Download Synaptonemal complex proteins - Journal of Cell Science

2749
Journal of Cell Science 107, 2749-2760 (1994)
Printed in Great Britain © The Company of Biologists Limited 1994
Synaptonemal complex proteins: occurrence, epitope mapping and
chromosome disjunction
Melanie J. Dobson*, Ronald E. Pearlman, Angelo Karaiskakis, Barbara Spyropoulos and Peter B. Moens†
Department of Biology, York University, Downsview, Ontario, M3J 1P3, Canada
*Present address: Department of Biochemistry, Faculty of Medicine, Dalhousie University, Halifax, Nova Scotia, B3H 4H7, Canada
†Author for correspondence
SUMMARY
We have used polyclonal antibodies against fusion proteins
produced from cDNA fragments of a meiotic chromosome
core protein, Cor1, and a protein present only in the
synapsed portions of the cores, Syn1, to detect the occurrence and the locations of these proteins in rodent meiotic
prophase chromosomes. The 234 amino acid Cor1 protein
is present in early unpaired cores, in the lateral domains of
the synaptonemal complex and in the chromosome cores
when they separate at diplotene. A novel observation
showed the presence of Cor1 axial to the metaphase I chromosomes and substantial amounts of Cor1 in association
with pairs of sister centromeres. The centromere-associated Cor1 protein becomes dissociated from the centromeres at anaphase II and it is not found in mitotic
metaphase centromeres. The extended presence of Cor1
suggests that it may have a role in chromosome disjunction
by fastening chiasmata at metaphase I and by joining sister
kinetochores, which ensures co-segregation at anaphase I.
Two-colour immunofluorescence of Cor1 and Syn1 demonstrates that synapsis between homologous cores is initiated
at few sites but advances rapidly relative to the establishment of new initiation sites. If the rapid advance of synapsis
deters additional initiation sites between pairs of homo-
logues, it may provide a mechanism for positive recombination interference. Immunogold epitope mapping of antibodies to four Syn1 fusion proteins places the amino
terminus of Syn1 towards the centre of the synaptonemal
complex while the carboxyl terminus extends well into the
lateral domain of the synaptonemal complex. The Syn1
fusion proteins have a non-specific DNA binding capacity.
Immunogold labelling of Cor1 antigens indicates that the
lateral domain of the synaptonemal complex is about twice
as wide as the apparent width of lateral elements when
stained with electron-dense metal ions. Electron
microscopy of shadow-cast surface-spread SCs confirms
the greater width of the lateral domain. The implication of
these dimensions is that the proteins that comprise the
synaptic domain overlap with the protein constituents of
the lateral domains of the synaptonemal complex more
than was apparent from earlier observations. This arrangement suggests that direct interactions might be expected
between some of the synaptonemal complex proteins.
INTRODUCTION
1992). In mammals, a number of SC-specific and SC-associated proteins have been identified (Heyting et al., 1987, 1988;
Smith and Benevente, 1992; Chen et al., 1992; Moens et al.,
1992; Moens and Earnshaw, 1989). In the absence of gene disruption experiments, their functions can be inferred indirectly
from known functions, e.g. topoisomerase II, from known
amino acid sequence motifs (Meuwissen et al., 1992), from
their location (Heyting et al., 1987), or from assays that detect
SC protein-protein or SC protein-DNA interactions. As these
characteristics become known for several SC proteins, a comprehensive picture of SC function can be assembled.
In an attempt to determine the occurrence and organization
of meiosis-specific chromosome proteins, we constructed a
cDNA expression library from hamster spermatocytes. This
library was screened with sera from rabbits and mice inoculated with hamster SCs to identify clones producing SC
antigens (Moens et al., 1992). Here we report characteristics
During early prophase of meiosis in most sexually reproducing organisms, each chromosome develops a longitudinal axial
core to which the chromatin loops are attached (Fig. 1). Subsequently, the cores of each pair of homologous chromosomes
become aligned in parallel, thereby forming the lateral
elements of the synaptonemal complex (SC). Later, the cores
separate while remaining attached at a few points, presumably
the sites of crossovers (von Wettstein, 1977; von Wettstein et
al., 1984). Meiotic functions of the SCs have been detected in
the yeast, Saccharomyces cerevisiae, where the Hop1 protein
of the lateral element facilitates between-homologue recombination (Hollingsworth et al., 1990), the Zip1 protein of the SC
functions in the pairing of homologues (Sym et al., 1993), and
topoisomerase II as a component of the SC functions in chromosome segregation at meiosis (Rose et al., 1990; Klein et al.,
Key words: synaptonemal complex, immunocytochemistry, cDNA
library, fusion protein, rodent spermatocyte, chromosome disjunction
2750 M. J. Dobson and others
ne
ch
co
tf
le
ce
Fig. 1. A diagrammatic representation of the conventional image of a
synaptonemal complex, SC. Meiotic prophase chromosome cores
(co) with the attached chromatin (ch) become parallel aligned during
chromosome synapsis and are then referred to as the lateral elements
(le) of the SC. There are transverse filaments (tf) between the lateral
elements and there is a median central element (ce). The SCs are
usually attached to the nuclear envelope (ne).
of two meiotic chromosome components whose encoding
cDNAs were isolated with this approach. The SYN1 gene
encodes a protein found only where the chromosome cores are
synapsed. Accordingly, this protein is named Syn1 (meiotic
chromosome Synaptic protein). The COR1 gene encodes a
product that is a component of the chromosome core in the
meiotic prophase chromosomes, referred to here as Cor1
protein (meiotic chromosome Core protein). In this report,
immunofluorescent and immunogold labelling are used to
determine the occurrence and locations of Syn1 and Cor1
antigens in rodent spermatocytes.
MATERIALS AND METHODS
cDNA library
The construction of a Syrian golden hamster (Mesocricetus auratus)
spermatocyte cDNA expression library has been reported previously
(Moens et al., 1992). Briefly, the library was constructed from the
poly(A)+ mRNA fraction of purified spermatocytes of young (25 day)
males in the λZap II vector (Stratagene, La Jolla, CA), and was
screened (Heyting and Dietrich, 1991) with SC-reactive serum from
two rabbits and a mouse that had been inoculated with purified
hamster SCs.
Because the sera could contain antibodies against antigens other
than meiotic chromosome proteins, the immunoreactive λ clones were
screened by affinity elution (Sambrook et al., 1989). The eluted antibodies were immune tested on spermatocytes in order to detect those
phage clones that have a cDNA insert that produces meiotic chromosome antigens. The inserts of choice were excised in vivo as Bluescript plasmids following the manufacturer’s protocol (Stratagene).
Double- and single-stranded DNA isolated from these Bluescript
plasmids or suitable subclones were sequenced in their entirety with
the dideoxy-chain termination method of Sanger et al. (1977).
Production of SC fusion proteins
Hamster SC antigens were produced in Escherichia coli by subcloning partial cDNAs in the expression vector pGEX-2T (Pharmacia)
to give a translational fusion of the cDNA fragment at the carboxyl
terminus of the glutathione S-transferase (GST) protein. Fusion
proteins derived from the SYN1 gene are named Syn1a, -b, etc. and
those derived from the COR1 gene are named Cor1a, -b, etc.
Expression of the fusion protein in these vectors is under the control
of the highly inducible tac promoter. Expression and purification of
the GST-SC fusion proteins were carried out according to the manufacturer’s protocol: transformed Escherichia coli cultures were grown
to an A600 of 0.7 in YT medium supplemented with 50 µg/ml ampicillin before gene expression was induced for 1 hour at 37°C by the
addition of 0.1 mM IPTG. Cultures were then chilled to 4°C,
harvested by centrifugation, washed with cold phosphate buffered
saline (PBS) and resuspended in cold PBS to which the following had
been added: 50 mM EDTA, 10 mM DTT, 0.5 mM PMSF, 0.5 µg/ml
leupeptin, 0.01 TIU/ml aprotinin. Triton X-100 was sometimes added
to the extraction buffer at a final concentration of 1% but it was not
found to aid the solubilization of any of the fusion proteins. Cells were
lysed by sonication and a freeze-thaw cycle. The lysed mixture was
centrifuged for 10 minutes at 4°C at 12,000 g. The supernatant from
this spin was taken as the soluble protein and the pellet was washed
a further time in the lysis buffer before being resuspended in lysis
buffer as the insoluble protein. For injection into mice or rabbits, the
insoluble protein from SC-positive bacterial extracts was washed
twice in cold PBS and resuspended in this same buffer at a concentration of 0.5 mg/ml.
Analysis of fusion proteins
Extracts of E. coli induced with IPTG and containing GST fusion
proteins were analysed for the presence of SC antigens by western
blotting. Soluble protein, insoluble protein or total protein were
separated by SDS-PAGE (Laemmli, 1970) in 10% running gels with
4% stacking gels and with a 29:1 (w/w), acrylamide:bisacrylamide
ratio. Of duplicate gels, one was stained with Coomassie Blue and
protein molecular masses were estimated from the relative mobilities
of standard proteins (Bio-Rad Low Molecular Weight Markers). The
duplicate gels had Amersham Rainbow Molecular Weight Markers
and they were transferred to nitrocellulose membranes for staining
with anti-SC antibodies by standard protocols (Sambrook et al.,
1989). Transfers were incubated with the primary anti-hamster SC
serum originally used to detect the SC-positive clones in the Stratagene λZap expression library. SC-positive bacterial extracts were
used to generate antibodies to fusion proteins in mice and rabbits.
Prior to use, the SC-positive serum from mice injected with bacterial
fusion proteins was incubated with E. coli extract (Promega) to
remove anti-E. coli antibodies. These primary antibodies were diluted
either 1/1000 or 1/3,000 in antibody dilution buffer (ADB) (10%, v/v,
goat serum; 3%, w/v, BSA; 0.05%, v/v, Triton X-100 in PBS).
Secondary antibody was a 1/3000 dilution of goat anti-rabbit or goat
anti-mouse conjugated to alkaline phosphatase and the positive
polypeptides were identified with the NBT-BCIP colour reaction
(Sambrook et al., 1989).
For Southwestern analysis, SDS-PAGE gels were electrophoresed
as usual, washed with gentle shaking for 30 minutes in a large volume
of transfer buffer (25 mM Tris, pH 8.3, 192 mM glycine, 20%
methanol) to remove the SDS and partially renature the proteins prior
to transfer to the nitrocellulose membrane. After transfer, filters were
washed twice for 15 minutes in blocking-binding-wash buffer, BBW
(3 g/l Ficoll, 3 g/l polyvinylpyrollidone, 10 mM NaCl, 20 mM Tris,
pH 8) and were then incubated with 32P-radiolabelled probe DNA
(1×108 cpm/µg) for 1 hour at room temperature in 1 ml of BBW at
107 cpm/ml as described by Mellor et al. (1985). Filters were subsequently washed for 2 hours at room temperature in BBW before being
exposed to X-ray film. Probes were end-labelled by a fill-in reaction
using Klenow polymerase according to Sambrook et al. (1989).
Binding was stable up to 100 mM NaCl.
Production of antibodies to fusion proteins
Mice and rabbits with SC-negative preimmune serum were inoculated
two or more times with a 1:1 mixture of 50 µg insoluble SC-positive
E. coli extract (inclusion bodies; Meuwissen et al., 1992) with
adjuvant per mouse per intraperitoneal injection, or 150 µg protein
extract with adjuvant per rabbit per subcutaneous injection. Cor1a
SC proteins 2751
protein extract proved toxic to mice at this level but was tolerated
when injections were reduced to 5 µg doses. To enhance antibody production, Syn1 fusion proteins were incubated with rabbit anti-SC
antibody for injection into rabbits and Cor1 fusion proteins with the
original mouse anti-SC antibody for injection into mice. The immune
sera were reacted with E. coli extract to remove anti-bacterial protein
antibodies. The immune sera were tested at dilutions of 1/1,000 and
1/10,000 on surface-spread hamster, rat and mouse testicular cells, on
cryosections of various body tissues, on western blots of spermatocyte nuclear proteins, and on western blots of bacterial extract
producing GST protein to assure specificity for meiotic chromosome
proteins.
Immunocytology
The procedures used for immunocytology of meiotic prophase chromosomes have been reported previously (Moens et al., 1987; Moens
and Earnshaw, 1989). Briefly, for epifluorescence microscopy, testicular cells collected in MEM were surface-spread on a hypotonic salt
solution, picked up on a glass multiwell slide, fixed in 1%
paraformaldehyde, pH 8.2, twice for 3 minutes, rinsed in 0.4% PhotoFlo wetting agent, pH 8.0, briefly air-dried, washed in PBS with 10%
ADB, and incubated with various primary antibodies on the individual wells overnight at 4°C. After washing, the material was exposed
to secondary antibody for 1 hour at 37°C or a few hours at 20°C. After
washing the material was covered with an antifading mounting agent
containing 5 ng/ml of DAPI or propidium iodide and a coverslip.
For electron microscopy, cells were picked up on plastic-coated
glass slides. Treatment with 1 µg/ml of DNase I in MEM for 20
minutes at 20°C was found to improve accessibility of SC antigens.
After immunostaining, the plastic film was floated off and EM grids
were placed on the film. Contrast was enhanced by post-fixation in
1% osmium tetroxide after the cells (on nickel grids) were thoroughly
dried for a day. For comparisons of SC dimensions in sectioned and
surface-spread spermatocytes, the same staining protocol was used for
both (saturated uranyl acetate, 10 minutes; lead citrate, 5 minutes).
Double labelling of SC antigens was performed using mouse serum
reactive with one of the antigens and rabbit serum specific for the
other. The secondary antibodies were conjugated with either FITC or
rhodamine for detection by epifluorescence or confocal microscopy.
For electron microscopy, the antigens were differentiated with 5 nm
and 15 nm gold-conjugated secondary antibodies. For anti-centromere
antibody, we used a 1/1000 dilution of the centromere positive serum
from a scleroderma (CREST) patient from a local rheumatology
clinic. Secondary antibody was goat anti-human FITC conjugated at
a 1/1000 dilution.
Epitope mapping
The positions of about 500 5-nm immunogold grains were determined
for each of the antibodies to the fusion proteins. Electron micrographs
were printed at a magnification of ×150,000 to ×170,000. The dimensions of the SC were measured at each gold grain position with a
digitizer and entered in a computer. The measurements include the
width of the osmium tetroxide-stained lateral elements, the total SC
width, and the position of the grain relative to the SC. The computations accumulated the gold grain position in 5 nm classes across an
SC of standardized size (40 nm wide lateral elements and an 80 nm
distance between them) (Moens et al., 1987). The distribution of
grains was printed as smoothed curves by Harvard Graphics software.
Shadow-casting
Surface-spread DNase-treated hamster spermatocytes on a plastic
film- (<80 nm) covered glass slide were exposed to platinum or goldpalladium evaporated in vacuum from a glowing tungsten wire at an
angle of about 7° to the plane of the slide. A fine grain was achieved
by placing the slide on a metal block at −80°C with some insulation
to delay cooling of the slide until the vacuum is established. The
plastic film was floated off the glass slide and recovered on EM grids.
Electron micrographs were printed at ×150,000 magnification and
width measurements were made with a digitizer.
RESULTS
SYN1 and COR1 cDNAs
Sequence analysis of the hamster cDNAs encoding Syn1a-d
fusion proteins (accession number L32978; Moens et al., 1992)
proved that these represent overlapping cDNAs of the hamster
homologue of the rat SCP1 gene that encodes a 125 kDa SC
protein (Meuwissen et al., 1992). The hamster and rat proteins
are 90% identical. We therefore adopt for Syn1 the numbering
of the SCP1 deduced amino acids and the designation of other
motifs. Our various cDNA clones of SYN1 are the result of
internal priming on A-rich sequences in the mRNA during the
construction of the library. Clones a to d correspond to clones
15, 14, 17 and 16, respectively, in the report on the isolation
of those clones (Table 1) (Moens et al., 1992).
Three co-terminal overlapping cDNAs encoding the hamster
meiotic chromosome core protein, Cor1, were isolated with the
following lengths, 680 bp (COR1a), 795 bp (COR1b) and 1070
bp (COR1c). The longest open reading frame in this cDNA
beginning at the first ATG and terminating with two adjacent
TGA codons (Fig. 2) encodes a putative 234 amino acid protein
with a predicted Mr of 27,134. This size is consistent with data
from western blots of hamster SC proteins in which the antiCor1a antibody reacts with a polypeptide of approximately 30
kDa molecular mass. The longest cDNA also contains 81 5′
untranslated nucleotides, 260 3′ untranslated nucleotides with
two potential poly A addition signals (AATAAA) and a poly
A tail. Northern hybridization analysis using COR1 cDNA as
probe, identifies an approximately 1150 nucleotide polyadenylated transcript in both hamster and rat. The predicted protein
is glutamine-rich (12% Q), most of the Q residues being in the
carboxyl-terminal half of the protein. Overall, the protein is
hydrophobic, with 34% hydrophobic residues, 18% basic and
15% acidic amino acids. A search of the PROSITE data base
(Bairock, 1992) indicates the Cor1 protein has a potential
ATP/GTP-binding site motif A (P-loop), potential cAMP- and
cGMP-dependent protein kinase C and casein kinase II phosphorylation sites, as well as potential N-myristoylation and
amidation sites. Significant similarity exists in both nucleotide
and amino acid sequence (40% identity) with a cDNA
encoding a 208 amino acid protein called pM1, a member of
an X-linked, lymphocyte-regulated family (XLR) of the mouse
(Siegel et al., 1987). The Cor1 protein also shows 16% identity
over a 203 amino acid stretch with skeletal muscle myosin
heavy chain, while the XLR family of proteins has similar
Table 1. Names and lengths of the Syn1 fusion proteins
Name
Nucleotides
Syn1e
Syn1d
Syn1f
Syn1c
Syn1b
Syn1a
Syn1g
292-927
403-1678
643-1678
1003-2235
1298-2235
1513-2286
2200-(A)n
Length
(bp)
653
1275
1035
1232
937
773
Amino acids
Old name
98-309
135-560
215-560
336-745
434-745
505-762
734-end
HSC16
HSC12
HSC17
HSC14
HSC15
2752 M. J. Dobson and others
identity with nuclear structural proteins lamins A and C, and
the structural protein mouse epidermal keratin II, members of
the intermediate filament family of proteins. Cor1 protein, like
myosin heavy chains, intermediate filament proteins and the
pM1 protein, is predicted to have regions of heptad repeats and
is therefore likely to form coiled-coil structures.
recognize a number of SC proteins including the 125 kDa Syn1
and 30 kDa Cor1 proteins (Fig. 3B lanes 6 and 7).
To determine whether the Syn1 protein might display DNA
binding activity, a western blot suitable for Southwestern
analysis was prepared from an SDS-PAGE gel on which
insoluble protein from E. coli expressing SYN1c, SYN1d and
GST had been electrophoresed. The transfer was incubated
with a 0.4 kb [32P]dATP-radiolabelled DNA fragment
excised from SCB9, a rat DNA sequence originally cloned on
the basis of its co-purification with rat SCs (Pearlman et al.,
1992) (Fig. 3C). The multiple bands in the Syn1c and -d lanes
correspond with immunoreactive labelled species in these
two extracts (Fig. 3A). GST and bands representing other
abundant E. coli proteins did not bind the radiolabelled DNA
probe. The data suggest that the SC Syn1 protein has DNA
binding capability. This binding capability, however, is not
sequence-specific, since other DNA sequences such as the
Syn1 and Cor1 fusion proteins
Syn1
We constructed translational fusion proteins in pGEX-2T from
four overlapping partial cDNA clones derived from the SYN1
