* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download DNA
Expanded genetic code wikipedia , lookup
Epitranscriptome wikipedia , lookup
Biochemistry wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Genome evolution wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Gene expression wikipedia , lookup
Molecular cloning wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Genetic code wikipedia , lookup
Community fingerprinting wikipedia , lookup
DNA supercoil wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Point mutation wikipedia , lookup
Biosynthesis wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Non-coding DNA wikipedia , lookup
Molecular evolution wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková Genome • complete set of information in an organism´s DNA • human genome – nuclear DNA – linear dsDNA • 25 000 genes – mitochondrial - circular dsDNA • 37 genes – 13 genes encode for proteins (respiration complex – oxidative fosforylation) – 24 genes encode for 22 tRNA and 2 rRNA Gene • • • Short strech of DNA encoding a single RNA or a single protein and adjacent sequences that are involved in gene regulation (they are transcribed, but not translated) Exon - transcribed into RNA and codes for the amino acid sequence of part of a protein Intron - transcribed into RNA, excised by RNA splicing to produce mRNA, does not code for protein DNA DNA molecule • 4 types of nucleotides: A,G,C,T • Base,sugar, phosphate • Hydrogen bonds • Phosphodiester bonds • 2 polynucleotide chains • Double helix Bases DNA : A, G, C, T RNA : A, G, C, U Sugars The Formation of DNA Base + Sugar = Nucleoside – the 1´ carbon of pentose is attached to nitrogen 1 of pyrymidine or nitrogen 9 of purine The Formation of DNA Base + Sugar + Phosphate = Nucleotide – phosphate is attached to the 5´-carbon of the pentose ring { ►deoxyribonukleotides – basic structure of DNA nukleoside (eg. deoxyadenosin) dAMP = deoxyadenosinmonophosphate dATP = deoxyadenosintriphosphate dNTP The other functions of nucleotides Energy carriers, chemical groups carriers Specific regulators The Formation of DNA Nucleotides join together to form nucleic acid • The hydroxyl group attached to the 3´-pentose carbon of one nucleotide forms an ester bond with the phosphate of another molecule, eliminating a water molecule • The link between nucleotides is known as a phosphodiester bond • Thus, one end of a DNA strand has a sugar residue in which the 5´carbon is not linked to another sugar residue (the 5´end) • Whereas at the other end the 3´carbon lacks a phosphordiester bond (the 3´end) 5’ 5’ Polarity of DNA strand 3’ 3’ DNA Structure • The double helical structure of DNA was proposed by Watson and Crick (1950) • The DNA helix – The „backbone“ on the outside of the helix consists of alternating sugars and phosphates – The bases are attached to the sugars and form the „rungs“ of the helix • The strands are – anti-parallel • their 5´,3´-phosphordiester links run in opposite directions – complementary • because of base pairing the chains complement each other video DNA is usually found in the structure of right-handed double helix of complementary and antiparallel strands Minor groove Major groove Nucleid acid are polymers of nucleotids. Double-stranded DNA containing deoxyribose can have several conformations A - DNA BDNA Z - DNA RNA can have (3D) conformation because of the intramolecular base-pairing (A-U, G-C) Modifications of DNA • methylation of cytosin • CpG islands, in promotores, in non-coding regions • they are involved in the gene imprinting, condensation of X chromosom The elementary structural unit of DNA is nucleosome Histons: H2A, H2B, H3, H4 are present in nucleosome core (each twice). This protein - octamer - scaffold and DNA altogether form nucleosome The lenght of DNA from one nucleosome to another is 200 bp cca 150 bases pairs is wounded around nucleosome Composition of nucleosome Histons are very conservative proteins containing so call histon fold and long N-ends Octamer of histons composes from tetramers H3/H4 and two dimers H2A/B Nucleosome is dynamic structure Dynamics of nucleosome condensing and releasing is regulated by other proteins Other various types of histones can be found in some specific nucleosomes and sequences Higher level of chromatin organisation – „solenoid“, 30 nm fiber Nucleosomes are bound together by H1 activity and activity of N- ends, e.g. H4 free ends Nucleosome beads on DNA wire 10 000 fold condensated DNA form mitotic... ...chromosome Stick structure is in next step condensated by group of proteins - condensins Organization of DNA into chromosomes Eukaryotic chromosomes contain one linear dsDNA DNA associates with histons and creates chromatin Modification of chromatin Chromatin remodeling complexes Modification of chromatin Modification of histons: acetylation, methylation, fosphorylation Histon code In addition to genetic code there is also „histon code“ – next level of genome information realization Histon code Modificated histons are bound to other types of proteins - system of readers and writers DNA and histon modifications take place in epigenetic regulation of gene expression Genetic vs epigenetic information and heredity Genetic information • nearly all information that is realized by cell is in DNA • information concerning the structure and functioning of cell • It is carried through generations • It must be changeable but not too much (lasting and stable enough vs capability of changing during evolution) • Genom is complete set of DNA (and thus information) • Genophore: carrier of genetic information Genes • Gene: sequence of nucleid acid which encodes a single polypeptide chain (protein) or a single RNA chain (rRNA, tRNA) • Eukaryotic and prokaryotic genes differs in many features (monocistrons, introns) • Regulatory regions of genes – promotors; enhancers • Repetitive sequences: are used for identification • Mobil elementes (transposons): spread in genom • Pseudogenes Gene locus 35 Repetitive sequences are used for identification Seqences in DNA: • Encode aminoacids – proteins (mRNA) • Encode RNA as a final product Genetic code Genetic code – a rule by which certain sequence of bases determines relevant amino acid tripletive, universal, redundant Some aminoacids can be encoded by one codon (methionine, tryptophan) some by six codons (leucine, serine, arginine) Three bases code one amino acid = triplet = codon 20 coded amino acids 4 bases (A, G, C, T) → 64 (43) combination of triplets (codons) initiation codon is also a codone for methionin 3 triplets function as stop codons 3 possibilities of reading of the sequence of triplets: reading frames 38 Task Tyrosine - Y Tryptofan - W Glutamine - Q Arginine - R Asparagine - N Lysine - K Aspartic acid - D Glutamic acid - E AGUGAAAUGAUUAAUGCAAGGUGAGGGGAGAACGAGUGAUAA Frameshift Deletion or addition of DNA sequences – They may arise as a result of unequal crossing over during meiosis, or spontaneous breakage of chromosomes • For example, deletion of a single base will alter remaining amino acid sequence • Duchenne muscular dystrophy (deletion and alteration of reading frame) • Becker muscular dystrophy (deletion but not alteration of reading frame) Expansion of trinucleotide repeats expansion of a sequence of DNA that contains a series of repeated nucleotide triplets – In diseases identified so far the repetitive sequence is present in the gene of normal individuals, but is expanded up to a 1000-fold in the gene of affected patients – Myotonic dystrophy – CAG repetition, progressive muscle weakness – Huntington‘s disease – progressive dementia and involuntary movements, in middle age – Fragile X syndrome – X chromosome linked mental retardation Task To find this nucleotide sequence on web site gcccgagagaccatgcagaggtcgcctctggaaaaggccagcgttgtctccaaacttttt http://blast.stva.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome