Download Photobleaching Substrates Characterized Using Fluorescence

Transient Association of Ku with Nuclear
Substrates Characterized Using Fluorescence
Photobleaching
This information is current as
of August 2, 2017.
References
Subscription
Permissions
Email Alerts
J Immunol 2002; 168:2348-2355; ;
doi: 10.4049/jimmunol.168.5.2348
http://www.jimmunol.org/content/168/5/2348
http://www.jimmunol.org/content/suppl/2002/02/21/168.5.2348.DC1
This article cites 49 articles, 22 of which you can access for free at:
http://www.jimmunol.org/content/168/5/2348.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2002 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on August 2, 2017
Supplementary
Material
William Rodgers, Stephen J. Jordan and J. Donald Capra
Transient Association of Ku with Nuclear Substrates
Characterized Using Fluorescence Photobleaching1
William Rodgers, Stephen J. Jordan, and J. Donald Capra2
T
he V(D)J recombination reaction in B and T lymphocyte
development occurs in two distinct phases (1). First,
genomic DNA is cleaved at recombination signal sequences by the RAG1 and RAG2 enzymes. This is followed by
repair of the ensuing DNA double-strand breaks (DSBs)3 by nonhomologous end joining (NHEJ). The protein complex DNA-PK,
composed of Ku and a catalytic subunit (DNA-PKCS), initiates the
NHEJ reaction. Ku binds to the free ends of the DSB, after which
DNA-PKCS is recruited to the DNA-Ku complex (2– 4). Assembly
of DNA-PK at the DNA lesion leads to further recruitment of
DNA repair enzymes, including the XRCC4/DNA ligase IV complex (5, 6). Similar to its role in V(D)J recombination, DNA-PK
functions in NHEJ during repair of DNA lesions that form as a
result of ionizing radiation and chemical agents.
Ku itself is a heterodimer composed of 70- and 83-kDa subunits,
termed Ku70 and Ku86 (or Ku80), respectively (7). In vitro studies
have shown that Ku binds to the free ends of DNA in a sequenceand structure-independent manner (8 –11). This presumably allows
Ku to bind to DSBs to initiate DNA repair. The x-ray crystal structure of Ku shows that it binds to DNA through a channel that is
formed by the Ku70-Ku86 heterodimer (12).
Molecular Immunogenetics Program, Oklahoma Medical Research Foundation, Oklahoma City, OK 73104
Received for publication July 3, 2001. Accepted for publication December 18. 2001.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by a grant from the National Institutes of Health (AI
12127; to J.D.C.).
2
Address correspondence and reprint requests to Dr. J. Donald Capra, Molecular
Immunogenetics Program, Oklahoma Medical Research Foundation, 825 NE 13th
Street, MS 17, Oklahoma City, OK 73104. E-mail address: jdonald-capra@omrf.
ouhsc.edu
3
Abbreviations used in this paper: DSB, double-strand break; CD, central domain;
FLIP, fluorescence loss induced by photobleaching; FRAP, fluorescence recovery
after photobleaching; GFP, green fluorescent protein; NHEJ, nonhomologous end
joining; TR, Texas Red; TX-100, Triton X-100.
Copyright © 2002 by The American Association of Immunologists
Genetic studies have provided important evidence that Ku is
essential for NHEJ in the repair of DSBs. For example, cells deficient in either Ku70 or Ku86 are hypersensitive to ionizing radiation (13, 14). Other compelling evidence includes studies of T
cell and B cell populations in Ku-deficient mice. For example,
DSBs generated during V(D)J recombination are not efficiently
repaired in mice that lack the expression of either Ku70 or Ku86
(15–17). Consequently, these animals exhibit a SCID phenotype.
Similarly, Ig heavy chain class switch recombination, which also
contains a DSB intermediate, is similarly inhibited in Ku70-deficient mice (18).
Despite the evidence that Ku functions in NHEJ during repair
of DSBs, its properties in intact cells are unclear. For example,
little is known concerning the dynamics of Ku in intact nuclei
as defined by its mobility and the rate at which it associates with
substrates. Interestingly, recent studies have provided specific examples of DNA- or RNA-binding proteins that exhibit rapid mobility
within the nucleus (19 –22). In one case it was suggested from these
results that some nuclear proteins undergo a transient, high flux
association with their substrates (19). Whether these observations are
applicable to Ku is unknown. Importantly, understanding the dynamics of Ku would provide important information regarding the kinetics
of its association with DNA breaks and the repair reaction that
follows.
To study the dynamics of Ku in cell nuclei, fluorescence photobleaching experiments were performed using cells expressing a
green fluorescent protein (GFP) fusion construct of either Ku70 or
Ku86. These results show Ku is highly mobile in cell nuclei, yet
exhibits a diffusion coefficient that is significantly less than that
predicted based from its size. The observed mobility of Ku includes its association with the nuclear matrix and DSBs generated
by ionizing radiation. Together, these results show that Ku undergoes a transient, high flux association with its substrates. Furthermore, by coassociating with DSBs and the nuclear matrix, Ku
could function to tether free ends of DNA to the nuclear matrix for
repair of the DNA lesion.
0022-1767/02/$02.00
Downloaded from http://www.jimmunol.org/ by guest on August 2, 2017
The autoantigen Ku, composed of subunits Ku70 and Ku86, is necessary for repair of DNA double-strand breaks by nonhomologous end joining. Similarly, Ku participates in repair of DNA double-strand breaks that occur during V(D)J recombination, and
it is therefore required for the development of B and T lymphocytes. Although previous studies have identified the DNA-binding
activities of Ku, little is known concerning its dynamics, such as the mobility of Ku in the nucleus and its rate of association with
substrates. To address this question, fluorescence photobleaching experiments were performed using HeLa cells and B cells
expressing a green fluorescent protein (GFP) fusion construct of either Ku70 or Ku86. The results show that Ku moves rapidly
throughout the nucleus even following irradiation of the cells. However, the rate of diffusion of Ku was ⬃100-fold slower than that
predicted from its size. Association of Ku-GFP with a filamentous nuclear structure was also evident, and nuclear extraction
experiments suggest that this represents nuclear matrix. A central domain of Ku70 containing its DNA-binding and heterodimerization regions and its nuclear localization signal shows that this alone is sufficient for the observed mobility of Ku70-GFP and its
association with nuclear matrix. These data suggest the mobility of Ku is characterized by a transient, high flux association with
nuclear substrates that includes both DNA and the nuclear matrix and may represent a mechanism for repair of double-strand
breaks using the nuclear matrix as a scaffold. The Journal of Immunology, 2002, 168: 2348 –2355.
The Journal of Immunology
Materials and Methods
Gene construction
Cell culture and protein expression
HeLa and 293T cells were grown in DMEM supplemented with antibiotics
and 10% FBS. Ramos, Daudi, Raji, and A20 cells were grown in RPMI
1640 supplemented with antibiotics and 10% FBS. All cells were maintained at 37°C in the presence of 5% CO2.
Before transfection, HeLa cells were seeded at 6.0 ⫻ 105 cells onto a
coverslip in a 3.5-cm dish the day before the experiment. The cells were
transfected using lipid carrier (Superfect; Qiagen, Valencia, CA) with 5 ␮g
of plasmid DNA. In experiments using 293T cells, 10-cm plates were
seeded with 7.5 ⫻ 106 cells 12 h before transfection. The cells were transfected using CaPO4 (Invitrogen, Carlsbad, CA) and 25 ␮g of plasmid DNA
for each plate. All remaining cell lines were transfected by electroporation
(Bio-Rad Gene Pulser II; Bio-Rad, Hercules, CA) using 107 cells, 25 ␮g of
plasmid DNA, and settings of 330 V and 960 ␮F. In experiments including
immunofluorescence staining, the samples were prepared as previously described (26).
Cell lysis, immunoprecipitation, and immunoblotting
All steps were performed at 4°C. Transfected 293T cells were washed
twice with PBS and lysed using 750 ␮l of a 10 mM NaCl, 3 mM MgCl2,
and 10 mM Tris (pH 7.4) buffer (RSB) containing 0.5% Triton X-100
(TX-100), 1.0 mM PMSF, and 100 kallikrein units of aprotinin. After 10
min in lysis buffer, the samples were centrifuged for 5 min at 4000 rpm
using a desktop centrifuge (Brinkman, Westbury, NY). The pellet containing intact nuclei was suspended in 500 ml of 150 mM NaCl, 1 mM EDTA,
20 mM Tris (pH 8.0), 0.1% TX-100, 10% glycerol, 1.0 mM PMSF, and
100 kallikrein units of aprotinin, and the nuclei were lysed by sonication.
The lysate was centrifuged, and the supernatant was removed and immunoprecipitated using an mAb specific for the Ku70/Ku86 heterodimer (Santa Cruz Biotechnology, Santa Cruz, CA). Pansorbin (Calbiochem, San Diego, CA) was used as a solid phase for the immunoprecipitations. The
immunoprecipitates were washed twice with 10 mM Tris (pH 8.0), 150
mM NaCl, and 5 mM EDTA containing 0.10% TX-100, and eluted using
SDS-PAGE sample buffer (27). The samples were separated by gel electrophoresis and detected by immunoblotting using a mAb to GFP (Covance
Research Products, Richmond, CA) as the first step. A biotinylated horse
Ab to mouse (Vector Laboratories, Burlingame, CA) and streptavidin-conjugated HRP (Vector Laboratories) were used as the second and third steps,
respectively. The membranes were developed using ECL (Amersham Pharmacia Biotech, Piscataway, NJ).
Nuclear matrix preparation
Cell nuclei were prepared by lysing cells in RSB by Dounce homogenization (20 –30 strokes). The lysate was sedimented and suspended in RSB
containing 0.25 M sucrose and 1 mM PMSF. Nuclei were separated from
cell debris by sedimenting through a 2 M sucrose layer (75,000 ⫻ g for 30
min). The resulting pellet was then suspended in RSB containing 0.25 M
sucrose and 1 mM CaCl2 and digested with 25 ␮g of DNase I (Roche,
Nutley, NJ) for 2 h at room temperature. Following DNase I treatment, the
sample was extracted with high salt buffer by suspending in RSB containing 2 M NaCl and 10 mM EDTA and incubating at 0°C for 10 min. The
sample was sedimented, washed with RSB containing 0.25 M sucrose, and
then suspended in SDS-PAGE sample buffer. The samples were separated
by SDS-PAGE and immunoblotted with the indicated Abs. Goat antiserum
to Ku70, Ku86, and lamin B were purchased from Santa Cruz Biotechnology. mAb to phospho-RNA polymerase II (matrin 250) was purchased
from Upstate Biotechnology (Lake Placid, NY). Biotinylated Ab to mouse
or goat Ig was purchased from Vector Laboratories.
Fluorescence microscopy
Image acquisition. Images were collected using a Leica TCS laser scanning confocal microscope (William K. Warren Medical Research Institute,
Oklahoma City, OK). GFP was excited at 488 nm, and Texas Red (TR) at
568 nm. Emission wavelengths between 530 and 560 nm were collected for
GFP imaging, and emission wavelengths between 600 and 660 nm were
collected for TR imaging. In double-labeling experiments, GFP and TR
fluorescence were collected simultaneously in separate channels.
Fluorescence recovery after photobleaching (FRAP) measurements.
Image analysis was performed using IP Lab Spectrum software (Scanalytics, Vienna, VA). Curve fitting for determining recovery values was performed using IGOR software (WaveMetrics, Palo Alto, CA). Protein mobility was measured as described previously (19). In brief, a region of the
nucleus was photobleached using a brief (0.5 s) pulse of the 488-nm line
of an argon laser at 100% power. Recovery of fluorescence within the
bleached region was monitored by collecting a frame every 1.7 s. The
amount of recovery at each time point was measured by determining the
average fluorescence intensity in the bleached region. The recovery values
were normalized using the equation: R ⫽ (AoIt)/(AtIo), where Ao is the total
intensity of the nucleus in the prebleach image, At is the total intensity of
the nucleus at time point t, Io is the average intensity of the bleached region
in the prebleach image, and It is the average intensity of the bleached
region at time point t. R therefore represents the ratio Ft:Fo corrected for
the decay in the fluorescence signal due to collection of the images during
the experiment (19), where Ft represents the average fluorescence intensity
of the spot at each time t, and Fo is the average fluorescence intensity of
this region in the prebleach image.
Fluorescence loss induced by photobleaching (FLIP) measurements. Intranuclear exchange of protein was measured by photobleaching a region
of the nucleus with a 5-s pulse of laser (488-nm line of an argon laser at
100% power). Each pulse was followed by image acquisition. Photobleaching and image acquisition were repeated until the entire fluorescence signal
was extinguished. The same region was photobleached in each pulse. The
ratio of the average fluorescence intensity of the nucleus at each time point
divided by its average intensity in the prebleach image was plotted vs time
to represent the rate of decay of fluorescence signal during the FLIP
experiment.
Results
Ku70- and Ku86-GFP molecules dimerize with endogenous
protein
Ku is functional only as the Ku70/86 heterodimer (10). Consequently, for Ku70- and Ku86-GFP to be faithful reporters of Ku
activity, each must dimerize with endogenous protein when separately expressed in transfected cells. To determine whether Ku70and Ku86-GFP dimerize with endogenous protein, nuclei from
cells transfected with either GFP construct were lysed and immunoprecipitated using a mAb that recognizes only the Ku70/Ku86
heterodimer. The immunoprecipitates were separated by SDSPAGE, and Ku70- or Ku86-GFP was detected by immunoblotting
with an Ab specific for GFP. Fig. 1A shows that both Ku70- and
Ku86-GFP are immunoprecipitated in this manner, showing that
Ku70- or Ku86-GFP associate with endogenous Ku.
To compare the cellular localization of Ku70- and Ku86-GFP
with that of Ku, HeLa cells expressing either Ku70-GFP (Fig. 1B,
top) or Ku86-GFP (Fig. 1B, bottom) were fixed and immunostained with the heterodimer-specific Ab. The Ku70/86 complex
was detected using a TR-conjugated secondary Ab specific for
mouse Ig (␣Ku70/86-TR). Fig. 1B shows that intranuclear localization of Ku70- and Ku86-GFP is identical to that of the Ku70/86
Downloaded from http://www.jimmunol.org/ by guest on August 2, 2017
Ku70- and Ku86-GFP constructs were generated using the GFP cloning
and expression vector pWay20 (23). This vector contains a SmaI site immediately upstream of and in-frame with enhanced GFP (CLONTECH
Laboratories, Palo Alto, CA) and a stop codon at the 3⬘ end of enhanced
GFP. The fusion genes were therefore constructed by subcloning blunt end
PCR products into the SmaI site of pWay20. A CMV promoter drives the
expression of the gene products.
Ku70 and Ku86 were amplified using the following oligonucleotides as
primers for the PCR: Ku70, coding, AGAATGTCAGGGTGGGAGTC;
Ku70, noncoding, GTTCTCGAGGTTGTTGTTGTTGTTGTCCTGGAAG
TGCTTGG; Ku86, coding, AGAATGGTGCGGTCGGGGA; and Ku86,
noncoding, GTTCTCGAGGTTGTTGTTGTTGTTTATCATGTCCAATA
AATCGT. The underlined residues represent the start codon encoded in
each coding primer. A second Ku70-GFP construct containing residues
255–550 was constructed using the following primers for amplification:
coding, ACATCATCTAGAATGCTCAACAAAGATATAGTGAT; noncoding: TCTAGTGAATTCGTTGTTGTTGTTGTTCTTGGGCCTTTTG
CTTCCAG. The underlined residues again indicate the start codon. The
residues in bold indicate an XbaI and EcoRI site encoded in the coding and
noncoding primers, respectively, for subcloning the PCR fragment upstream of GFP using a previously described vector (24). Each of the
noncoding primers contains a polyglutamine insert between the C terminus of the Ku subunit and the N terminus of GFP. This was added to
enhance folding of the separate protein domains. Glutamine was used
for this purpose because it has the lowest propensity for forming secondary structures (25).
2349
2350
HIGH MOBILITY OF KU IN CELL NUCLEI MEASURED USING FRAP
heterodimer. For example, the similarity of the distributions of the
Ku-GFP molecules with that of the heterodimer is illustrated by
the merge images where the overlap is indicated by yellow. Fig. 1
shows that both Ku70- and Ku86-GFP efficiently associate with
endogenous protein and are therefore faithful reporters of
endogenous Ku.
Ku70- and Ku86-GFP are highly mobile in cell nuclei
To measure the mobility of Ku in cell nuclei, FRAP was measured
in cells expressing either Ku70- or Ku86-GFP. Experiments measuring FRAP consist of first photobleaching a small region of the
nucleus by a brief (0.5-s) laser pulse. Recovery of fluorescence by
diffusion of protein into the bleached region is measured by acquiring images of the sample following the initial photobleaching.
Two separate photobleaching experiments that were performed
using HeLa cells expressing Ku70-GFP are shown in Fig. 2A and
in Supplements 1 and 2.4 In Fig. 2A, the green circle indicates the
region that was photobleached in each experiment, and the images
were acquired at the indicated times. In the top panel, the sample
was untreated before photobleaching, and complete recovery of the
fluorescence signal occurred by ⬃17 s. However, the sample in the
bottom panel of Fig. 2A was fixed before the FRAP experiment. In
this case, the bleached region remains void of fluorescence even
after the recovery is complete in the untreated sample. This difference in mobility between the untreated and the fixed sample is
also indicated by the recovery curves plotted in Fig. 2B. Furthermore, a region in the fixed sample the same size as that shown in
Fig. 2A but outside of the bleach spot had a normalized fluorescence value close to 1.0 for all time points (data not shown). Thus,
the lack of recovery in the fixed sample is not due to quenching of
fluorescence by fixation. Experiments with cells expressing Ku86GFP showed it has a mobility similar to that of Ku70-GFP (Supplement 3). These results therefore show Ku-GFP is mobile in cell
nuclei and fixing the samples inhibits this mobility.
To quantitate the mobility of Ku70-GFP and Ku86-GFP, the
recoveries were fitted to the monoexponential function Ft/F0 ⫽
4
The on-line version of this article contains supplemental material.
FIGURE 2. FRAP measurements of HeLa cells expressing either Ku70or Ku86-GFP. A, FRAP experiments with HeLa cells expressing Ku70GFP. Only the nucleus of each cell is evident. The green circles indicate the
regions that were photobleached. The cell in the bottom panel was fixed
with 2% paraformaldehyde before the FRAP experiment. Frames were
collected at the indicated times. B, A plot of the normalized fluorescence
intensity values vs time of each FRAP experiment in A. The average fluorescence intensity within the photobleached region was measured in each
frame and normalized using the equation. The lines represent the fitted
curves of each experiment. The thick and thin lines represent the untreated
and fixed samples, respectively. C, The time constants and recovered fractions measured in populations of HeLa cells expressing either Ku70- or
Ku86-GFP. The histograms on the left represent data from cells expressing
Ku70-GFP, and those on the right are from cells expressing Ku86-GFP.
F⬁ ⫹ F1 ⫻ e(⫺t/␶), where F⬁ represents the fraction of recovery at
infinite time and indicates the mobile fraction of the molecule in
the bleached region or, inversely, its immobile fraction. ␶ is the
time constant for recovery, and it is inversely proportional to the
diffusion coefficient. Histograms of the time constants and percent
recoveries measured in populations of HeLa cells expressing either
Ku70- or Ku86-GFP are shown in Fig. 2C. Significantly, each
histogram is unimodal in character, thus showing that all the cells
in the samples exhibit a similar mobility.
The histograms in Fig. 2C correspond to an average time constant of ⬃6 s for both Ku70-GFP and Ku86-GFP (Table I). Furthermore, the diffusion coefficient (D) was calculated for each experiment using the change in the Gaussian profile of the bleach
spot with time (28, 29). By this method, it was determined that the
recoveries of Ku70-GFP and Ku86-GFP correspond to a diffusion
coefficient of ⬃0.35 ␮m2s⫺1. This is similar to that measured for
GFP fusion constructs of other proteins that function in the nucleus
(19 –21) and represents a diffusion coefficient nearly 200-fold less
than that of GFP alone in the nucleus (30). This observed difference in the mobility of GFP and Ku-GFP cannot be accounted for
Downloaded from http://www.jimmunol.org/ by guest on August 2, 2017
FIGURE 1. Measurement of association of Ku70- and Ku86-GFP with
endogenous subunits of Ku heterodimer. A, Nuclei of 293 T cells expressing either Ku70- or Ku86-GFP were collected, lysed, and immunoprecipitated with an mAb that recognizes the Ku heterodimer. The immunoprecipitate was separated by 7.5% SDS-PAGE, and the GFP fusion proteins
were detected by immunoblotting with Ab specific for GFP. The predicted
sizes of Ku70- and Ku86-GFP are 102 and 112 kDa, respectively. Molecular weights (in thousands) are indicated on the left. Ig represents crossreaction with the Ab used for the immunoprecipitation. B, Confocal images
of HeLa cells expressing either Ku70-GFP (top) or Ku86-GFP. The samples were immunostained with an mAb that recognizes the Ku heterodimer
and TR-conjugated secondary Ab (␣Ku70/86-TR). Each set of panels
shows the nuclei from two separate cells. White bar, 5 ␮m.
The Journal of Immunology
2351
Table I. Time constants and recovered fractions measured in populations of the indicated cell lines
Ku70-GFP
HeLa
HeLa, 10°C
Raji
A20
Ku86-GFP
␶
% Recovery
n
␶
% Recovery
n
6.0 ⫾ 2.5
4.6 ⫾ 2.7
6.2 ⫾ 3.0
4.2 ⫾ 1.9
91 ⫾ 7
94 ⫾ 7
91 ⫾ 9
98 ⫾ 3
49
24
15
9
5.8 ⫾ 2.3
ND
5.7 ⫾ 3.7
ND
94 ⫾ 8
ND
90 ⫾ .09
ND
30
the wortmannin plus irradiation sample is slightly slower than that
of the sample treated with wortmannin alone. This difference may
reflect a small increase in the lifetime of Ku70-GFP in complex
with nuclear substrates such as DSBs. However, these results show
that Ku is not sequestered by DSBs, since the amount of recovery
is unchanged following irradiation. Thus, the fluorescence recoveries in the irradiated cells are consistent with our interpretation of
the FRAP experiments in Fig. 2 that Ku exhibits a transient association with its nuclear substrates. Such a transient association of
nuclear proteins with their substrates has been reported for other
molecules based on the results from FRAP experiments (19, 21).
The entire nuclear pool of Ku is mobile
Both Ku70-GFP and Ku86-GFP exhibit ⬃95% recoveries in the
FRAP experiments. This demonstrates that essentially the entire
pool of either subunit within the bleached region is mobile. To
determine whether the entire nuclear pool of Ku shares this characteristic, FLIP experiments were performed using HeLa cells expressing either Ku70-GFP or Ku86-GFP. In the FLIP experiments
the sample is repeatedly photobleached with pulses of longer duration (5 s). Decay of total fluorescence signal is measured by
acquiring an image of the sample between each photobleaching
pulse (31). Thus, FLIP experiments measure the diffusion of fluorophore from all regions of the nucleus into the path of the
laser beam.
An example of a FLIP experiment performed using HeLa cells
expressing either Ku70-GFP or GFP alone is shown in Fig. 3A. In
the case of the cell expressing Ku70-GFP, only the nucleus is
evident. Both the nucleus and cytoplasm are labeled in the cell
expressing GFP. In each experiment the region indicated by the
green circle was bleached using laser pulses 5 s in duration. In the
cell expressing GFP alone, fluorescence from the nucleus is
quickly bleached. Bleaching of the remaining signal in the cell
Table II. Time constants and recovered fractions measured in
populations of the indicated cell linesa
Ku70-GFP
HeLa, 30 min
post-IRb
HeLa, 6 h
post-IR
HeLa, 20 ␮M
wortmannin
HeLa, 20 ␮M
wortmannin
post-IR
␶
% Recovery
n
5.6 ⫾ 2.1
92 ⫾ 7
21
6.6 ⫾ 2.5
94 ⫾ 6
58
4.0 ⫾ 2.1
92 ⫾ 6
6
7.9 ⫾ 2.0
91 ⫾ 7
7
a
Irradiated samples were exposed to 20 Gy of gamma radiation. Samples treated
with wortmannin were pretreated with the compound for 1 h prior to the FRAP
measurements.
b
IR, Irradiation.
Downloaded from http://www.jimmunol.org/ by guest on August 2, 2017
by size alone (⬃200 kDa for the Ku-GFP heterodimer vs 27 kDa
for GFP alone). For example, the ⬃8-fold difference in size between Ku-GFP and GFP corresponds to a 2-fold difference in molecular volume (assuming a spherical protein) (31). Thus, Ku70GFP diffuses ⬃2 orders of magnitude slower than that predicted
based on its volume relative to that of GFP alone. One mechanism
for this slower than predicted mobility of Ku70- and Ku86-GFP is
a transient association of Ku with other molecules in the nucleus.
To measure the effect of lowering the temperature of the sample
on the mobility of Ku-GFP, FRAP experiments were performed at
10°C rather than 37°C. Both the rate and amount of recovery of Ku
are similar at 10°C to that measured at 37°C (Table I), and this
occurs despite temperature-dependent changes in the diffusion coefficient, viscosity, and perhaps composition of the nucleus. One
possible explanation is that the difference in temperature is not
great enough to affect these parameters. For example, the diffusion
coefficient and viscosity of the sample depends upon the absolute
temperature of the sample (31). The change from 37 to 10°C represents a 10% decrease in the absolute temperature, and this is less
than the resolution of these measurements (SD ⫽ 2.7 s). Conversely, ATP-dependent mobility would probably be inhibited in
this experiment. Thus, these data are consistent with the idea that
the recoveries of Ku-GFP occur by diffusion rather than active
transport within the nucleus.
In developing lymphocytes, Ku functions in repair of DSBs that
occur as a consequence of V(D)J recombination (15, 18). To determine whether Ku exhibits a similar mobility in B cells as in
HeLa cells, FRAP experiments were performed using Raji and
A20 B cells expressing either Ku70- or Ku86-GFP. These results
are summarized in Table I, and they show that both the time constant and the recovered fraction of Ku70- and Ku86-GFP in B cells
are similar to those measured in HeLa cells. Thus, the mobility of
Ku measured in HeLa cells is not restricted to this cell type, but
also includes B cells.
Ku binds to the free ends of DNA (8 –10), and genetic studies
have shown that it is required for DSB repair following irradiation
(13, 15, 32). To determine whether generation of DSBs affects the
mobility of Ku proteins, FRAP experiments were performed using
gamma-irradiated HeLa cells expressing Ku70-GFP. Table II summarizes the results of these measurements and shows that there is
no significant change in the rate or amount of recovery of Ku70GFP at either 30 min or 6 h postirradiation compared with untreated cells (Table I). This result suggests that Ku does not form
a complex with DSBs that results in changes in its mobility. However, another interpretation of these data is that DSB repair is
complete by 30 min. For example, genetic studies have shown that
some forms of NHEJ occur with a half-time of minutes, and that
this is a DNA-PKCS-dependent pathway (33). To determine
whether the failure to detect changes in the mobility of Ku following irradiation was due to rapid repair of DSBs, cells were
pretreated with wortmannin before irradiation to inhibit DNAPKCS-dependent DSB repair. The results of this experiment are
also summarized in Table II and show that the rate of recovery of
14
2352
HIGH MOBILITY OF KU IN CELL NUCLEI MEASURED USING FRAP
cells in Fig. 3A, and Ku70-GFP is seen to associate with a filamentous structure within the nucleus. The yellow lines that are
overlaid on the image on the left illustrate this. The filament-associated Ku is brighter than the adjacent regions within the nucleus. This suggests that Ku is transiently inhibited from diffusing
into the bleach spot during the FLIP experiment due to association
with the nuclear filaments. In contrast to the cell expressing Ku70GFP, the entire nucleus of the cell expressing GFP is photobleached uniformly, and no filamentous network is apparent.
These results show that association of Ku70-GFP with nuclear
structures occurs in a specific manner.
Ku associates with nuclear matrix through the Ku70 subunit
FIGURE 3. FLIP experiments of cells expressing either Ku70-GFP or
GFP alone. A, Two separate nuclei of cells expressing Ku70-GFP (top) or
GFP (bottom) alone are shown. A FLIP experiment was performed by
photobleaching the region indicated by the green circle for 5-s intervals. B,
A plot of the decay of the fluorescence signal of each nucleus in A with
time. Ku70-GFP is similar to GFP in that its signal is completely bleached
during the experiment, thus demonstrating complete mobility within the
time frame of the experiment. C, In an image collected after 10 s of photobleaching in each experiment in A Ku70-GFP appears localized with a
filamentous structure within the nucleus (left), but GFP alone does not. The
Ku70-GFP images are identical, except that the yellow lines were added to
the image on the left to indicate the observed filaments.
occurs as GFP diffuses into the nucleus from the cytoplasm. Similar to GFP, Ku70-GFP in the nucleus is also entirely photobleached, and this occurs in ⬃1 min. These results are also illustrated by the fluorescence decay curves in Fig. 3B. Importantly, in
cases where a second cell expressing Ku70-GFP was adjacent to
the cell that was photobleached, negligible photobleaching occurred in the adjacent cell (Supplement 4). Thus, the fluorescence
decay is due specifically to photobleaching during the FLIP experiment. Efficient bleaching of the nuclear fluorescence also occurred in samples that were pretreated with wortmannin and irradiated before the FLIP experiment (Supplement 5). This result is
consistent with FRAP measurements showing that Ku exhibits
similar fluorescence recoveries in irradiated and untreated cells.
Together the FLIP experiments show that the entire nuclear pool of
Ku molecules is mobile, such that it is able to transverse the nucleus in ⬃1 min even in the presence of DSBs.
Despite the similarity in the photobleaching of Ku70-GFP and
GFP alone, each also displayed distinct properties during the
course of the FLIP experiments. For example, Fig. 3B shows that
Ku70-GFP fluorescence decayed at a slower rate than GFP alone.
Furthermore, Fig. 3C shows higher magnification images of the
FIGURE 4. Characterization of Ku in the nuclear matrix fraction. A,
The nuclear matrix fraction of transfected 293T cells was prepared and
separated by 7.5% SDS-PAGE. Ku70-GFP was detected by immunoblotting with Ab that recognizes GFP. B, HeLa cells were fixed and costained
with an Ab that recognizes Ku and an Ab specific for matrin 250. Ku and
matrin 250 were detected using fluorescein- and TR-conjugated secondary
Abs, respectively. The arrowheads indicate filamentous regions that are
coenriched with Ku and matrin 250. C and D, The nuclear matrix fraction
was prepared using HeLa cells (C) and the indicated B cell lines (D). Each
prepared nuclear matrix fraction was immunoblotted with Ab to Ku70 and
Ku86. The fraction from HeLa cells was also immunoblotted with Ab to
lamin B. An equivalent amount of material was loaded in each lane in C
and D. D, WCL represents whole cell lysate prepared from Raji cells.
Molecular weights (in thousands) are indicated on the left.
Downloaded from http://www.jimmunol.org/ by guest on August 2, 2017
The Ku-associated filaments evident in Fig. 3 are also similar in
appearance to nuclear matrix visible by immunostaining of DNasetreated nuclei (34). Furthermore, Ku70-GFP is present in the nuclear matrix fraction of transfected 293T cells (Fig. 4A), and endogenous Ku colocalizes with the matrix-associated protein matrin
250 (35) (Fig. 4B). Fig. 4C shows that endogenous Ku70 is present
with the matrix marker lamin B (36) in the nuclear matrix fraction
prepared from HeLa cells that had not been transfected. Interestingly, Ku86 is not present in the matrix fraction. Furthermore,
The Journal of Immunology
Ku70, but not Ku86, is present in the nuclear matrix fraction of the
B cell lines Raji, Daudi, and Ramos (Fig. 4D). These results suggest Ku associates with the nuclear matrix through the Ku70 subunit alone and that Ku86 is removed during preparation of the
nuclear matrix fraction.
