Download DNA

Genes, genomes
Seminar of molecular and cell biology
Markéta Dostalíková
Genome
• complete set of information in an organism´s
DNA
• human genome
– nuclear DNA – linear dsDNA
• 25 000 genes
– mitochondrial - circular dsDNA
• 37 genes
– 13 genes encode for proteins (respiration complex – oxidative
fosforylation)
– 24 genes encode for 22 tRNA and 2 rRNA
Gene
•
•
•
Short strech of DNA encoding a single RNA or a single protein and
adjacent sequences that are involved in gene regulation (they are
transcribed, but not translated)
Exon - transcribed into RNA and codes for the amino acid sequence of
part of a protein
Intron - transcribed into RNA, excised by RNA splicing to produce
mRNA, does not code for protein
DNA
DNA molecule
• 4 types of nucleotides: A,G,C,T
• Base,sugar, phosphate
• Hydrogen bonds
• Phosphodiester bonds
• 2 polynucleotide chains
• Double helix
Bases
DNA : A, G, C, T
RNA : A, G, C, U
Sugars
The Formation of DNA
Base + Sugar = Nucleoside
– the 1´ carbon of pentose is attached to
nitrogen 1 of pyrymidine or nitrogen 9 of
purine
The Formation of DNA
Base + Sugar + Phosphate
= Nucleotide
– phosphate is attached to
the 5´-carbon of the
pentose ring
{
►deoxyribonukleotides – basic structure of DNA
nukleoside
(eg. deoxyadenosin)
dAMP = deoxyadenosinmonophosphate
dATP = deoxyadenosintriphosphate
dNTP
The other functions of nucleotides
Energy carriers, chemical groups carriers
Specific regulators
The Formation of DNA
Nucleotides join together to form nucleic acid
• The hydroxyl group attached to the 3´-pentose carbon of one
nucleotide forms an ester bond with the phosphate of another
molecule, eliminating a water molecule
• The link between nucleotides is known as a phosphodiester bond
• Thus, one end of a DNA strand has a sugar residue in which the 5´carbon is not linked to another sugar residue (the 5´end)
• Whereas at the other end the 3´carbon lacks a phosphordiester
bond (the 3´end)
5’
5’
Polarity of DNA strand
3’
3’
DNA Structure
• The double helical structure of DNA was proposed by Watson and
Crick (1950)
• The DNA helix
– The „backbone“ on the outside of the helix consists of
alternating sugars and phosphates
– The bases are attached to the sugars and form the „rungs“ of
the helix
• The strands are
– anti-parallel
• their 5´,3´-phosphordiester links run in opposite directions
– complementary
• because of base pairing the chains complement each other
video
DNA is usually found in the structure of right-handed double
helix of complementary and antiparallel strands
Minor groove
Major groove
Nucleid acid are polymers of nucleotids. Double-stranded DNA containing
deoxyribose can have several conformations
A - DNA
BDNA
Z - DNA
RNA
can have (3D) conformation because of the intramolecular base-pairing
(A-U, G-C)
Modifications of DNA
• methylation of cytosin
• CpG islands, in promotores, in non-coding regions
• they are involved in the gene imprinting, condensation
of X chromosom
The elementary structural unit of
DNA is nucleosome
Histons: H2A, H2B, H3, H4
are present in nucleosome
core (each twice). This
protein - octamer - scaffold
and DNA altogether form
nucleosome
The lenght of DNA from one
nucleosome to another is
200 bp
cca 150 bases pairs is
wounded around
nucleosome
Composition of
nucleosome
Histons are very conservative proteins
containing so call histon fold and long N-ends
Octamer of histons composes from tetramers
H3/H4 and two dimers H2A/B
Nucleosome is dynamic structure
Dynamics of nucleosome
condensing and releasing is
regulated by other proteins
Other various types of
histones can be found in
some specific nucleosomes
and sequences
Higher level of chromatin organisation –
„solenoid“, 30 nm fiber
Nucleosomes are bound
together by H1 activity
and activity of N- ends,
e.g. H4 free ends
Nucleosome beads
on DNA wire
10 000 fold condensated DNA form mitotic...
...chromosome
Stick structure is in next step
condensated by group of
proteins - condensins
Organization of DNA into chromosomes
Eukaryotic chromosomes contain one linear dsDNA
DNA associates with histons and creates chromatin
Modification of chromatin
Chromatin remodeling complexes
Modification of chromatin
Modification of histons: acetylation, methylation, fosphorylation
Histon code
In addition to genetic code there is also „histon code“ – next level of genome
information realization
Histon code
Modificated histons are bound to other
types of proteins - system of readers
and writers
DNA and histon modifications take place in epigenetic
regulation of gene expression
Genetic vs epigenetic information and heredity
Genetic information
• nearly all information that is realized by cell is in DNA
• information concerning the structure and functioning of cell
• It is carried through generations
• It must be changeable but not too much (lasting and stable
enough vs capability of changing during evolution)
• Genom is complete set of DNA (and thus information)
• Genophore: carrier of genetic information
Genes
• Gene: sequence of nucleid acid which encodes a single polypeptide
chain (protein) or a single RNA chain (rRNA, tRNA)
• Eukaryotic and prokaryotic genes differs in many features
(monocistrons, introns)
• Regulatory regions of genes – promotors; enhancers
• Repetitive sequences: are used for identification
• Mobil elementes (transposons): spread in genom
• Pseudogenes
Gene locus
35
Repetitive sequences are used for identification
Seqences in DNA:
• Encode aminoacids – proteins (mRNA)
• Encode RNA as a final product
Genetic code
Genetic code – a rule by which certain sequence of bases
determines relevant amino acid
tripletive, universal, redundant
Some aminoacids
can be encoded by
one codon
(methionine,
tryptophan) some by
six codons (leucine,
serine, arginine)
Three bases code one amino acid = triplet = codon
20 coded amino acids
4 bases (A, G, C, T) → 64 (43) combination of triplets (codons)
initiation codon is also a codone for methionin
3 triplets function as stop codons
3 possibilities of reading of the sequence of triplets: reading
frames
38
Task
Tyrosine - Y
Tryptofan - W
Glutamine - Q
Arginine - R
Asparagine - N
Lysine - K
Aspartic acid - D
Glutamic acid - E
AGUGAAAUGAUUAAUGCAAGGUGAGGGGAGAACGAGUGAUAA
Frameshift
Deletion or addition of DNA sequences
– They may arise as a result of unequal crossing over during
meiosis, or spontaneous breakage of chromosomes
• For example, deletion of a single base will alter remaining
amino acid sequence
• Duchenne muscular dystrophy (deletion and alteration of
reading frame)
• Becker muscular dystrophy (deletion but not alteration of
reading frame)
Expansion of trinucleotide repeats
expansion of a sequence of DNA that contains a series of repeated
nucleotide triplets
– In diseases identified so far the repetitive sequence is present in
the gene of normal individuals, but is expanded up to a 1000-fold
in the gene of affected patients
– Myotonic dystrophy – CAG repetition, progressive muscle
weakness
– Huntington‘s disease – progressive dementia and involuntary
movements, in middle age
– Fragile X syndrome – X chromosome linked mental retardation
Task
To find this nucleotide sequence on web site
gcccgagagaccatgcagaggtcgcctctggaaaaggccagcgttgtctccaaacttttt
http://blast.stva.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome