconstituted vectors at -20 °C, protoplasts at -80 °C
All vectors are E. coli / B. megaterium shuttle vectors
Amount
5 x 500 µl
5 x 500 µl
5 µg
10 µg
10 µg
10 µg
10 µg
10 µg
10 µg
10 µg
10 µg
10 µg
10 µg
10 µg
10 µg
Not available in the US
Not available in the US
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Bacillus subtilis Expression Vectors
Page 6
Expression Vectors for B. subtilis
Product Description:
Gram-positive bacteria are well known for their contributions to agricultural, medical and food biotechnology and
for the production of recombinant proteins.
Among them, Bacillus subtilis has been developed as an
attractive host because of several reasons:
 It is non-pathogenic and is considered as a GRAS
organism (generally regarded as safe)
 It has no significant bias in codon usage
 It is capable of secreting functional extracellular proteins directly into the culture medium (at present, about
60% of the commercially available enzymes are produced by Bacillus species)
 A large body of information concerning transcription,
translation, protein folding and secretion mechanisms,
genetic manipulation and large-scale fermentation has
been acquired
There are two obstacles reducing the use of B. subtilis: (i)
production of a number of extracellular proteases which
recognize and degrade heterologous proteins, and (ii)
stable vector plasmids. The first obstacle has been largely solved by the construction of protease-deficient strains.
And the second has been completely overcome by introducing plasmids using the theta-mode of replication such
as those derived from the natural plasmids pAMβ1 and
pBS72.
Quite recently, the construction and use of four different
expression vectors based on the E. coli - B. subtilis shuttle vector pMTLBS72 exhibiting full structural stability was
published.
The two vectors pHT01 and pHT43 allow high-level expression of recombinant proteins within the cytoplasm, where
pHT43 directs the recombinant proteins into the medium.
Both vectors are based on the strong αA-dependent promoter preceding the groE operon of B. subtilis which has
been converted into an efficiently controllable (IPTG-inducible) promoter by addition of the lac operator.
Derivatives of pHT01 are available either with 8xHis tag
(pHT08), Strep tag (pHT09) or c-Myc tag (pHT10).
Pgrac promoter (consisting of the groE promoter; the lacO
operator and the gsiB SD sequence)
ColE1 ori: ColE1 origin
AmpR : ampicillin resistance
lacl: lacl gene (lac repressor)
CmR: chloramphenicol resistance
SamyQ: amyQ signal sequence
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Bacillus subtilis Expression Vectors
Page 7
The pAL Vector – cold-inducible vector
One further expression vector was constructed containing
the cold-inducible des promoter of Bacillus subtilis. pAL12
is suited for extracellular synthesis of recombinant proteins. When mid-exponential phase bacterial cells are rapidly transferred from 37 °C to 25 °C or even a lower temperature, the synthesis of most cellular proteins greatly
decreases, while that of cold-shock proteins is transiently
upregulated. In Bacillus subtilis, one of these cold-shock
proteins is a membrane-bound desaturase (Δ5-Des) encoded by the des gene. This enzyme catalyzes the introduction of a cis double bond at the Δ5 position of a wide
variety of saturated fatty acids. It has been shown that the
des gene is tightly regulated during cold shock. Production
of recombinant proteins started within the first 30 min after
temperature downshock to 25 °C and continued for about 5 h.
References
1. Anagnostopoulos, C. and Spizizen, J. (1961). Requirements
for transformation in Bacillus subtilis. J. Bacteriol. 81:741-746.
2. Jannière, L., Bruand, C. and Ehrlich, S.D. (1990). Structurally
stable Bacillus subtilis cloning vectors, Gene 87:53-61.
3. Nguyen, D.H., Nguyen, Q.A., Ferreira, R.C., Ferreira, L.C.S.,
Tran, L.T. and Schumann, W. (2005). Construction of plasmidbased expression vectors for Bacillus subtilis. Plasmid;
2005 Nov; 54(3): 241-8. Epub 2005 Jul 11.
4. Phan, T.T.P., Nguyen, H.D. and Schumann, W. (2005). Novel
plasmid-based expression vectors for intra- and extracellular
production of recombinantproteins in Bacillus subtilis. Protein
Expr. Purif.; 2006 Apr; 46(2): 189-95. Epub 2005 Aug 9.
5. Sambrook, J. and Russel, D.W. (2001) Molecular Cloning:
A laboratory manual.
6. Titok, M.A., Chapuis, J., Selezneva, Y.V., Lagodich, A.V., Prokulevich, V.A., Ehrlich, S.D. and Jannière, L. (2003). Bacillus
subtilis soil isolates: plasmid replicon analysis and construction of a new theta-replicating vector, Plasmid 49: 53-62.
Order Information, Shipping & Storage
Order No. Description
Amount
PBS001
pHT01 vector, lyophilized plasmid DNA
10 µg
PBS002
pHT43 vector, lyophilized plasmid DNA
10 µg
PBS003
pHT08 vector, lyophilized plasmid DNA
10 µg
PBS004
pHT09 vector, lyophilized plasmid DNA
10 µg
PBS005
pHT10 vector, lyophilized plasmid DNA
10 µg
PBS007
pAL12, Bacillus subtilis cold-inducible
vector for intracellular expression
10 µg
Shipped at room temperature (RT). Lyophilized plasmid DNA can
be stored at 4 °C. Once the DNA has been dissolved in sterile
water or buffer we recommend storage at -20 °C.
PBS020
PBS021
PBS022
Bacillus subtilis strain 1012wt
Bacillus subtilis strain 168 Marburg
Bacillus subtilis strain WB800N
(for secretion vectors)
Shipped on dry ice; store at -80 °C.
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
1 ml
1 ml
1 ml
pBacTag Tagging Vectors
Page 8
Epitope- and GFP-tagging Integration Vectors for Bacillus subtilis
Features
 Helpful for localizing target proteins within specific cell
compartments
 Easy purification of fusion proteins produced in B. subtilis by metal affinity chromatography
 Allows detection of fusion proteins on immunoblots by
commercially available antibodies
 Tags: FLAG, HA, c-Myc, GFP+, YFP and CFP
Product Description
The six pBacTag vectors are based on the backbone of
pMUTIN2 and allow for translational fusions of two different
types of tagging sequences, epitope and localization tags,
to the 3‘ end of any chromosomal gene of interest within
the B. subtilis chromosome and of any other bacterial species not allowing for replication of pBacTag. Transcriptional
fusion of the tagging sequences is accomplished by PCR
amplification of the 3‘ terminal part of the Gram-positive
gene of interest (about 300 bp), insertion into the tagging
vector’s multiple cloning site in such a way that (1) it is in
frame with the tag sequence to create a fusion protein and
(2) that this tagged fusion protein will be synthesized upon
integration of the whole vector via homologous recombination with the chromosomal gene. The construct is then
introduced back into the Gram-positive organism that was
the source of the gene and the plasmid will integrate into
the chromosome by homology with the cloned gene.
The pBacTag vectors are unable to replicate in B. subtilis independently, however upon insertion of about 300
bp derived from the coding region of the gene to be inactivated by PCR, they can integrate into the respective
genes by homologous recombination. Integration of the
recombinant pBacTag vector into the target gene transcriptionally fuses the different tags to that promoter of the
gene, and downstream genes can be controlled by the isopropyl-β-D-thiogalactopyranoside (IPTG)-inducible Pspac
promoter. Selection for erythromycin resistance allows for
recovery of these integrants. The six vector plasmids were
primarily constructed for use in B. subtilis but can be applied to any bacterial species not allowing replication of
the pBR322-based plasmids. On the other hand, expression of downstream genes depends on synthesis of the Lac
I repressor protein and proper functioning of the Pspac
promoter.
The epitope sequences (FLAG, c-Myc, and HA) allow detection of tagged proteins within the cell using commercially available antibodies. Furthermore, the FLAG and HA
tags can be used to purify the fusion proteins by affinity
chromatography. The Green Fluorescent Protein (GFP)
localization tags GFP+ (which produces enhanced fluorescence), YFP and CFP can be used to localize a protein to
a specific compartment within the cell.
A detailed handbook is provided with the product. It is also
available for download on our website www.mobitec.com
The pBacTag tagging vectors:
Pspac: Pspac promoter
trpAt: TrpA terminator
ColE1 ori: ColE1 origin
Ampr: ampicillin resistance
T1T2T0: Lambda t0 and rrnB t1, t2 terminators
lacI: lacI gene (lac repressor)
Emr: erythromycin resistance
tag: tag sequence
The complete DNA sequences are available on request.
Order Information, Shipping & Storage
Order No. Description
PBT001
pBacTag-FLAG® vector DNA, lyophilized
PBT002
pBacTag-cMyc vector DNA. lyophylized
PBT003
pBacTag-HA vector DNA, lyophilized
PBT004
pBacTag-GFP+ vector DNA, lyophilized
PBT005
pBacTag-CFP vector DNA, lyophilized
PBT006
pBacTag-YFP vector DNA, lyophilized
Shipped at RT; store at 4 °C
FLAG® is a registered trademark of Sigma-Aldrich Co.
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Amount
5 µg
5 µg
5 µg
5 µg
5 µg
5 µg
Yeast Expression Vectors
Page 9
Expression Vectors for Yeast (S. cerevisiae)
p427-TEF
High copy yeast expression vector carrying the aminoglycoside phosphotransferase gene for selection in yeast
using G418. Inserts are expressed from the strong TEF
promoter.
p417-CYC
Low copy yeast expression vector carrying the aminoglycoside phosphotransferase gene for selection in yeast
using G418. Inserts are expressed from the weak CYC1
promoter.
pTEF-MF
Yeast expression vector for secreted proteins. A strong
TEF1 promoter drives constitutive expression of a cDNA
fused to the pre-pro leader sequence of mating factor alpha to ensure secretion of the protein product into the medium.
pGAL-MF
Yeast expression vector for secreted proteins. A regulatable GAL-L promoter drives inducible expression of a cDNA
fused to the pre-pro leader sequence of mating factor alpha to ensure secretion of the protein product into the medium.
Order Information, Shipping & Storage
Order No.
Description
P03301DS
p427-TEF Yeast Expression Vector
P03302DS
p417-CYC Yeast Expression Vector
P03303DS
pTEF-MF Yeast Expression Vector
P03304DS
pGAL-MF Yeast Expression Vector
Shipped at RT; store at -20 °C
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
pORF-CLONE Vector System
Page 10
Improved Cloning of Open Reading Frames for Yeast (S. cerevisiae)
Features
 Efficient, cost-effective selection of cDNA clones containing correct ORFs
 Significantly reduced background of clones containing
cDNA with incorrect reading frames resulting in expression libraries enriched for clones expressing authentic
polypeptides
 S. cerevisiae host system allows expression of soluble,
correctly folded and modified eukaryotic target proteins
in high yields
 Improved selection of larger cDNA inserts in the eukaryotic host system - translation problems and frameshifts can be avoided
 Fast generation of high-quality cDNA libraries by means
of random priming
 Average insert size of cDNA is approximately 1.2 kb
 Easy, fast and reproducible purification of recombinant
proteins via metal chelate affinity chromatography - detection of recombinant proteins by commercially available antibodies
 Ideally suited for high-throughput cloning or the production of cDNA chips
Product Description
The yeast shuttle/expression vector pORF-CLONE has
been specifically developed for an improved and facilitated
selection of cloned cDNA inserts containing open reading
frames (ORFs) thus allowing an enriched growth of clones
expressing authentic polypeptides. This vector system is
particularly useful for the development of a high-throughput technique for the one-step generation of high-quality
cDNA libraries in the yeast Saccharomyces cerevisiae and
a direct, time-saving screening of random-primed cDNA
libraries.
In brief, the selection system is based on the HIS3 marker gene fused to the C-terminus of the cDNA insert.
The cDNAs cloned in-frame result in histidine-prototrophic
yeast cells growing on minimal medium, whereas clones
bearing the vector without insert or out-of-frame inserts
should not grow on this medium.
Previously, E. coli vectors have been constructed on the
basis of the ß-galactosidase coding sequence for the generation of in-frame fusion libraries. However, only DNA
fragments in the range of 100-1000 bp could be enriched
using this system. Moreover, expression of the marker
gene was also observed when the lacZ gene was not in
frame with the cDNA because of the polycistronic mRNA
in prokaryotes and the reinitiation of translation. Other
vectors conferred kanamycin resistance to the host on
translation of an insert in the correct reading frame but the
libraries constructed with them only contained small cDNA
fragments in the range of 100-300 bp which could be enriched to 60% - 80% for ORF clones.
For improving the selection efficiency, especially of larger
inserts, it is quite advantageous to use an eukaryotic host,
which, in contrast to E. coli, has a codon usage homologous to that of mammalian cells, thus avoiding frameshifts
as well as translation and post-translational modification
problems. Therefore, the eukaryotic yeast Saccharomyces cerevisiae, which is able to produce soluble proteins in
large amounts is a suitable host for expressing functional,
correctly modified proteins.
With the pORF-CLONE vector a system has been developed in which a C-terminally fused marker gene is expressed only if the cloned insert carries no internal stop
sequences, which may result from frameshifts or 5‘ and
3‘ untranslated regions. Consequently, the use of random-primed cDNAs is required in this system instead of
oligo(dT)-tailed cDNAs that carry their own C-terminal termination codon.
The pORF-CLONE E. coli/S. cerevisiae shuttle/expression
vector offers an innovative approach for generating cDNA
libraries which are significantly enriched for ORFs and express authentic polypeptides. Using the pORF-CLONE
expression system, time-consuming and costly techniques
for identification of clones expressing protein by using antibody screening on high-density filters and subsequently
rearraying the selected clones in a new “daughter” library
can be avoided. The advantage of this vector is that, in a
one-step screening procedure, it allows the generation of
expression libraries enriched for clones with correct reading frames as sources of recombinant proteins.
Plasmid map of pORF-CLONE.
ColE1 ori: ColE1 origin; AmpR: ampicillin resistance; CUP1:
CUP1 promoter; RGSHis(6): 6xHis-tag; HA: hemagglutinine epitope 6P: PreScission protease recognition sequence.
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
pORF-Clone Vector System
The pORF-CLONE vector includes the Cu2+-inducible CUP1 promoter from the yeast metallothionein gene,
which controls expression of genes inserted in the MCS.
It also carries the HIS3 gene, coding imidazol-glycerolphosphate-dehydrogenase, which enables the selection
of ORFs based on histidine prototrophy. In addition, the
vector contains the E. coli ampicillin resistance (AmpR)
gene for selection in E. coli and the yeast selectable markers URA3 and LEU2d. For the improved expression of
randomly primed cDNAs, a translation initiation sequence
(CAAAATGTCT) that was adapted to S. cerevisiae has
been introduced allowing the translation of cDNAs without
their own start codon. For the detection and purification of
expressed gene products, the plasmid includes a tandem
epitope tag positioned N-terminal to the multiple cloning
site (MCS), consisting of the hemagglutinine epitope (HA)
and the oligo histidine domain (RGS-His6). The modified MCS includes a stop codon in each reading frame
and allows the directional cloning (SalI/NotI) of cDNAs.
For the cleavage of HIS3p from the fusion protein, the
recognition sequence (6P) of the PreScission protease
Page 11
(CTGGAAGTTCTGTTCCAGGGGCCC) has been additionally inserted. The yeast HIS3 gene was introduced
C-terminal to the MCS (Fig.). The translation of the DNA
proceeds from the start codon ATG through the tag sequences into the HIS3 gene. Only if an insert is cloned in
the correct reading frame and if it does not contain any stop
codon, a complete fusion protein will be produced (Fig.). In
this case, expression of the gene product leads to histidine
prototrophy in a his3 S. cerevisiae strain. Clones bearing
the pORF-CLONE plasmid, but without inserts (Fig.), remain auxotrophic, as no HIS3 gene is expressed because
of translation stops in all three reading frames. The yeast
cells are also expected to be auxotrophic if they contain a
cDNA that is inserted in an incorrect reading frame, leading to internal stop codons and resulting in the termination of translation before reaching the HIS3 sequence (Fig.).
In general, mRNA sequences carry many stop codons in
reading frames other than the correct one.
pORF-CLONE can be used for cloning of cDNAs with
SalI/NotI overhangs and for the expression of randomly
primed cDNAs.
BamHI
CACATCAATCATCACATAAAATATTCAGCGAATTGGATCCAAAATGTCTGGCAGATCTCA
HA
PstI
6xHIS
CCCATACGACGTCCCAGACTACGCTCTGCAGAGAGGATCGCATCACCATCACCATCAC
SalI
NotI
PreScission protease recognition sequence (6P)
GGGTCGACTGAGAGCTCATAGCTAAGCGGCCGCCTGGAAGTTCTGTTCCAGGGGCCC
HIS3 
ACAGAGCAGAAAGCCCTAGTAAAGCGTATTACAAATGAAACCAAGATTCAGATTGC
GATCTCTTTAAAGGGTGGTCCCCTAGCGATAGAGCACTCGATCTTCCCAGAAAAAGA
Part of the pORF-CLONE sequence including the cloning sites,
tag and protease sequences as well as the translation initiation
sequence with the ATG start codon:
The DNA sequence of pORF-CLONE is available on
request.
A detailed handbook is provided with the product. It is also
available for download on our website www.mobitec.com
Order Information, Shipping & Storage
Order No. Description
PORF1*
pORF-CLONE vector DNA, lyophilized
Amount
10 µg
*The vectors come with 500 pmol of 5’ and 3’ sequencing primers each.
Shipped at RT; store at 4 °C
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
pPICHOLI Shuttle Vector System
Expression Vectors for Yeast (P. pastoris)
Features
Page 12
AOX or CUP1-Promoter
ColE1 Ori
 Efficient, cost-effective and time-saving protein production in either E. coli or P. pastoris
�
 Problems like protein aggregation, denaturation or
accumulation in inclusion bodies may be avoided by
choosing the P. pastoris expression system
CYC1-Terminator
CYC1-Terminator
 Gene products toxic in E. coli may be easily expressed
in P. pastoris
 Easy cloning and high transformation efficiencies
Zeocin
 Vectors can be used for in vitro transcription/translation
of cloned genes
EM7-Promoter
 Convenient affinity purification and detection of recombinant proteins
�
pPICHOLI
Product Description
The novel pPICHOLI vectors have been designed for heterologous, inducible gene expression in two commonly
used hosts: the yeast P. pastoris and the prokaryote E.
coli. The vectors contain an inducible (yeast) alcohole dehydrogenase (AOX) promoter (pPICHOLI-C: CUP1 promoter) and an E. coli T7 promoter as well as sequences
allowing autonomous replication both in P. pastoris and E.
coli. Small amounts of vector DNA are sufficient to successfully transform P. pastoris. Time-consuming, labor-intensive and costly subcloning into a number of expression
vectors including testing for a successful gene expression is no longer necessary. A multiple cloning site enables
convenient ligation of DNA fragments into the vectors. The
dual expression system offers many advantages: The prokaryotic expression system (E. coli) is simple to handle
and allows a cost-effective and high-level production of
heterologous proteins. The P. pastoris/pPICHOLI system
is a powerful eukaryotic expression system showing rapid growth at high cell densities. When combined with the
strong AOX or CUP1 promoter, respectively, it can yield
up to several grams of the heterologous protein per liter
of culture. Moreover, it is ideally suited for expression of
soluble proteins with post-translational modifications and
those (eukaryotic) proteins causing problems when expressed in E. coli (e.g. proteins toxic to E. coli).
In P. pastoris 100% of the cloned genes could be expressed as soluble proteins whereas in E. coli only 86%
of the cloned genes were successfully expressed (27% of
them as soluble proteins).
The pPICHOLI dual expression vectors combine eukaryotic and prokaryotic promoter elements. Phage T7 promoter, including the ribosomal binding site of the major
capsid protein, promotes the efficient bacterial expression
and is placed downstream from the P. pastoris promoter.
The strong alcohol oxidase promoter (AOX) is tightly regulated, since protein expression is completely repressed
when transformed cells are grown on glucose and maximally induced when grown on methanol.
pPICHOLI-C carries the copper-inducible CUP1 promoter
of Saccharomyces cerevisiae (instead of the AOX promoter) which has been shown to reduce the induction time
greatly.
�
T7-Promoter
AOX-Terminator
EcoR
Eco
RII
RGSHis(6)
RGSHis(6)
BamH
Bam
HII
BS/HAepitope*
epitope*
BS/HA
SalI
Sal
NotI
Not
Stop
Stop
PARS1
TEF1-Promoter
ColE1 ori: ColE1 origin; Zeocin: zeocin resistance; PARS1: P.
pastoris autonomous replicating sequence; RGSHis(6): 6xHistag; BS: biotinylation sequence;
Note: The BamHI site is not unique!
* pPICHOLI-HA has an additional HA epitope tag but lacks the
BS!
pPICHOLI is available with a multiple cloning site (MCS) in
three different reading frames to simplify cloning in frame
with the tags (pPICHOLI-1, pPICHOLI-2, pPICHOLI-3).
pPICHOLI-1 (3579 bp) has two G bases directly upstream
of the Sal I site. pPICHOLI-2 (3578) and pPICHOLI-3
(3577 bp), respectively, are lacking one or both of these
G bases. pPICHOLI-C however is not available with a
MCS in three different reading frames. Due to the use of a
common selection marker (zeocin), the sizes of the shuttle vectors remain small (~3.6 and 3.2 kb, respectively),
hence they remain convenient for handling, cloning and
transformation.
By integration of a Pichia specific autonomous replicating
sequence (PARS1) into the pPICHOLI vectors, linearization is no longer required and the transformation efficiency
is increased up to 105 transformants/µg DNA. Additionally,
plasmids can be easily recovered from P. pastoris. The
pPICHOLI dual expression vectors include a RGS(His)6 tag
for sensitive detection and rapid purification of expressed
proteins and an in vivo biotinylation sequence. Due to the
strong affinity of biotin to avidin, capture and screening
assays are greatly facilitated using these vectors.
pPICHOLI-HA lacks the biotinylation sequence but possesses instead of it an HA (hemagglutinin) epitope.
A detailed handbook is provided with the product. It is also
available for download on our website www.mobitec.com
Order Information, Shipping & Storage
Order No. Description
PPICH1*
pPICHOLI (1-3), pPICHOLI-C and
pPICHOLI-HA vector DNA, lyophilized
Amount
5 x 10 µg
* The vectors come with 500 pmol of 5’ and 3’ sequencing
primers each.
Shipped at RT; store at 4 °C
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Mammalian Expression Vectors
Page 13
Expression Vectors for Mammalian Cells
Mammalian expression vectors for stable or transient expression of cDNAs in mammalian cells:
 Strong CMV promoter for high-level, constitutive expression
 HA epitope tag for convenient detection of expression
products
 SfiI sites for convenient, directional cloning of fulllength cDNAs
SfiI is a rare cutter enzyme which recognizes the sequence
GGCCNNNNNGGCC. The variable core sequence allows
the design of multiple SfiI sites with incompatible overhangs within the same vector.
These vectors feature two SfiI sites with the sequences
GGCCATTACGGCC and GGCCGCCTCGGCC, allowing
directional cloning of cDNAs. SfiI sequences are extremely rare in eukaryotic genomes and therefore, the majority of
eukaryotic cDNAs can be subcloned full-length using SfiI.
pHA-MEX
Mammalian expression vector featuring a strong CMV
promoter, an N-terminal HA epitope tag for detection of
expressed proteins and a NeoR cassette for stable integration of the expression vector into the genome of the host
cell. pHA-MEX is suited for both transient overexpression
and long-term, stable expression.
pMEX-HA
Mammalian expression vector featuring a strong CMV
promoter, a C-terminal HA epitope tag for detection of expressed proteins and a NeoR cassette for stable integration of the expression vector into the genome of the host
cell. pMEX-HA is suited for both transient overexpression
and long-term, stable expression.
Order Information, Shipping & Storage
Order No.
Description
P03401DS
pHA-MEX mammalian expression vector
P03402DS
pMEX-HA mammalian expression vector
Shipped at RT; store at 4 °C
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
CMV Expression Vectors
Page 13a
CMV promoter-based constitutive Expression Vectors phCMV1, phCMV2, phCMV3
Features
 Modified Human cytomegalovirus (CMV) immedi-
ate – early promoter/enhancer/intron for high-level expression in vitro and in vivo
 T7 promoter priming site in phCMV, phCMV3 for
sequencing of the inserted DNA fragment
 SV40 polyadenylation signal for efficient transcrip-
tion termination and polyadenylation of mRNA
 pUC origin for high copy number replication of
vector in E. coli cells
Product description
The phCMV series of vectors are designed to achieve
significantly higher expression levels than traditional human cytomegalovirus (CMV) promoter-based constitutive
expression vectors. This makes the phCMV vectors ideal tools for routine protein expression studies as well as
animal injection experiments. The phCMV vectors consistently deliver superior expression levels when compared
with other commercially available CMV promoter-based
expression vectors. It is not unusual to obtain protein expression levels from phCMV that are severalfold higher
than those obtained from other popularly used vectors. In
addition, because phCMV vectors use the Kan/Neo gene
for selection in both bacteria and cultured cell lines, they
offer smaller vector sizes and improved transfection efficiency.
Benefits
 Maximized high-level expression with optimized CMV
promoter
 G418 resistance gene for the selection of stable cell
lines
 Optional N- or C-terminal HA fusion tags for simplified
protein detection and purification with anti-HA antibodies and affinity resins
 Extensive multiple cloning region for convenient and
easy cloning
 Small vector sizes for efficient transfection
References
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1994). Current Protocols
in Molecular Biology (New York: Greene Publishing Associates
and Wiley-Interscience).
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular
Cloning: A Laboratory Manual, Second Edition (Plainview, New
York: Cold Spring Harbor Laboratory Press).
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
CMV Expression Vectors
Page 13b
Order Information, Shipping & Storage
Order No.
Description
VS-EXC00100-01
phCMV1 CMV-based constitutive Expression Vector
for encoding recombinant proteins in their native form, without any tags
Kit contents
• 25 µg supercoiled phCMV1 vector, 1 µg/µl solution.
• 10 µg phCMV1/CAT positive control vector, 1 µg/µl solution
VS-EXC00200-01
phCMV2 CMV-based constitutive Expression Vector
for encoding recombinant proteins with an N-terminal HA fusion tag
Kit contents
• 25 µg supercoiled phCMV2 vector, 1 µg/µl solution.
• 10 µg phCMV2/CAT positive control vector, 1 µg/µl solution
VS-EXC00300-01
phCMV3 CMV-based constitutive Expression Vector
for encoding recombinant proteins with an C-terminal HA fusion tag
Kit contents
• 25 µg supercoiled phCMV3 vector, 1 µg/µl solution.
• 10 µg phCMV3/CAT positive control vector, 1 µg/µl solution
Amount
1 kit
1 kit
1 kit
Shipped at -20 °C. Stable for at least 6 months when stored properly.
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Fusion Protein Cloning System PheBo
Page 14
E. Coli Expression Vectors with PheBo Purification System
Features
 Protein purification from the cytoplasm (pHKcyto)
 Preparative protein accumulation in the periplasm
(pHKperi)
 Protein export into the periplasm for correct protein
folding
 Endoproteinase Pro-Pro-Y-Pro cleaves also inclusion
bodies!
 Contamination with the endoproteinase Pro-Pro-Y-Pro
avoided
 IPTG inducible
 Convenient protein purification via pre-packed affinity
columns
Product Description
In the PheBo-System for fusion protein cloning and purification, the protein of interest is cloned next to the leader
protein ß-lactamase. The expressed fusion protein remains in the cytoplasm (vectors pHKcyto1 and pHKcyto2)
or is released into the periplasm with the help of a signal
sequence (vectors pHKperi1 and pHKperi2).
ß-lactamase allows efficient protein purification under mild
conditions on pre-packed re-usable phenylboronate- (PheBo) affinity columns. The leader protein is removed by the
site-specific endoproteinase Pro-Pro-Y-Pro (Igase), which
also cleaves inclusion bodies. After a second passage
through the same affinity column, the protein of interest
can be obtained in pure form from the column flowthrough, whereas ß-lactamase and the endoproteinase
remain on the column.
Affinity purification with easy-tohandle, pre-packed and equilibrated
phenylboronate (PheBo) columns
(2.5 ml version on this photo, connected tightly to a syringe via Luerlock connection).
A detailed handbook including
all protocols is provided with
the product. It is also available for download.
Fusion Protein Expression and Purification
Example
M
1
2
3
4
M
-97 kDa
-66 kDa
-45 kDa
-31 kDa
-21 kDa
-14 kDa
Endoproteinase Pro-Pro-Y-Pro (Igase) cleavage of a REIV (an
immunoglobulin) fusion protein produced with the PheBo system. Lane 1, ß-lactamase-REIV fusion protein after PheBo affinity column; lane 2, after endoproteinase Pro-Pro-Y-Pro cleavage; lane 3, REIV in the PheBo column eluate; lane 4, after
washing the PheBo column with buffer; M, protein marker (kDa,
kiloDalton, indicated on the right). Size ß-lactamase about: 31
kDa. See Ref.1, on the following page.
Schematic overview of IPTG induced fusion protein expression,
purification via PheBo column, endoproteinase cleavage of fusion protein and final purification of the protein of interest with
a second application of the same PheBo column; note, that the
endoproteinase Pro-Pro-Y-Pro (Igase) remains on the column as
well.
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Fusion Protein Cloning System PheBo
Page 15
pHKcyto1 and pHKperi1:
pHKcyto2 and pHKperi2:
Multiple cloning sites of pHK vectors. The endoproteinase Pro-Pro-Y-Pro (Igase) sites for fusion protein cleavage are indicated.
Periplasmic protein production with signal sequence:
Cytoplasmic protein production:
ori
Map of pHKperi1. bla: ß-lactamase; S: signal sequence; Plac: lac
promoter; catR: chloramphenicol acetyl transferase; ColE1 ori:
pBR322-derived origin of replication; f1: origin of replication of
filamentous phage f1; fdT: transcription terminator from bacteriophage fd, tandemly repeated; MCS: multiple cloning site. Original vector names: pHKperi1 = pHK5-11; size: 4188 bp; pHKperi2
= pHK5-21; size: 4175 bp. pHKperi2 differs from pHKperi1 in the
mutiple cloning site as described above on this page.
Host Strains
Since no lacI gene encoding the lac repressor is located
on the pHK vectors, it is advisable to use an E. coli strain
that contains a lacIq gene located on the F’ episome (e.g.
BMH71-18, JM101, JM103, JM105) as expression host. A
frequently used host strain is BMH71-18.
References
1. Kolmar, K. et al., J. Mol. Biol. 228 (1992) 359-365
2. Frisch, C. et al., Biol. Chem. Hoppe-Seyler 375 (1994) 353-356
3. Kolmar, K. et al., J. Mol. Biol. 251 (1995) 471-476
4. Frisch, C. et al., Fold Des 1 (1996) 431-440
5. Uson, I. et al., Fold Des 2 (1997) 357-361
The PheBo system has been developed by Prof. Dr. H.-J. Fritz
and Dr. H. Kolmar, Institute of Molecular Genetics, University of
Göttingen, Germany.
Map of pHKcyto1. bla: ß-lactamase; Plac: lac promoter; catR:
chloramphenicol acetyl transferase; ColE1 ori: pBR322-derived
origin of replication; f1 ori: origin of replication of filamentous
phage f1; fdT: transcription terminator from bacteriophage fd,
tandemly repeated; MCS: multiple cloning site. Original vector
names: pHKcyto1 = pHK5-10; size: 4140 bp; pHKcyto2 = pHK520; size: 4120 bp. pHKcyto2 differs from pHKcyto1 in the mutiple
cloning site as described above on this page.
Order Information, Shipping & Storage
Order No.
Description
PHKP01
pHKperi1 vector DNA, lyophilized
PHKP02
pHKperi2 vector DNA, lyophilized
PHKC01
cyto1 vector DNA, lyophilized
PHKC02
pHKcyto2 vector DNA, lyophilized
PHKP12
Kperi1 and pHKperi2
PHKC12
pHKcyto1 and pHKcyto2
PB0702
Phenylboronate column
PB0705
Phenylboronate column
Shipped at RT; store at 4 °C
EP0205 Endoproteinase
Pro-Pro-Y-Pro (Igase)
Shipped on dry ice; store at -20 °C
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Amount
5 µg
5 µg
5 µg
5 µg
5 µg each
5 µg each
2 ml
5 ml
50 µg
Fusion Protein Cloning System pAX
Page 16
E. coli Vector System for Cloning of N-terminal Authentic Proteins






Features
Expression of N-terminal authentic proteins without additional amino acids (pAX5)
Cloning in three different reading frames (pAX4a, b, c)
Production of both single DNA strands for sequencing
the gene (f1 origin in + and - orientation)
Purification of fusion proteins via APTG affinity cromatography
Cleavage of fusion protein with endoproteinase Ile-GluGly-Arg (Xa) or collagenase
Mutagenesis
Product Description
The pAX vector system combines the advantages of optimal gene expression with those of simple protein purification via APTG affinity chromatography. The fusion protein
contains a rigid collagen structure between the leader protein ß-galactosidase and the foreign protein of interest, allowing both proteins to fold into their active forms independently. The protein hinge region also provides free access
to the cleavage site of the endonuclease Ile-Glu-Gly-Arg
(Factor Xa). After expression, the fusion protein is separated from the cell lysate via APTG affinity chromatography.
Proteolytic cleavage of the eluted fusion protein is performed either by endoproteinase Ile-Glu-Gly-Arg or collagenase. The former results in the release of a 5´ authentic
foreign protein, if the gene is cloned into the Nru I site
of pAX5. A second application of the same APTG column
separates the leader sequence (consisting of ß-galactosidase and collagen) from the cloned protein. The purified
protein of interest is collected in the flow-through.
The pAX system can be used to clone, sequence, mutagenize and express foreign genes in E. coli and purify
the gene product. Eight cloning vectors, which differ in the
multiple cloning site, the reading frame and the orientation
of the f1 origin, are available from MoBiTec, as well as
sequencing primers and endoproteinase Ile-Glu-Gly-Arg
(factor Xa).
Host Strains
E. coli lacIq strains like JM109 are recommended, or
strains which do not express ß-galactosidase. We suggest
the helper phage M13K07.
Schematic overview of fusion protein expression, purification via
APTG column, endoproteinase Ile-Glu-Gly-Arg cleavage of fusion protein and final purification of the protein of interest with a
second application of the same APTG column.
Example
SDS gel of β-gal fusion protein
1
2
3
4
5
6
7
200
116 -βGal
97,4
66,2
HisRS
42,7
SDS gel of different steps involved in the purification of E. coli
histidyl-tRNA-synthetase (HisRS) expressed as a b-Gal fusion
protein. Lane 1, E. coli crude extract after lysis; lane 2, eluate
from DE52 column; lane 3, sodium borate elution from APTG
column; lane 4, endoproteinase Ile-Glu-Gly-Arg treated fusion
protein; lane 5, purified HisRS released from the fusion protein
(the b-Gal/hinge region was eliminated by a second APTG affinity chromatography); lane 6, purified native HisRS; lane 7, protein
molecular size marker. Lane 4 shows the b-galactosidase (116
kDa; upper strong band) and the synthetase (lower band). The
endoproteinase is present in such a small amount (< 1% of the
fusion protein) that it is not detected.
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Fusion Protein Cloning System pAX
Page 17
Multiple cloning sites of the pAX DNA vectors. Please note that the XbaI site is methylated. If the XbaI site is to be used, the vector should be grown
in a dam-strain. The amino acid sequence is listed below the DNA sequence. For pAX4a+/- the restriction enzyme recognition sites are indicated.
pAX Sequencing Primers
Sequencing counter-clockwise in all pAX vectors:
AXPRI1: 5´-CCTGGTCTTGCTGGCCAACAT-3´
Reference
Markmeyer, P. et al., Gene 93 (1990) 129-134
Sequencing counter-clockwise in all pAX vectors:
AXPRI2: 3´-TCTTGCGAGCCAACGGCGGCCC-5´
With pAX5 it is possible to express N-terminal authentic proteins without additional amino acids!
A detailed handbook including all protocols is provided with the product. It is also available for download.
Order Information, Shipping & Storage
Order No. Description
pAX5+ vector map.
Plac: lac promoter; t0: l terminator t0; CS: collagen linker; Xa: recognition sequence for factor Xa protease; f1 ori: origin of bacteriophage f1; AmpR: ampicillin resistance; lacZ: ß-galactosidase;
MCS: multiple cloning site.
Amount
PAX4AP pAX4a+ vector DNA, lyophilized
10 µg
PAX4AM pAX4a- vector DNA, lyophilized
10 µg
PAX4BP pAX4b+ vector DNA, lyophilized
10 µg
PAX4BM pAX4b- vector DNA, lyophilized
10 µg
PAX4CP pAX4c+ vector DNA, lyophilized
10 µg
PAX4CM pAX4c- vector DNA, lyophilized
10 µg
PAX5P
pAX5+ vector DNA, lyophilized
10 µg
PAX5M
pAX5- vector DNA, lyophilized
10 µg
AXPRI1
pAX 5´ sequencing primer, lyophilized
0.05 A260
AXPRI2
pAX 3´ sequencing primer, lyophilized
0.05 A260
EP0504* Endoproteinase IIe-Glu-Gly-Arg (Xa) 250 µg
Shipped at RT; store at 4 °C
* not available in the US
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
BRP Plasmids and Competent BRP Cells
Page 18
E. coli Supplementary Vector for Protein Secretion









Features
Protein excretion into E. coli culture medium without
the need of a signal sequence
Release of lethal proteins
Preventing protein degradation by cytoplasmic proteinases
Avoiding inclusion bodies
Release of periplasmic proteins
Large-scale biotechnological production of proteins in
a continuous culture
Simplified protein purification from culture medium
Vectors can be co-transformed with ColE1 vectors,
alternatively we offer competent BRP-transformed cells
Vectors expressing the Bacteriocin Release Protein
(BRP)
Product Description
The plasmids pJL3 and pSW1 express the Bacteriocin Release Protein (BRP), which initiates release of periplasmic
and cytoplasmic E. coli proteins into the culture medium.
Being compatible with most of the commonly used expression vector systems (e.g. ColE1 vectors like pAX, PheBo,
pBR322 derivatives), BRP vectors can be co-transformed
with the vector producing the recombinant protein of interest. Induction of the BR-Protein with IPTG (pJL3) or mitomycin C (pSW1) will cause an activation of phospholipase
A in the outer E. coli membrane. This results in the formation of permeable zones in the cell membranes, through
which proteins are released into the medium. A moderate induction prevents lysis of producer cells, also making
the system suitable for large-scale protein production in
a continuous culture. Since cloned proteins are no longer
accumulated in the cytoplasm, problems associated with
lethality of recombinant proteins, their preferential degradation or inclusion body formation are avoided.
For your convenience, we also provide competent cells
already transformed with one of the vectors.
Example: α-Amylase Release
Examples
Proteins, which have already been successfully released
by activity of BRP from the E. coli periplasm are: (see review article in Ref. 4)
protein size in kDa
• Bacillus penicillinase
• Aeromonas xylanase L
• Human IgG Fc region
• Human chimeric IgE/IgG Fc
• Human calcitonin
• Guar α-galactosidase
• Bacillus α-amylase
• Bacillus cellulase (N-4 and 1139)
• Human growth hormone
• Human tumor necrosis factor-α
• β-lactamase
• FaeE
25
135
29
37
27
40
55
58/92
21
17
29
25
Protein release with the BRP vector system
1.
Co-transformation
of recombinant
plasmid and BRP
Vector in one or two
steps)
2.
Induction of BRP,
which then activates
Phospholipase A
3.
Excretion of cytosolic
and periplasmic proteins
into the cell culture
medium
Effect of Mitomycin C concentration on the release of α-amylase
from E. coli RR1. Extracellular α-amylase activity determined according to Ref. 6. Medium: YT with 100 µg/ml Amp (selection of
pBR322-Amy) and 12.5 µg/ml tetracycline (selection of pSW1).
Co-transformation in two steps using standard protocols. See
Ref. 1 on the following page.
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
BRP Plasmids and Competent BRP Cells
Page 19
IPTG inducible:
Host Strains
Generally, any E. coli host which is not phopholipase A
deficient, can be used. The host we use for preparing
_ our
_
pre-made
competent
cells
is
E.
coli
K12
N3406
(thr
leu
_
thi lacY tonA supE).
pSW1: The E. coli host strain has to be recA+, since the induction with mitomycin C is based on the recA-dependent
cellular SOS-response (e.g. JM101, RR1, JM83).
pJL3; p15A1 ori, origin of replication; CmR, chloramphenicol resistance; lppp, E. coli lipoprotein promoter, lacpo, lac promoter
operator system; lac I, lac repressor.
Mitomycin C
incucible:
pJL3: It is advisable to choose a recA deficient E. coli host
strain to avoid unintended recombination (e.g. JM109,
DH5a, XL1-Blue).
To increase protein yield, a protease-deficient strain might
be helpful.
Induction
Same inducer for recombinant protein and BRP: inducer
concentration has to be selected which is appropriate for
both vectors.
Different inducers: time shifted induction is possible.
Note: Toxic or inclusion body forming proteins should be
excreted immediately; i.e. time-shifted induction is not advisable.
pSW1; p15A1 ori, origin of replication; TetR, tetracycline resistance; (CmR), part of chloramphenicol resistance gene, not functional; pClo, pCloDF13 promoter. BRP, Bacteriocin Release Protein.
Compatibility
BRP vectors are compatible with all vectors, which contain
an origin of replication other than p15A1. Therefore, BRP
vectors can be combined with all commonly used systems
derived from pBR322 (i.e. with ColE1 origins), such as
pUC, pAX, PheBo etc. Two different selection markers are
advisable for the selection of double transformants.
Quasi-Lysis Test
References
1. Yu, P. et al., Biotechnol. Prog. 8 (1992) 25-29
2. van der Wal, F. J. et al., Biotech. Letters 17, 8 (1995)
815-820
3. van der Wal, F. J. et al., Appl. Microbiol. Biotechn. 44
(1995) 459-465
4. van der Wal, F. J. et al., FEMS Micobiol. Reviews 17
(1995) 381-399
5. Luirink, J. et al., Mol. Gen. Genet. 206 (1987) 126-132
6. Fuwa, J. Biochem. Tokyo (1954) 41, 583-603
Effect of induction with IPTG on the growth of E. coli harboring a
BRP vector. IPTG was added at zero time. The various concentrations of IPTG used (0-40 µM) are indicated in the figure. See
Ref. 5. The optical density at 660 nm is a measure of the number
of cells. At concentrations above 20 µM IPTG, the cells cease to
grow 2 hours after induction.
Order Information, Shipping & Storage
Order No. Description
BRPJL3
pJL3 vector DNA, lyophilized
BRPSW1
pSW1 vector DNA, lyophilized
Shipped at RT; store at 4 °C
Amount
5 µg
5 µg
COMJL3
Competent cells transformed with pJL3 5 x 200 µl
COMSW1
Competent cells transformed with pSW 15 x 200 µl
Shipped on dry ice; store at -80 °C
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
PCR Cloning Vector p3T
Page 20
E. coli Cloning Vector for PCR* Fragments
Features
 Cloning PCR products via multiple dA extensions
 Results in higher efficiencies than with single dA/dT
overhangs
Product Description
The p3T vector provides a flexible system for the direct
cloning of PCR products. It allows cloning of PCR products
via multiple dT overhangs.
Utilizing the restriction site PflMI, three dT overhangs are
produced. After polyadenylating the PCR fragment with
Terminal Deoxynucleotidyl Transferase, the PCR fragment
can be cloned with high efficiency via a multiple dA extension.
Using p3T, less amplified DNA is required. A SmaI site is
present to reduce vector background; MscI sites flank the
insert for optimal excision. Blue/white selection by α-complementation is possible.
Vector map of p3T; AmpR, ampicillin resistance; M13 ori, origin of
phage M13; lac Z, lac I, from lactose operon; ori, ColE1 origin;
MCS, multiple cloning site.
Restriction Enzyme
Triple T / Triple A-Cloning
∆
PflMI
PflMI
5´ CCANNNNNTGG 3´
3´ GGTNNNNNACC 5´
∆
PflMI
The restriction enzyme PflMI produces three dT overhangs at
both sides of the cloning site of p3T, enabling „TripleT/TripleA“cloning of the PCR-fragment.
The recognition sites of the restriction enzyme PflMI (available at New
England Biolabs), which produces
three dT overhangs in the cloning
site of p3T.
The DNA sequence is available for download on our
web site (address see below) and on the EMBL data
base at accession number Z46733 (attention: vector is
called p123T).
Multiple Cloning Site of p3T
Host Strains
E. coli standard host, such as XL1-Blue (Stratagene).
A detailed handbook including all protocols is provided
with the product. It is also available for download
References
1. Mitchell, D. B. PCR Meth. App. 2 (1992) 81-82. The vector
called p123T in this publication is the same as p3T.
* PCR is a process covered by patents owned by Hoffmann-La Roche. Use of this process requires a licence.
Order Information, Shipping & Storage
Order No.
Description
P123T
p3T vector DNA, lyophilized
Shipped at RT; store at 4 °C
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Amount
5 µg
Poly(His)-tag Cloning Vector pEG-His 1
Page 21
E. coli Expression Vector with His-tag for Easy Purification
Features
 Inserts can be expressed as C-terminal tagged 6xHis
fusion proteins for efficient and easy one-step purification of full length proteins by metal-chelate affinity
chromatography
 An RGS motive and the proximate His-tag allow detection and/or immunoprecipitation of the expressed protein with commercial anti-RGS and anti-His antibodies
 Optimized promoter guarantees excellent expression
levels
 Very tight expression control due to overexpression of
the LacI repressor
 A convenient MCS allows flexible and easy cloning of
the insert
 Start codon is provided by an NdeI site
Product Description
The pEG-His1 vector harbors a promoter control which
even allows the expression of toxic gene products in E.
coli. To obtain its exceptional tightness prior induction with
IPTG, the LacI repressor gene has been included in the
vector and is overexpressed in plasmid bearing cells.
Recombinant fusion proteins with a 6xHis tag can be easily and selectively purified using metal chelate affinity
chromatography. For example, immobilized nickel affinity
matrix shows an optimal binding capacity and a minimized
non-specific binding resulting in highly purified and reproducible 6xHis-tagged protein preparations.
Plasmid map of vector pEG-His1.
Western blot of whole cell lysates from five E. coli clones expressing the toxic protein EBNA2. ni, not induced; i, induced.
Cloning map of pEG-His1 (4339 bp).
The DNA sequence of pEG-His 1 is available for download.
A detailed handbook is provided with the product. It is also
available for download on our website www.mobitec.com
Order Information, Shipping & Storage
Order No.
Description
PEG01
pEG-His1 vector DNA, lyophilized
Amount
5 µg
Shipped at RT; store at 4 °C.
The vector comes with 500 pmol of 5’ and 3’ sequencing primers each.
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Exontrap Cloning Vector
Page 22
E. coli Vector for Cloning of Exons






Features
Search for new eukaryotic genes
Identification of genes which are not transcribed into
RNA during certain life cycle stages
Intron/exon mapping2
Exon libraries for screening the genome
with labeled cDNA
Removing introns before sequencing
Expression of eukaryotic genes
Product Description
The Exontrap vector has an intrinsic splicing function,
allowing selective cloning of exon sequences from large
genomic eukaryotic DNA fragments. This new route for
the identification of eukaryotic genes does not involve an
initial isolation of cellular mRNA. Thus, genes, which are
not transcribed during certain life cycle stages, can also be
identified. Exon/intron mapping is greatly facilitated, since
for the determination of exon boundaries only the trapped
exons have to be sequenced and compared to the known
gene. Also, an exon library can be derived and screened
for cell type specific genes with labeled cDNA from a panel
of differentiated cells.
The Exontrap function is based on a shuttle vector containing prokaryotic and eukaryotic genetic elements for
replication in both, bacteria and cell cultures. The vector
contains a 5´ and 3´ exon separated by a 600 bp intron
sequence, which contains a polylinker for cloning. The recombinant vector is transfected into eukaryotic cells (e.g.
COS cells) and transcribed. Whether the insert contains
an exon in the correct orientation is determined by restriction or sequence analysis. The mRNA is processed, i.e.
the intron sequences originating from the vector, as well as
those being introduced, are removed. After total RNA isolation, the mature mRNA is reverse transcribed into cDNA
using a specific primer complementary to a sequence of
the bordering exon. The cDNA is amplified by PCR* using
specific primers, which create restriction sites for further
subcloning.
Schematic overview: Eukaryotic DNA is cloned into Exontrap,
propagated in E. coli. The RNA is then spliced in vivo in eukaryotic cells leaving only exon sequences. The mature mRNA is
then reverse transcribed into cDNA and amplified by PCR.
Multiple Cloning Site
Host Strains
 E. coli K12 derivatives
 COS cells (SV40 transformed African Green Monkey
Kidney, ATCC CRL 1651)
References
1. Auch, D. and Reth, M., Nucl. Acids Res. 18 (1990) 6743-6744
2. Kwok, J. B., Oncogene, 8 (9) (1993) 2575-82
* PCR is a process covered by patents owned by HoffmannLa Roche. Use of this process requires a licence.
Map of Exontrap vector: RS virus LTR: Rous sarcoma virus long
terminal repeat promoter; SV 40 ori, ColE1 ori: origins of replication; poly A: 3’ poly A addition site; AmpR: ampicillin resistance.
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Exontrap Cloning Vector
Page 23
Selective Exon Cloning
The Exontrap system has been developed by Prof. Dr. Reth at
the Max-Planck-Institute for Immunology in Freiburg, Germany.
A detailed handbook including all protocols is provided
with the product. It is also available for download on our
website www.mobitec.com
Primer
Application
cDNA primer 1
PCR primer 2
(5´, containing a BamHI site)
PCR primer 3
(3´, containing a SmaI site)
5´ sequencing primer 4
3´ sequencing primer 5
PCR 5‘ primer 6
containing a BamHI site
cDNA synthesis
primer for in vitro
amplification
primer for in vitro
amplification
primer for sequencing
primer for sequencing
primer for exon amplification
without additional 5´ and 3´
sequences
primer for exon amplification
without additional 5´ and 3´
sequences
PCR 3‘ primer 7
containing a BamHI site
The DNA sequence is available for download on our
web site (address see below). Please note, that 440 bp
are unknown.
Order Information, Shipping & Storage
Order No. Description
K2010
Exontrap Kit:
pET01 vector DNA, lyophilized
cDNA primer 1, lyophilized
5´ PCR primer 2, lyophilized
3´ PCR primer 3, lyophilized
PET01
pET01 vector DNA, lyophilized
ETPR04
5´ sequencing primer 4, lyophilized
ETPR05
3´ sequencing primer 5, lyophilized
ETPR06
5´ PCR primer 6, lyophilized
ETPR07
3´ PCR primer 7, lyophilized
Shipped at RT; store at 4 °C
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Amount
5 µg
0.05 A260
0.05 A260
0.05 A260
5 µg
0.05 A260
0.05 A260
0.05 A260
0.05 A260
ssDNA-Production and Expression in pMEX
Page 24
E. coli Vector System for Easy Sequencing, Mutagenesis and Expression




Features
Cloning
Strong gene expression
Sequencing
Unidirectional deletion
Product Description
The pMEX DNA cloning vectors combine the cloning and
expression advantages of DNA plasmid (or cosmid) systems with the sequencing and mutagenesis advantages of
single-strand phage systems. The pMEX vectors contain
the ColE1 origin of replication and the phage f1 intergenic
region. Thus, genes and gene banks can be cloned, sequenced, mutagenized, and expressed in the same vector
system. To optimize gene expression, the distance between the promoter and the ribosomal binding site (ShineDalgarno sequence) can be easily shortened to the optimal length of 5 to 20 base pairs using the easy access to
site directed mutagenesis. With the strong promoter, this
results in strong expression of the cloned gene product.
The MCS is constructed such that the cloned gene can
be sequenced easily by nested deletions from both sides
(5´ and 3´) whilst the framing genetic elements (operator,
promoter, start and stop codons, terminators) and both
sequencing primer sequences remain unchanged. This
also enables protein engineering by truncation from both
sides with stable gene expression. The pMEX DNA vector system is easy to handle. E. coli lacIq strains can be
used, which have advantages for the expression of toxic
proteins. The strong promoter does not require heat shock
activation; thus, no SOS response will interfere with the
protein expression.
�
pMEX8 map. AmpR: ampicillin resistance; Ptac: tac promoter;
MCS: multiple cloning site; t1, t2: terminators of the rrnB operon;
f1 IG: intergenic region of the phage f1; ColE1: origin of replication.
1 2 3 4 5 6
kDa
Example
200
The gene of the Valyl-tRNA-synthetase was cloned into the vector
pMEX6 yielding the vector pVB38.
The protein synthesis of this vector pVB38 in E. coli after induction
with 1 mM IPTG was analyzed on
7.5% SDS-PAGE. Lane 1 and 6:
molecular weight marker; lane 2:
crude extract of E. coli TG1 transformed with pMEX6, induced; lane
3: valyl-tRNA-synthetase from
yeast; lane 4: crude extract from E.
coli TG1 transformed with pVB38,
not induced; lane 5: crude extract
from E. coli TG1 transformed with
pVB38, induced. See ref. 1.
116
97
66
Multiple Cloning Sites of pMEX5 and pMEX6:
Multiple Cloning Sites of pMEX7 and pMEX8:
Multiple cloning sites of the pMEX vectors. Please note, that the
BamH I site in pMEX5 and pMEX6 is not unique.
pMEX Sequencing Primers
pMEX 5´ Primer: 5´-CGGCTCGTATAATGTGTGG-3´
(for pMEX5 and pMEX7)
pMEX 3´ Primer: 3´-CCGCCTACTCTCTTCT-5´
(for pMEX6 and pMEX8)
A detailed handbook including all protocols is provided
with the product. It is also available for download.
Order Information, Shipping & Storage
Order No. Description
PMEX5
pMEX5 vector (f1 ori in - orientation)
PMEX6
pMEX6 vector (f1 ori in + orientation)
PMEX7
pMEX7 vector (f1 ori in - orientation)
PMEX8
pMEX8 vector (f1 ori in + orientation)
MEXPR5 PMEX 5´ sequencing primer, lyophilized
MEXPR6 PMEX 3´ sequencing primer, lyophilized
Shipped at RT; store at 4 °C
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Amount
10 µg
10 µg
10 µg
10 µg
0.05 A260
0.05 A260
pBBR RESO
Page 25
Broad-Host-Range Vectors for Promotor Identification in Gram-negative Bacteria
Features
 Identification of the promoter sequence of a cloned
gene or operon
 Identification of promoter sequences in random tnpRgene fusion libraries
 Identification of genes induced under harsh environmental conditions, such as various stresses, under
which other reporter genes and selection systems (cat,
bla) cannot be used
Product Description
The plasmid pBBR RESO is a broad-host-range promoter
cloning vector. In contrast to other known broad-host-range vectors, it is maintained at a medium copy number and
has a reasonable size of about 6.8 kb. It stably replicates
in any Gram-negative bacterium studied, and is therefore
particularly interesting for the isolation and genetic analysis of DNA sequences with promoter activity in the homologous organism. The reporter system used employs
the resolvase-mediated excision of a kanamycin (Kan) resistance gene flanked by two res sequences. Cloning an
active promoter results in Kan-sensitive clones.
pBBR RESO was derived from pBBR1MCS3, which itself is
a modification of the broad-host-range plasmid pBBR1CM1.
It contains a chloramphenicol resistance gene (CmR) and
a unique BglII cloning site immediately upstream the
promoterless reporter gene tnpR, encoding the resolvase from transposon Tn34. Two directly repeated res sequences flanking the Kan gene are located downstream
of tnpR2. A transcriptional fusion between a DNA fragment
cloned into BglII and tnpR results in expression of the
latter, and resolvase-mediated strand exchange occurs
between the res sites. This leads to the irreversible shift
from a Kan-resistant to a Kan-sensitive phenotype of the
host bacterium. Clones should be plated on Cm-containing agar and assayed for kanamycin resistance/sensitivity. The only requirement for the use of this system is a
resolvase-free background, i.e. the Gram-negative strains
should not contain any transposon potentially coding for
resolvase. Besides BglII the DNA of interest can also be
digested with Sau3A or BamHI, since the overhangs are
compatible.
The DNA sequence of pBBR RESO is available for
download.
A detailed handbook is also available for download on our
website www.mobitec.com
Order Information, Shipping & Storage
Order No.
Description
RESO01
pBBR RESO vector DNA, lyophilized
Shipped at RT; store at 4 °C
Amount
5 µg
BglII
Promoter cloning vector pBBR RESO. Cloning a promoter sequence into the BglII site causes resolvase mediated kanamycin
(KanR) excision (pBBR RESO*) and, thus, irreversible Kan sensitivity. Mob is involved in mobilization, Rep in replication. tnpR:
resolvase. CmR: chloramphenicol resistance.
Advantages
Not only constitutively but also transiently induced promoters can be detected. Further, the screening for promotercontaining clones does not necessitate a selection pressure onto the reporter gene product.
Host strains
 Plasmid propagation: transposase-free E. coli strains, 
such as DH5 or JM109
 Expression: a transposase-free Gram-negative host
(see pBBR122 on the following page for strains tried so
far with pBBR derivatives)
References
1. Antoine, R. and C. Locht, Mol. Microbiol. 6 (1992)
1785-1799
2. Blake, D. G. et al., Current Biology 5 (1995) 1036-1046
3. Kovach, M. E. et al., BioTechniques 16 (1994) 800-802
4. Stark, W. M. et al., Cell 58 (1989) 779-790
The vector pBBR RESO has been developed by S. Köhler, J.
Teyssier, and J. P. Liautard at the INSERM laboratory U-431,
Montpellier, France (unpublished).
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Broad-Host-Range Vectors pBBR122 and pBHR1
Page 26
Broad-Host-Range Vectors for Gram-negative Bacteria
Features
 Change of bacterial host, expression in bacteria
other than E. coli (mainly Gram-negative)
 Studies of broad-host-range replicons
 Studies of Gram-negative bacteria
Product Description
pBBR122 is a cloning vector with very broad host-range
maintenance. As opposed to other known broad-host-range vectors, it replicates at medium copy numbers and has
a small size (5304 bp). This greatly facilitates genetic studies of a wide variety of Gram-negative bacteria and makes
pBBR122 particularly interesting for studies of broad-hostrange replicons. It stably replicates in all Gram-negative
organisms tried so far under standard growth conditions
using the appropriate selective pressure. pBBR122 was
derived from pBBR1, which was isolated from Bordetella bronchiseptica S875. It is compatible with other broadhost-range vectors, since it does not belong to any of the
broad-host-range incompatibility groups IncP, IncQ or
IncW. Genetic information: pBBR122 is neither mobilizable nor conjugative. Rep is the gene involved in replication.
By removing a frame shift in the Mob gene of pBBR122,
pBHR1 was created. This mobilizable vector is available
as well.
Replicate in
• Aeromonas caviae
• Aeromonas hydrophila
• Acetobacter xylinum
• Aeromonas veronii
• biovar sobria
• Agrobacterium tumefaciens
• Alcaligenes eutrophus
• Azorizobium caulinodans
• Bartonella bacillifonis
• Bordetella spp
• Brucella spp
• Caulobacter crescentus
• Escherichia coli
• Hyphomicrobium denitrificans
• Hyphomicrobium facilis
• Methylobacillus glyocogenes
• Methylbacterium extorquens
• Methylophilus
• methylotrophus
• Pseudomonas syringae
• Pseudomonas (Burkholderia)
• solanacearum
• Paracoccus denitrificans
• Pseudomonas fluorescens
• Pseudomonas putida
• Rhizobium meliloti
• Rhizobium leguminosarum
• Rhodobacter sphaeroides
• Salmonella typhimurium
• Vibrio cholerae
• Xanthomonas campestris
• and potentially many more!
Note: The organisms which have been used in combination with pBBR122, are listed on this page. We assume that
pBBR122 and pBHR1 replicate in many more organisms
than tested so far. If you have tested pBBR122 in an organism which is not on the list, we would appreciate your
feedback. Thank you!
A detailed handbook is available for download
Order Information, Shipping & Storage
Order No. Description
Amount
PBBR01 pBBR122 vector DNA (not mobilizable), lyophilized 5 µg
5 µg
PBBR02 pBHR1 vector DNA (mobilizable), lyophilized
Shipped at RT; store at 4 °C
Map of pBBR122. CmR, chloramphenicol resistance; KanR, kanamycin resistance; Rep, replication. Restriction sites within the
marker genes are indicated.
Map of pBHR1. CmR, chloramphenicol resistance; KanR, kanamycin resistance; Rep, replication. Mob, mobilization. Restriction
sites within the marker genes are indicated.
The vector pBBR122 has been developed by Dr. Camille
Locht, Inst. Pasteur, France.
The vector pBHR1 has been developed by the Laboratoire
de Génétique des Procaryotes - Dr. Michael Faelen, Philippe Gabant, Cédric Szpirer. It is commercialized under
non-exclusive license granted by the Université Libre de
Bruxelles, Belgium.
References
1. Renauld-Mongénie, G. et al., J. Bacteriol. 178 (1996) 1053-1060
2. Elzer, P. H. et al., Plasmid 33 (1995) 51-57
3. Kovach, M. E. et al., Gene 166 (1995) 175-176
4. Kovach, M. E. et al., BioTechniques 16, 5 (1994) 800-802
5. Antoine, R. and Locht, C., Mol. Microbiol. 6, 13 (1992) 1785-1799
6. Szpirer, C. Y. et al., J. Bacterial. 183 (2001) 2101-2110
7. Szpirer, C. Y. et al., Mol. Microbiol. 37 (2000) 1283-1292
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Suicide Vector pCorrectClone
Page 27
E. coli Cloning Suicide Vector






Features
95% cloning efficiency!**
Low copy vector reduces copy number of potentially toxic genes (important e.g. for cloning B. subtilis genes)
Dephosphorylation of vector becomes superfluous
9 unique restriction sites (in MCS) available which can
be combined with five other sites outside gvpA for directed cloning
No expensive chemicals like X-Gal are necessary for
selective medium
High-level production of mRNA and protein is achieved
by the strong lambda promoter
**of a 2.1 kb Kpn l DNA fragment (sticky ends);
of a 2.0 kb PCR product into the vector’s Sma l site (blunt ends)
Product Description
The pCorrectClone cloning vector is a tool for high-efficient cloning of DNA fragments and high-level expression
of proteins in E. coli. The positive selection that makes
cloning so easy is based on the plasmid-located conditional lethal gvpA gene coding for the gas vesicle protein
from Anabaena flos-aquae. Overexpression of this protein
is toxic for E. coli and leads to cell death of bacteria carrying gvpA. When a DNA fragment is cloned into the MCS
within gvpA, the lethal gene is disrupted. Thus, only the
AmpR transformants with insert-containing plasmids will
grow. The system has particularly useful aspects for the
construction of gene banks, sequencing projects and cloning of PCR products. The vector can be used with your
E. coli strain of choice.
Strategy for high-efficient selection of recombinant clones.
Applications
 Positve selection of recombinant clones
(only recombinants will grow!)
 Cloning of PCR products, cDNA or any other DNA
 High-level mRNA production
More than 95% recombinant clones –
an efficient tool to help you avoid wasting
time on false positives!
The DNA sequence of pCorrectClone is available for
download.
A detailed handbook is also available for download on our
website www.mobitec.com
Order Information, Shipping & Storage
Order No. Description
PCC001
pCorrectClone Vector
Vector DNA
Sequencing primers
shipped at RT; store at 4 °C
PCC002
pCorrectClone Cloning Kit
Vector DNA
Sequencing primers
T4 DNA ligase
10x ligase buffer
restriction endonuclease Sma I
SmaI 10x reaction buffer
sterile water
TE-buffer
Amount
10 µg
500 pmole
10 µg
500 pmole
50 U
100 µl
50 U
100 µl
1 ml
1 ml
PCC003
*Restriction site
is not unique
pCorrectClone Cloning Kit plus
components as in No. PCC002 plus
as above
competent E. coli cells
10 x 100 µl
Shipped on blue ice (PCC002) or dry ice (PCC003); vector, primers and
buffers store at 4 °C; enzymes at -20 °C; cells at -80 °C
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Multiple Cloning Side Vector pMCS5
Page 28
E. coli Cloning Vector with Largest MCS for Versatile Cloning Strategies

Features
Standard cloning into a site upstream from a T7 RNA
polymerase promoter
End-cloning
Labeling
Linearization of recombinant clones
Blue/white selection




 Generation of single-stranded DNA (using the f1 origin)
Product Description
The cloning vector pMCS5 contains the ultimate multiple cloning site (MCS) with 59 unique restriction sites. Included are the recognition sites for many commonly used
restriction enzymes, providing a suitable cloning site for
almost any application. The scientist can choose between
46 unique hexamer sites, two heptamer sites and the recognition sites of all ten octanucleotide-specific endonucleases. In addition, the well-defined 18-mer sequence
of the extremely rarely cutting enzyme I-SceI2 is located
at one terminus of the MCS, enabling the linearization of
recombinant clones. I-SceI does not recognize a palindrome and can thus be used for labeling and end-cloning.
Further it can be utilized for strand protection in unidirectional deletion experiments. Included in the MCS are also
restriction sites which occur very infrequently in human
DNA such as MluI, NruI and SplI.
59 unique restriction sites!
The DNA sequence as well as a detailed handbook are
available for download on our web site
Our DNA vector systems are supplied in convenient storage boxes.
Restriction Enzyme Recognition sites in the 259-bp MCS cassette
Recognition Sequences
Enzymes
Properties
Heptamer sequences
BaeI, RSrII
Octamer sequences
AscI, FseI, NotI, SrfI
PacI, SwaI
PmeI, SgrAI, Sse8387I, SfiI
only GC pairs
only AT pairs
Hexamer sequences
MluI, NruI, SplI, ClaI
AccI, Acc65I, AgeI, ApaI, AvrII, BamHI, BbeI, BglII,
Bsp120I, BspDI, BspMI, BssHII, BstBI, Ecl136II,
EcoRI, EcoRV, EheI, HindIII , HpaI, KasI, KpnI, MunI,
NarI, NcoI, NdeI, NheI, NsiI, Nsp7524V, PmlI, Ppu10I,
PstI, SacI, SacII, SalI, SmaI, SnaBI, SpeI, SphI, XbaI,
very infrequent in human DNA
since the plasmid was produced
in the dam+ strain DH5α, the ClaI
site is methylated and cannot be
cleaved
XhoI, XmaI, XmaIII
18-mer sequence
I-SceI2
highly unlikely in any DNA
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Multiple Cloning Side Vector pMCS5
Page 29
Multiple Cloning Site and Vector Map
With the 18-mer
recognition sequence I- Sce I
Note: Depending on the DNA vector program used, the
number of restriction enzyme cleavage sites may vary.