The central domain of Ku70 has properties similar to those of
full-length Ku70
Ku70 contains a core region consisting of residues 255– 450 that is
sufficient for heterodimerization with Ku86, binding to DNA ends,
and DSB repair (32). Furthermore, residues 535–550 contain the
FIGURE 6. A model for DSB repair by simultaneous binding of Ku to the DSB and nuclear matrix. Ku coassociates with DSB and
nuclear matrix, thereby allowing the matrix to
serve as a scaffold for further assembly of
DNA repair enzymes, including DNA-PKCS
and the DNA ligase IV/XRCC4 complex. Association of Ku with DSB and nuclear matrix
is transient (⬍20 s), but additional Ku molecules quickly replace it. Association of Ku
with the nuclear matrix occurs through the
Ku70 subunit alone.
nuclear localization signal of Ku70 (37). To compare the properties of a central domain (CD) of Ku70 containing its core and
nuclear localization signal with that of full-length protein, a GFP
fusion gene was constructed encoding residues 255–550 of Ku70
(Ku70CD-GFP).
Fig. 5A shows three separate HeLa cells that are expressing
Ku70CD-GFP, each of which demonstrates targeting of Ku70CDGFP to the nucleus (white arrowheads). Interestingly, Fig. 5A also
shows that Ku70CD-GFP is present in a membranous network
within the cytoplasm. This is not found with either Ku70- or Ku86GFP and may represent stable association of Ku70CD-GFP with a
compartment within the cytoplasm. To measure the association of
Ku70CD-GFP with endogenous Ku86, a nuclear lysate of transfected cells was immunoprecipitated with the dimer-specific Ab
described for Fig. 1. Coimmunoprecipitation of Ku70CD-GFP with
the Ku-specific Ab (Fig. 5B) shows that it associates with
endogenous Ku86.
To compare the mobility of Ku70CD-GFP with that of fulllength Ku70-GFP, FRAP measurements were preformed in parallel using HeLa cells expressing either Ku70CD-GFP or Ku70-GFP.
An example of a FRAP experiment using a HeLa cell expressing
Ku70CD-GFP is shown in Supplement 6. The average time constants measured for Ku70CD-GFP were 4.3 ⫾ 2.2 (n ⫽ 11) and
5.2 ⫾ 1.7 (n ⫽ 11) for the full-length protein. Similarly, the average fractional recovery of the samples was 0.95 ⫾ 0.09 for CD
and 0.93 ⫾ 0.12 for full-length proteins. These results show
Ku70CD-GFP and Ku70-GFP has a similar mobility within the
nucleus despite the fact that Ku70CD-GFP is approximately half
the size of the full-length protein.
To measure the association of Ku70CD-GFP with the nuclear
matrix, the matrix fraction was prepared using transfected 293T
cells. Fig. 5C shows that the matrix fraction contains core Ku70GFP, as detected by immunoblotting with Ab specific for GFP.
Downloaded from http://www.jimmunol.org/ by guest on August 2, 2017
FIGURE 5. Characterization of the central domain of Ku70. A, Confocal images of cells expressing Ku70CD-GFP. The arrowheads indicate the
nucleus of each cell. White bar, 5 ␮m. B, Nuclei from 293T cells expressing Ku70CD-GFP were lysed and immunoprecipitated with dimer-specific
Ab as described in Fig. 1. C, The nuclear matrix fraction of 293T cells
expressing Ku70CD-GFP was prepared as described in Fig. 4. In both B and
C, Ku70CD-GFP was detected in each experiment using GFP-specific Ab.
The predicted size of Ku70CD-GFP is 61 kDa. Molecular weights (in
thousands) are indicated on the left.
2353
2354
HIGH MOBILITY OF KU IN CELL NUCLEI MEASURED USING FRAP
Thus, the matrix-targeting domain of Ku70 occurs within its central domain, and it is therefore proximal to the region in Ku that
confers DSB repair activity.
Discussion
Acknowledgments
We thank B. Higgins and J. Zavzavadjian for their technical assistance, and
Drs. K. Rodgers and C. Webb for the helpful discussions.
References
1. Fugmann, S. D., A. I. Lee, P. E. Shockett, I. J. Villey, and D. G. Schatz. 2000.
The RAG proteins and V(D)J recombination: complexes, ends, and transposition.
Annu. Rev. Immunol. 18:495.
2. Dynan, W. S., and S. Yoo. 1998. Interaction of Ku protein and DNA-dependent
protein kinase catalytic subunit with nucleic acids. Nucleic Acids Res. 26:1551.
3. Dvir, A., S. R. Peterson, M. W. Knuth, H. Lu, and W. S. Dynan. 1992. Ku
autoantigen is the regulatory component of a template-associated protein kinase
that phosphorylates RNA polymerase II. Proc. Natl. Acad. Sci. USA 89:11920.
4. Gottlieb, T. M., and S. P. Jackson. 1993. The DNA-dependent protein kinase:
requirement for DNA ends and association with Ku antigen. Cell 72:131.
5. Grawunder, U., M. Wilm, X. Wu, P. Kulesza, T. E. Wilson, M. Mann, and
M. R. Lieber. 1997. Activity of DNA ligase IV stimulated by complex formation
with XRCC4 protein in mammalian cells. Nature 388:492.
6. Ramsden, D. A., and M. Gellert. 1998. Ku protein stimulates DNA end joining
by mammalian DNA ligases: a direct role for Ku in repair of DNA double-strand
breaks. EMBO J. 17:609.
7. Smith, G. C., and S. P. Jackson. 1999. The DNA-dependent protein kinase. Genes
Dev. 13:916.
8. Mimori, T., and J. A. Hardin. 1986. Mechanism of interaction between Ku protein and DNA. J. Biol. Chem. 261:10375.
9. Paillard, S., and F. Strauss. 1991. Analysis of the mechanism of interaction of
simian Ku protein with DNA. Nucleic Acids Res. 19:5619.
10. Ono, M., P. W. Tucker, and J. D. Capra. 1994. Production and characterization
of recombinant human Ku antigen. Nucleic Acids Res. 22:3918.
11. Ono, M., P. W. Tucker, and J. D. Capra. 1996. Ku is a general inhibitor of
DNA-protein complex formation and transcription. Mol. Immuno.l. 33:787.
12. Walker, J. R., R. A. Corpina, and J. Goldberg. 2001. Structure of the Ku heterodimer bound to DNA and its implications for double-strand break repair. Nature 412:607.
13. Gu, Y., S. Jin, Y. Gao, D. T. Weaver, and F. W. Alt. 1997. Ku70-deficient
embryonic stem cells have increased ionizing radiosensitivity, defective DNA
end-binding activity, and inability to support V(D)J recombination. Proc. Natl.
Acad. Sci. USA 94:8076.
14. Tai, Y. T., G. Teoh, B. Lin, F. E. Davies, D. Chauhan, S. P. Treon, N. Raje,
T. Hideshima, Y. Shima, K. Podar, and K. C. Anderson. 2000. Ku86 variant
expression and function in multiple myeloma cells is associated with increased
sensitivity to DNA damage. J. Immunol. 165:6347.
15. Zhu, C., M. A. Bogue, D. S. Lim, P. Hasty, and D. B. Roth. 1996. Ku86-deficient
mice exhibit severe combined immunodeficiency and defective processing of
V(D)J recombination intermediates. Cell 86:379.
Downloaded from http://www.jimmunol.org/ by guest on August 2, 2017
We report here experiments using GFP fusion constructs of Ku70
and Ku86 to measure the mobility of Ku in intact cell nuclei.
Together, FRAP and FLIP experiments show that Ku moves rapidly throughout the nucleus, and the entire nuclear pool of Ku
exhibits this mobility. However, quantitation of the recovery of Ku
in FRAP experiments shows that it has approximately a 100-fold
slower mobility than would be predicted based on its size alone.
One explanation for the observed mobility of Ku is that it is reduced due to association of Ku with nuclear substrates. These results are therefore consistent with the idea that Ku undergoes a
transient, high flux association with DNA and other nuclear structures as has been suggested for some nuclear proteins (19).
Previous studies have demonstrated that nuclear substrates for
Ku include free ends of DNA (8 –10) and telomeres (38 – 41). Our
results show the nuclear matrix represents another substrate for Ku
binding. Fig. 6 illustrates a model describing how association of
Ku with the nuclear matrix may represent a functionally significant
feature in its role in DSB repair. For example, Ku may serve to
tether the free ends of the DSBs to the nuclear matrix so that the
matrix can serve as a scaffold for further assembly of DNA repair
machinery. Based on the mobility of Ku, the Ku-DSB-nuclear matrix complex must have a half-life of ⬍10 s. However, if other
DNA repair enzymes exhibit the same mobility as Ku, then a shortlived complex of enzymes and DNA may be sufficient for repair of
the DSB. Evidence of a DNA-PK-dependent pathway for NHEJ
that has a half-time of minutes is consistent with this idea (33).
Alternatively, rapid replacement of Ku with additional Ku molecules may establish a steady-state assembly that has a lifetime
considerably longer than that of the dwell time of individual Ku
molecules.
One conclusion from the observation that Ku70, but not Ku86,
is present in the matrix fraction is that only the Ku70 monomer
associates with the nuclear matrix. However, a separate study has
shown that equivalent amounts of Ku86 are immunoprecipitated
with antiserum specific to either Ku70 or the Ku heterodimer, and
dimerization is necessary for efficient nuclear translocation of each
subunit (42). These results therefore indicate that nuclear Ku70
occurs as a heterodimer and that Ku associated with matrix does so
as a heterodimer of Ku70 and Ku86. The suggestion that Ku86 is
disassociated from Ku70 during preparation of the nuclear matrix
is not surprising, since 0.3 M NaCl is sufficient to disassociate the
Ku heterodimer in certain conditions (43).
A current model for DNA repair is that Ku initiates NHEJ by
binding DSBs and recruiting additional DNA repair enzymes (7).
The mobility exhibited by Ku in the nucleus indicates that it can
move rapidly throughout the nucleus in search of DSBs. This contrasts with the model that Ku is sequestered at telomeres until the
occurrence of DSBs, at which time it delocalizes from the telomeres to bind to the DNA lesions (44).
The rapid mobility exhibited by Ku and shared by other nuclear
enzymes of diverse structure and function (19 –22) implies that this
high mobility is a general feature of proteins that function in DNA
or RNA synthesis and processing. This observation suggests that
current opinion regarding the compartmentalization of the nucleus
is oversimplified. For example, previous studies using immunofluorescence staining have shown that replication and transcription
are associated with nuclear foci that appear in interphase nuclei
(45, 46). This has led to the idea that proteins that function in these
events are sequestered into stable, long-lived structures. However,
based on the results from mobility studies, another interpretation is
that the foci are composed of molecules that are rapidly exchanging with regions of the nucleus outside of the foci. Similar to this,
nucleoli have been shown to be composed of molecules that are
rapidly exchanging with the extranucleolar compartment (19, 21).
Some nuclear proteins do not share the rapid mobility of Ku. For
example, the histone protein H2B shows little recovery even as late
as 30 min postbleaching (19, 47, 48). Thus, while at least some
proteins are freely diffusing within the nucleus and forming shortlived complexes, others are forming a stable scaffold with little or
no flux from other regions of the nucleus. The nuclear matrix may
represent a similar type of low exchange structure within the nucleus. In contrast, it has been argued that the nuclear matrix is
merely an artifact arising from DNase treatment and salt extraction
of nuclei (49). However, Fig. 3, showing association of Ku70-GFP
with a filamentous network that also correlates with its occurrence
in the matrix fraction, argues that the matrix fraction is, in fact,
representative of a matrix structure in intact nuclei.
In summary, using fluorescence photobleaching to measure the
mobility of Ku, it was determined that Ku rapidly diffuses throughout the nucleus. In addition to this mobility, Ku exhibits association with the nuclear matrix, and we postulate that this may represent a mechanism for tethering DSBs to the nuclear matrix for
repair. Finally, the mobility exhibited by Ku and other nuclear
proteins suggests that nuclear architecture can be defined as a
structure composed of stable scaffolding molecules, among which
enzymes that mediate DNA and RNA synthesis and processing
rapidly diffuse and form transient interactions to complete their
function.
The Journal of Immunology
33. Wang, H., Z. C. Zeng, A. R. Perrault, X. Cheng, W. Qin, and G. Iliakis. 2001.
Genetic evidence for the involvement of DNA ligase IV in the DNA-PK-dependent pathway of non-homologous end joining in mammalian cells. Nucleic Acids
Res. 29:1653.
34. Wei, X., S. Somanathan, J. Samarabandu, and R. Berezney. 1999. Three-dimensional visualization of transcription sites and their association with splicing factor-rich nuclear speckles. J. Cell Biol. 146:543.
35. Mortillaro, M. J., B. J. Blencowe, X. Wei, H. Nakayasu, L. Du, S. L. Warren,
P. A. Sharp, and R. Berezney. 1996. A hyperphosphorylated form of the large
subunit of RNA polymerase II is associated with splicing complexes and the
nuclear matrix. Proc. Natl. Acad. Sci. USA 93:8253.
36. Luderus, M. E., A. de Graaf, E. Mattia, J. L. den Blaauwen, M. A. Grande,
L. de Jong, and R. van Driel. 1992. Binding of matrix attachment regions to lamin
B1. Cell 70:949.