We have determined the number of sites with DNA Strider
1.2.
The vector has been developed by Dr. Jörg Hoheisel, German Cancer Research Center (DKFZ), Heidelberg, Germany.
References
1. Hoheisel, J., BioTechniques 17, 3 (1994) 456-459
2. Thierry et al., Nucl Acid Res. 19 (1991) 189-190
Map and multiple cloning site of vector pMCS5; AmpR: ampicillin resistance, f1 ori: filamentous phage f1 origin, lacZ´: ß-galactosidase, pBR322
ori: plasmid pBR322 origin (ColE1), T7 promoter: RNA polymerase T7
promoter, polylinker: from pUC18, new MCS inserted; sequence and restriction sites listed above.
Order Information, Shipping & Storage
Order No.
Description
PMCS5
pMCS5 vector DNA, lyophilized
Shipped at RT; store at 4 °C
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Amount
5 µg
Standard Cloning Vectors
Page 30
E. coli Standard Cloning Vectors




Features
Highest quality DNA prepared by ion-exchange chromatography, cesium chloride density centrifugation
and gel filtration
Preparations with over 80% supercoiling
Of special interest: pUC118 and pUC119
Ready-to-use for transformations and enzymatic reactions
�
DNA extraction
�
�
pBR322 is an ampicillin and tetracycline resistant, general
purpose cloning vector. Several inactivating cloning sites
are present in the antibiotics resistance genes, which, if a
reading frame shift occurs, will give rise to AmpR / TcS or,
alternatively, AmpS / TcR transformants. Cloning sites are
indicated on the data sheet.
pBR325 is an ampicillin, tetracycline and chloramphenicol
resistant, general purpose cloning vector. It is derived from
pBR322 by insertion (into its EcoRI site) of the chloramphenicol acetyltransferase gene.
pBR328 is an ampicillin, tetracycline and chloramphenicol resistant, general purpose cloning vector. This vector,
derived from pBR325, has the bom site (basis of mobility) deleted and therefore is non-mobilizable; this makes
pBR328 suitable where more stringent biological containment is required. This deletion also creates extra unique
cloning sites in the chloramphenicol acetyltransferase
gene: PvuII, BspMII and BalI.
Vector
Resistance
Origin Speciality
pBR322
Tc, Amp
ColE1
pBR325
Tc, Amp, Cm
pBR328
Tc, Amp, Cm
pACYC184 Tc, Cmp15A1
ColE1
ColE1
pAT153
Tc, Amp
ColE1
pUC18
Amp
ColE1
pUC118
Amp
ColE1
pUC19
Amp
ColE1
pUC119
Amp
ColE1
reading frame shift gives
AmpR, TcS transformants
Cm resistant pBR322
non-mobilizable pBR325
double-transformants
with ColE1 vectors
non-mobilizable;
higher copy than pBR322
MCS within lacZ:
blue/white selection
M13 origin
for ssDNA production
MCS within lacZ:
blue/white selection
M13 origin
for ssDNA production
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Standard Cloning Vectors
Page 31
pUC18/19 and pUC118/119
The plasmids have a multiple cloning site within the lacZ
α-fragment. Inserts cloned into this site disrupt ß-galactosidase activity and give rise to white colonies on X-Gal/
IPTG plates. The plasmids encode resistance to ampicillin. Foreign DNA inserted in-frame with the lacZ gene will
be expressed as a fusion protein (containing a portion of
the ß-galactosidase) under control of the lac promoter.
The promoter is inducible with IPTG and followed by an
initiation codon as well as a ribosome binding site. pUC18
and pUC19 differ in their multiple cloning site orientation.
pUC118 and pUC119 contain an additional M13 phage origin for single strand production.
�
pACYC184
pACYC184 encodes tetracycline and chloramphenicol resistance. Unlike most cloning vectors, which have ColE1
origins of replication, pACYC184 has an origin derived
from p15A1. This allows pACYC184 to be maintained in
a pBR322 or pUC18 transformant, for example. Such a
double transformant is necessary where two recombinant
proteins need to be expressed simultaneously.
�
�
pAT153
pAT153 is a derivative of pBR322 where the bom (basis of
mobility) site has been deleted. Thus pAT153 is non-mobilizable and is more readily contained than pBR322. Also
present in this 703 bp deletion was the region involved in
copy number control; loss of this region gives pAT153 a
1.5 to 3-fold higher copy number. pAT153 encodes ampicillin and tetracycline resistance.
�
Thr Met Ile Thr Asn Ser Ser Ser Val Pro Gly Asp Pro Leu Glu Ser Thr Cys Arg His Ala Ser Leu Ala Leu Ala
ATG ACC ATG ATT ACG AAT TCG AGC TCG GTA CCC GGG GAT CCT CTA GAG TCG ACC TGC AGG CAT GCA AGC TTG GCA CTG GCC
�������������
������
�����
����� ������������ ������
����� ���������������������
�����
�����
��������
Thr Met Ile Thr Pro Ser Leu His Ala Cys Arg Ser Thr Leu Glu Asp Pro Arg Val Pro Ser Ser Asn Ser Leu Ala
ATG ACC ATG ATT ACG CCA AGC TTG CAT GCC TGC AGG TCG ACT CTA GAG GAT CCC CGG GTA CCG AGC TCG AAT TCA CTG GCC
�������������������������������������������������������
��������
�����
�����
���������������������
�����
������ ������������ �����
�����
������
Multiple cloning sites of pUC18/pUC118 (top) and pUC19/pUC119 (bottom).
Quality Control/Technical Details:
Protein contamination is monitored by measuring the ratio of absorbance at 260 and 280 nm. All preparations must have A260/
A280 greater than 1.8, indicating essentially protein-free DNA.
The absence of nuclease activity is measured by incubating
plasmid DNA in restriction buffer for 16 hours. No DNA degradation should be observed. The DNA‘s suitability for enzymatic
manipulation is tested by restriction with a variety of endonucleases. The correct banding pattern is confirmed by agarose gel
electrophoresis. The transformation efficiency of the plasmid
DNA is measured and antibiotic resistance and blue/white selection is also confirmed. During storage at 4°C, plasmid DNA will
slowly convert from supercoiled to relaxed circles. Although this
will not affect restriction, transformation efficiency will drop. For
long-term storage keep at -20°C. If multiple freeze-thawing cycles are likely to occur, dispense small volumes into sterile tubes
and store at -20°C. All plasmids are supplied in TE buffer (10 mM
Tris-HCI, pH 8.0, 1 mM EDTA).
Order Information, Shipping & Storage
Order No.
Description
V30302
pBR322 vector DNA
V30402
pBR325 vector DNA
V32802
pBR328 vector DNA
V32402
pACYC184 vector DNA
V32602
pAT153 vector DNA
V33002
pUC18 vector DNA
V33302
pUC118 vector DNA
V33202
pUC19 vector DNA
V33402
pUC119 vector DNA
Shipped on blue ice; store at -20 °C
Amount*
25 µg
25 µg
25 µg
25 µg
25 µg
25 µg
25 µg
25 µg
25 µg
*DNA is in solution
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
EosFP
Page 32
Green to Red Photoconvertible Fluorescent Protein for Local Marking
EosFP was isolated from the stony coral Lobophyllia
hemprichii 1. Initially, the protein matures in a green fluorescent state with an emission maximum at 516 nm. Upon irradiation with violet-blue light the chromophore undergoes
an irreversible photoconversion to a red state emitting at
581 nm 2. The wavelengths required for photoconversion
and detection of the green and red fluorescent states can
be easily separated, making EosFP an excellent choice for
regional optical marking.




Features
 Green to red photoconversion: UV/blue-inducible, permanent, bright and fast
 Superb marker for tracking of cells, compartments, proteins in live cells
 Nanoscopy marker using photoactivated localization
microscopy (PALM)
Applications
Tracking of cells, e.g. cell fate mapping, tracking of metastases
Tracking of subcellular compartments
Tracking of proteins
Fluorescence nanoscopy
References
1. Wiedenmann et al. (2004). Proc. Natl. Acad. Sci. U.S.A. 101,
15905-15910.
2. Nienhaus et al. (2005). Proc. Natl. Acad. Sci. U.S.A. 102,
9156-9159.
3. Wiedenmann et al. (2007) BIOforum 30/5, 20-22.
4. Nienhaus et al. (2006) Photochem. Photobiol. 82, 351358.
Protein
wt-EosFP
td-EosFP
Excitation before/after photoconversion (nm)
506/571
506/569
516/581
516/582
Extinction coefficient before/after photoconversion (M cm )
72,000/41,000
84,000/33,000
Fluorescence Quantum Yield
0.70/0.55
0.66/0.60
Oligomerization
tetramer
tandem dimer, functional monomer
Emission before/after photoconversion (nm)
-1
Two variants of EosFP are available from MoBiTec:
The tetrameric wildtype protein (wt-EosFP) and a pseudomonomeric variant in which two copies of an engineered
EosFP variant are fused to form a tandem dimer (td-EosFP). Both variants express functionally in a wide range of
pro- and eukarotic cells at a temperature of 37 °C or below.
For the labeling of cells or tissues, tetrameric wt-EosFP is
the construct of choice. For labeling of subcellular compartements using short oligopeptide signals attached to the
-1
marker, both wt-EosFP and td-EosFP can be considered.
Although some fusion proteins with tetrameric wt-EosFP
are possible, the pseudomonomeric variant td-EosFP is
the recommended construct for protein labeling. Fusions
to the N-terminus of td-EosFP usually work well. Fusions
to the C-terminus are also possible, however, some fusions might fail with proteins requiring a strictly monomeric
marker, for instance tubulin.
Order Information, Shipping & Storage
Order No.
Description
VS-FLP10010
pcDNA3-vector, wt-EosFP, with mitochondrial targeting signal, lyophilized DNA
VS-FLP10020
pcDNA3-vector, wt-EosFP, FLAG®-tagged, lyophilized DNA
VS-FLP10030
pcDNA3-vector, td-EosFP, FLAG®-tagged, lyophilized DNA
FLAG® is a registered trademark of Sigma-Aldrich Co.
Amount
10 µg Not available in the US
10 µg Not available in the US
10 µg Not available in the US
Shipped at RT; store at 4 °C
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
MobiTEV Protease
Page 33
Improved TEV Proteases
Tobacco Etch Virus (TEV) Protease is used to remove fusion tags - solubility, secre,
,
tion, detection, and purification tags - and release the native protein of interest. MobiTEV Protease is an improved version of TEV Protease that is highly site-specific,
highly active, and significantly more stable than native TEV Protease, resulting in
enhanced long-term activity. MobiTEV Protease specifically recognizes the seven
amino acid sequence Glu-Asn-Leu-Tyr-Phe-Gln/-Gly, cleaving between Gln and Gly.
Features
 Highly specific cleavage activity
 Robust activity over a broad temperature (4 °C to 37 °C) and
pH (7 to 9) range
 Enhanced enzyme stability for prolonged protease activity
 Greater than 85% single-band purity with no non-specific protease
contamination
 Easy removal of TEV Protease from the digested protein sample
using the His- or GST-tag
Unit Definition
One unit of MobiTEV Protease cleaves 3 µg of the control substrate at >85% in
1 hour in 30 µl reaction buffer (50 mM Tris/HCl, 0.5 mM EDTA and 1 mM DTT) at
pH 8.0 and 30 °C.