37. Koike, M., T. Ikuta, T. Miyasaka, and T. Shiomi. 1999. The nuclear localization
signal of the human Ku70 is a variant bipartite type recognized by the two components of nuclear pore-targeting complex. Exp. Cell Res. 250:401.
38. Hsu, H. L., D. Gilley, E. H. Blackburn, and D. J. Chen. 1999. Ku is associated
with the telomere in mammals. Proc. Natl. Acad. Sci. USA 96:12454.
39. Hsu, H. L., D. Gilley, S. A. Galande, M. P. Hande, B. Allen, S. H. Kim, G. C. Li,
J. Campisi, T. Kohwi-Shigematsu, and D. J. Chen. 2000. Ku acts in a unique way
at the mammalian telomere to prevent end joining. Genes Dev. 14:2807.
40. Polotnianka, R. M., J. Li, and A. J. Lustig. 1998. The yeast Ku heterodimer is
essential for protection of the telomere against nucleolytic and recombinational
activities. Curr. Biol. 8:831.
41. Porter, S. E., P. W. Greenwell, K. B. Ritchie, and T. D. Petes. 1996. The DNAbinding protein Hdf1p (a putative Ku homologue) is required for maintaining
normal telomere length in Saccharomyces cerevisiae. Nucleic Acids Res. 24:582.
42. Koike, M., T. Shiomi, and A. Koike. 2001. Dimerization and nuclear localization
of Ku proteins. J. Biol. Chem. 276:11167.
43. Wang, J., M. Satoh, A. Pierani, J. Schmitt, C. H. Chou, H. G. Stunnenberg,
R. G. Roeder, and W. H. Reeves. 1994. Assembly and DNA binding of recombinant Ku (p70/p80) autoantigen defined by a novel monoclonal antibody specific
for p70/p80 heterodimers. J. Cell Sci. 107:3223.
44. Haber, J. E. 1999. Sir-Ku-itous routes to make ends meet. Cell 97:829.
45. Singer, R. H., and M. R. Green. 1997. Compartmentalization of eukaryotic gene
expression: causes and effects. Cell 91:291.
46. Strouboulis, J., and A. P. Wolffe. 1996. Functional compartmentalization of the
nucleus. J. Cell Sci. 109:1991.
47. Misteli, T., A. Gunjan, R. Hock, M. Bustin, and D. T. Brown. 2000. Dynamic
binding of histone H1 to chromatin in living cells. Nature 408:877.
48. Lever, M. A., J. P. Th’ng, X. Sun, and M. J. Hendzel. 2000. Rapid exchange of
histone H1.1 on chromatin in living human cells. Nature 408:873.
49. Pederson, T. 2000. Half a century of “the nuclear matrix.” Mol. Biol. Cell 11:799.
Downloaded from http://www.jimmunol.org/ by guest on August 2, 2017
16. Nussenzweig, A., C. Chen, V. da Costa Soares, M. Sanchez, K. Sokol,
M. C. Nussenzweig, and G. C. Li. 1996. Requirement for Ku80 in growth and
immunoglobulin V(D)J recombination. Nature 382:551.
17. Gu, Y., K. J. Seidl, G. A. Rathbun, C. Zhu, J. P. Manis, N. van der Stoep,
L. Davidson, H. L. Cheng, J. M. Sekiguchi, K. Frank, et al. 1997. Growth retardation and leaky SCID phenotype of Ku70-deficient mice. Immunity 7:653.
18. Manis, J. P., Y. Gu, R. Lansford, E. Sonoda, R. Ferrini, L. Davidson,
K. Rajewsky, and F. W. Alt. 1998. Ku70 is required for late B cell development
and immunoglobulin heavy chain class switching. J. Exp. Med. 187:2081.
19. Phair, R. D., and T. Misteli. 2000. High mobility of proteins in the mammalian
cell nucleus. Nature 404:604.
20. McNally, J. G., W. G. Muller, D. Walker, R. Wolford, and G. L. Hager. 2000.
The glucocorticoid receptor: rapid exchange with regulatory sites in living cells.
Science 287:1262.
21. Chen, D., and C. Huang. 2001. Nucleolar components involved in ribosome
biogenesis cycle between the nucleolus and nucleoplasm in interphase cells.
J. Cell Biol. 153:169.
22. Boisvert, F. M., M. J. Kruhlak, A. K. Box, M. J. Hendzel, and D. P. Bazett-Jones.
2001. The transcription coactivator cbp is a dynamic component of the promyelocytic leukemia nuclear body. J. Cell Biol. 152:1099.
23. Lo, W., W. Rodgers, and T. Hughes. 1998. Making genes green: creating green
fluorescent protein (GFP) fusions with blunt-end PCR products. BioTechniques
25:94.
24. Rodgers, W., and J. Zavzavadjian. 2001. Glycolipid-enriched membrane domains
are assembled into membrane patches by associating with the actin cytoskeleton.
Exp. Cell Res. 267:173.
25. Minor, D. L., Jr., and P. S. Kim. 1994. Measurement of the ␤-sheet-forming
propensities of amino acids. Nature 367:660.
26. Haaf, T., E. Raderschall, G. Reddy, D. C. Ward, C. M. Radding, and E. I. Golub.
1999. Sequestration of mammalian Rad51-recombination protein into micronuclei. J. Cell Biol. 144:11.
27. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature 227:680.
28. Yokoe, H., and T. Meyer. 1996. Spatial dynamics of GFP-tagged proteins investigated by local fluorescence enhancement. Nat. Biotechnol. 14:1252.
29. Sowa, G., J. Liu, A. Papapetropoulos, M. Rex-Haffner, T. E. Hughes, and
W. C. Sessa. 1999. Trafficking of endothelial nitric-oxide synthase in living cells:
quantitative evidence supporting the role of palmitoylation as a kinetic trapping
mechanism limiting membrane diffusion. J. Biol. Chem. 274:22524.
30. Houtsmuller, A. B., S. Rademakers, A. L. Nigg, D. Hoogstraten,
J. H. Hoeijmakers, and W. Vermeulen. 1999. Action of DNA repair endonuclease
ERCC1/XPF in living cells. Science 284:958.
31. Lippincott-Schwartz, J., E. Snapp, and A. Kenworthy. 2001. Studying protein
dynamics in living cells. Nat. Rev. Mol. Cell. Biol. 2:444.
32. Jin, S., and D. T. Weaver. 1997. Double-strand break repair by Ku70 requires
heterodimerization with Ku80 and DNA binding functions. EMBO J. 16:6874.
2355