Reference
Kapust et al. (2001) Tobacco etch virus protease: mechanism of autolysis and rational design of stable mutants with wildtype catalytic proficiency. Protein Eng. 14, 993-1000.
Order Information, Shipping & Storage
Order No.
Description
PR-ETA10010-01
MobiTEV, recombinant, His-tag
PR-ETA10010-05
MobiTEV, recombinant, His-tag
Amount
1,000 U
10x 1,000 U
Shipped on dry ice; store at -80 °C
TEV Protease with additional GST-tag:
PR-ETA10050-01
TEV Protease, recombinant, GST- & His-tag
PR-ETA10050-02
TEV Protease, recombinant, GST- & His-tag
PR-ETA10050-03
TEV Protease, recombinant, GST- & His-tag
Shipped on blue ice; store at -20 °C
100 U
500 U
1,000 U
Not available in the US
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
IgA Protease
Page 34
Especially Useful for Cleavage of Fusion Protein in Inclusion Bodies
IgA Protease, also referred to as Igase or Endoprotease Pro-Pro-Y-Pro, is an endoprotease with a MW of 106 kDa that cleaves the proline-rich hinge region of IgA1.
The enzyme recognizes the amino acid sequence N-X-Z-Pro-Pro/-Y-Pro-C (X = preferred Pro or Ser; Y = Thr, Ser or Ala; Z = preferred Arg or Thr). IgA Protease processes polypeptides at authentic or engineered sites. Highly specific proteolysis can
be obtained not only with soluble and purified protein fusions but also with insoluble
aggregates derived from cytoplasmic inclusion bodies.
Features
 Highly specific recognition of
N-X-Z-Pro-Pro/-Y-Pro-C sequence
 Especially useful for cleavage of insoluble
aggregates derived from inclusion bodies
 Used in the PheBo Fusion Protein System
for cloning, expression, cleavage and affinity
purification of fusion proteins.
Order Information, Shipping & Storage
Order No.
Description
EP0205
IgA Protease (Igase Pro-Pro-Y-Pro), recombinant
Amount
50 µg
Shipped on dry ice; store at -20 °C
HRV3C Protease
Highly Active Protease for the ‘PreScission’ Site
Human rhinovirus 3C (HRV3C) Protease is a cysteine protease that recognizes the
cleavage
site of Leu-Glu-Val-Leu-Phe-Gln/-Gly-Pro, commonly referred to as the
,
,
PreScission site. It cleaves between Gln and Gly. The recombinant form of the
HRV3C Protease is a restriction grade protease that has robust activity at 4 °C with
high specific activity and great stability. It does not require any special buffer for its
activity and can be used in a buffer most suitable for the target protein. This HRV3C
Protease is a 47 kDa protein with both GST- and His-tags, so it can be removed by
either Ni-chelating or Glutathione (GSH) resin.
Features
 Highly specific, e.g. more specific than thrombin protease
,
,
 Cost effective compared to GE’s PreScission Protease
 Easy removal of HRV3C using GST- or His-tag
 No buffer restrictions; use the suitable buffer for your target protein
 Freeze resistant and functional even after multiple freeze-thaws
Unit Definition
One unit of HRV3C Protease cleaves >95% of 100 µg of control target protein at 4 °C
in 16 hours. No non-specific activity has been observed under the same condition
with HRV3C Protease to control target protein ratio of 1:10. Prolonged incubation
(several days) under the same condition does not show any non-specific cleavage.
Reference
Cordingley et al. (1989) Cleavage of small peptides in vitro by human rhinovirus 14 3C protease expressed in Escherichia coli. J Virol. 63(12), 5037-45.
Order Information, Shipping & Storage
Order No.
Description
Amount
PR-ETA20010-01
HRV3C Protease, recombinant, GST- & His-tag
1,000 U
Shipped on blue ice; store at -20 °C
Not available in the US
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Kex2 Proteases
Page 35
Protease for Alternative Cleavage Sites
Kex2 is a specific serine endoprotease from yeast with a MW of 68 kDa. It cleaves
at the carboxyl end of the recognition sequences: Arg-Arg/-X and Lys-Arg/-X and
thus provides new possibilities for e.g. the development of fusion protein systems
with alternative cleavage sites.
Features
 Cleaves amino acid sequences N-Arg-Arg/-X
and N-Lys-Arg/-X at the carboxyl end
 Suited for protein sequencing and cleavage
of fusion proteins
Order Information, Shipping & Storage
Order No.
Description
Amount
EP0410
Kex2 Protease (Lys/Arg-Arg), recombinant
10 U
EP0450
Kex2 Protease (Lys/Arg-Arg), recombinant
50 U
Shipped on dry ice; store at -80 °C
Pro39 Protease
Very Specific and Tuneable Protease
Pro39 is the Semliki Forest Virus (SFV) non-structural protein nsP2 C-terminal
protease domain, in a truncated, modified and His-tagged form. Pro39 protease
specifically recognizes and cleaves the amino acid sequence DVLRLGRAGA/
YIFSS or DVLRLGRAGA/G. The cleavage is highly specific and active.
The molecular weight of Pro39 is approximately 39 kDa. Since the protease has a
His-tag, it can be easily removed from cleavage reactions.
The reaction conditions for cleaving of fusion proteins have to be determined empirically. During cleavage reactions, it is recommended that samples be removed
from the reaction mixture at various points in time and analyzed by SDS-PAGE to
estimate the yield and extent of digestion, and the purity of the product. Typical
parameters that should be varied in pilot experiments include enzyme/substrate
ratio, substrate concentration, temperature, reaction time, pH.
Features
 Pro39 cleaves its substrates in a wide temperature and
pH range, as well as in most commonly used buffers
 The cleavage of the substrates can be reversibly inhibited by the
addition of Zn2+ ions and reactivated by the addition of EDTA
 Pro39 cleaves substrates containing the recognition site both
in liquid as well as in a resin-bound state
Order Information, Shipping & Storage
Order No.
Description
Amount
PR-ENP00010-01
Pro39 Protease, recombinant, His-tag
500 U
PR-ENP00010-02
Pro39 Protease, recombinant, His-tag
2,500 U
Shipped on dry ice; store at -80 °C
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
Factor Xa Protease
Page 36
The Endoprotease that Creates Authentic Recombinant Proteins
Factor Xa is a specific serine endoprotease with an extended,
substrate-binding region matching the Ile-Glu-Gly-Arg tetrapeptide segment. Following purification, the fusion protein is treated
with Factor Xa to release the desired protein with a precise N-terminal sequence determined by the vector construction, which is
particular useful for structural work and for any other application
requiring substantial amounts of authentic recombinant protein
product.
Features
 Highly active cleavage of N-Ile-Glu-Gly-Arg/-C sequence at the
carboxyl end
 Creates N-terminal authentic recombinant protein if cloned into
the NruI site of the pAX5+ vector
Order Information, Shipping & Storage
Order No.
Description
EP0504
Factor Xa Protease (Ile-Glu-Gly-Arg)
Amount
250 µg
Shipped at RT; store at 4 °C
Not available in the US and Canada
HS-Nuclease
Fast Digestion of Nucleic Acids with a highly purified Endonuclease
HS-Nuclease is a recombinant form of Serratia marcescens
extracellular endonuclease (encoded by the same gene as Bezonase®) produced in E. coli using a proprietary process. This
nonspecific endonuclease hydrolyzes both single- and doublestranded nucleic acids (DNA and RNA) to 5’-phosphorylated oligonucleotides of 1-4 bases in length. HS-Nuclease is a highly
purified homodimer of 27 kDa subunits that has exceptional high
specific activity and is free of protease activity. HS-Nuclease is
ideal to digest nucleic acids and to reduce viscosity during protein purification and sample preparation.
Features
 High speed endonuclease
 Digests single- and double-stranded nucleic acids
 Highly purified, no protease activity
 Fast digestion of nucleic acids during protein purification
 Removes nucleic acid contamination from sample preparation
50 mg of salmon sperm DNA was incubated with the indicated
units of HS-Nuclease and another brand of nuclease at 37 °C for
30 min in a buffer of 50 mM Tris-HCl, pH 8.0 and 1 mM MgCl2. DNA
digestion was monitored by agarose gel.
Order Information, Shipping & Storage
Order No.
Description
GE-NUC10700-01
HS-Nuclease (recombinant Endonuclease, encoded by the same gene of Benzonase®)
GE-NUC10700-02
HS-Nuclease (recombinant Endonuclease, encoded by the same gene of Benzonase®)
Shipped on blue ice; store at -20 °C
Amount
50,000 U
100,000 U
Benzonase® is a trademark of Merck KGaA
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
MobiSpin Columns for DNA Purification
Page 37
Equilibrated and Ready-to-Use; now also for Removal of Unincorporated Dyes!
Product Description
The MobiSpin columns are designed for a wide variety of
nucleic acid purification applications. Next to our MobiSpin
columns with Sephadex® G-50 resin three different Sephacryl® resins are available: S-200, S-300 and S-400. A
sample volume guide for the selection of the matrix suited
best for your specific needs is available at: mobitec.com.
® Trademarks are registered by Pharmacia.
Features
 Compatible with laboratory standard
 Column comes pre-packed and equilibrated
 Easy handling: spin, load sample, spin, and collect the
 purified product
 No sample dilution
 Reproducible results with simplified protocols
 One sample in less than 4 minutes
 Numerous samples can be processed simultaneously
 Large number of applications
Applications of S-200, S-300 and S-400 matrices
 Buffer exchange between enzyme reactions
 DNA purification prior to sequencing
 Oligonucleotide purification after synthesis
 Removal of free nucleotides
 Low cost plasmid purification
Application of G-50 matrix
 Removal of unincorporated dyes or dye terminators for
 purification of DNA after labeling reactions
Non-specific binding:
The MobiSpin columns exhibit only insignificant non-specific binding, allowing purification of samples in the nanogram range. For each resin type there is a uniform proportional loss of sample due to the nature of the process.
Retention:
For a given sample volume, product retention inversely
correlates to molecular size. As the size of the product increases, its relative retention decreases.
MobiSpin columns with different matrices. Scale: reduced.
Order Information, Shipping & Storage
Order No. Description
Amount
SCO200
MobiSpin S-200
20 columns
SCO210
MobiSpin S-200
100 columns
SCO300
MobiSpin S-300
20 columns
SCO310
MobiSpin S-300
100 columns
SCO400
MobiSpin S-400
20 columns
SCO410
MobiSpin S-400
100 columns
SCO234
MobiSpin S-200, S-300, S-400
3 x 10 columns
SCO500
MobiSpin G-50
20 columns
SCO510
MobiSpin G-50
100 columns
Shipped at RT; store at 4 °C
Boca Scientific . 1-866-227-6335 . Fax: 561-995-5018 . [email protected] . www.bocascientific.com
VECTOR SYSTEMS
MoBiTec GmbH
Lotzestrasse 22a
37083 Göttingen, Germany
Phone: +49 5 51-707 22-0
Fax:
+49 5 51-707 22-22
E-mail:
[email protected]
Internet: www.mobitec.com
Distributed
by: BOCASCIENTIFIC INC.
950 PENINSULA CORPORATE CIRCLE
SUITE 1025
BOCA RATON, FL 33497
1-866-227-6335
FAX 561-995-5018
[email protected] www.bocascientific.com