gene. Analysis of the soluble, insoluble and total proteins from
the E. coli (DH5aF′) transformants by SDS-PAGE and western
blotting, shows that for all four, SC-antigenic material is
produced mainly in the insoluble fraction. Shown in Fig. 3A
is the total Coomassie-stained E. coli protein from strains
carrying the SYN1 fusion constructs: a (lane 1), d (lane 2), c
(lane 3); and from a strain carrying
the parental pGEX-2T vector (lane
CG
-80
4). The predicted full-length fusion
-1
proteins of 77 kDa (Syn1d, lane 2) CAAAGGCGCAGCCGGCTCAGAAGCGTCGAGGGAGCTGAGGCGTCGACCTCCGTCCCGGGCCGCTGAAGAAACTCTAAAG
and 75 kDa (Syn1c, lane 3); are ATG GTG CCT GGT GGA AGA AAG CAC TCT GGG AAA TCT GGG AAG CCA CCA CTG GTG GAT CAG
60
clearly visible as are a truncated 32 M V P G G R K H S G K S G K P P L V D Q
20
kDa Syn1a fusion protein (lane 1) and
GCT AAA ACA GCC TTT GAC TTT GAG AAA GAA GAT AAA GAA CTG AGT GGT TCA GAG GAG GAT
120
the 27 kDa GST protein (lane 4). A K T A F D F E K E D K E L S G S E E D
40
Lanes 5-8 are a western blot of lanes
1-4 visualized with antibody against GTT GCT GAT GAA AAG ACT CCA GTA ATT GAT AAA CAT GGA AAG AAA AGA TCT GGG GGA CTA 180
60
the fusion protein Syn1d produced in V A D E K T P V I D K H G K K R S G G L
E. coli. Two E. coli proteins of GTT GAA GAT GTG GGA GGT GAA GTA CAG AAT ATG CTG GAA AAA TTT GGA GCT GAC ATT AAC 240
80
approximately 73 and 37 kDa stain V E D V G G E V Q N M L E K F G A D I N
quite strongly with this and other AAA GCT CTT CTT GCC AAG AGA AAA AGA ATT GAA ATG TAT ACC AAA GCT TCT TTC AAA GCC 300
antibodies against fusion proteins, but K A L L A K R K R I E M Y T K A S F K A
100
this antibody does not recognize the
GST segment of the fusion proteins AGT AAC CAG AAA ATT GAG CAA ATT TGG AAA ACA CAA CAA GAA GAA ATA CAG AAG CTT AAC 360
S
N
Q
K
I
E
Q
I
W
K
T
Q
Q
E
E
I
Q
K
L
N
120
(Fig. 3A, lane 8). Other strongly
staining bands in lanes 5-7 represent AGT GAA TAT TCT CAG CAA TTT ATG AGT GTG TTG CAG CAG TGG GAA CTG GAT ATG CAG AAA 420
140
full-length or truncated Syn1 fusion S E Y S Q Q F M S V L Q Q W E L D M Q K
proteins. This is confirmed in the TTT GAG GAA CAA GGA GAA AAA CTA ACT AAT CTT TTT CGA CAA CAA CAG AAG ATT TTT CAG 480
western blot shown in Fig. 3A, lanes F E E Q G E K L T N L F R Q Q Q K I F Q
160
9 (pGEX-2T), 10 (Syn1c), 11
TCT AGA ATT GTT CAG AGC CAG AGA CTG AAA GCA ATC AAA CAG CTA CAT GAG CAG TTC
540
(Syn1d) and 12 (Syn1a), visualized CAG
Q
S
R
I
V
Q
S
Q
R
L
K
A
I
K
Q
L
H
E
Q
F
180
with anti-GST antibody. In protein
produced from an E. coli strain ATA AAG AAT TTG GAG GAT GTG GAG AAA AAT AAT GAT AAT CTA TTT ACT GGC ACA CAA AGT 600
200
carrying pGEX-2T, only the 27 kDa I K N L E D V E K N N D N L F T G T Q S
GST protein and an approximately 73 GAA CTT AAA AAA GAA ATG GCA ATG TTG CAA AAA AAA GTT ATG ATG GAA ACT CAG CAG CAA 660
220
kDa E. coli protein are visualized E L K K E M A M L Q K K V M M E T Q Q Q
(lane 9). Fusion proteins visualized GAG ATG GCA AAT GTT CGA AAG TCT CTT CAA TCC ATG TTA TTC TGA TGA GTCTTTGAAGAAAGA 723
by the anti-GST antibody (Fig. 3A, E M A N V R K S L Q S M L F * *
234
lanes 12, 11, 10) are the same as those
recognized by the anti-Syn1d fusion ACTTGAACCTATGTAATATATGATACAGTTAAAACATTATCTATGAGGCATGCCTATAGAAAGTATACTTTGAACTATA 802
protein antibody (Fig. 3A, lanes 5, 6, ACATTCATAACCATAGCTTGTTTAAGTGGAAGACTTCTGTTCCTGTTAACTTTTAAATAAAACTTAACAGCTGTATAAG 881
7), demonstrating that antibodies
against different epitopes of the TAGCAGCTATTTCAGTGTATCAAGCTTTCAACTCTTATAATAGTGAATTGTTTGCTACTATTGTGTCAATAAAAATGAT 960
fusion proteins recognize the same TTAAATTTA(A)n
969
fusion proteins. Antibodies against
the Syn1 fusion proteins also
Fig. 2. Nucleotide sequence of the cDNA encoding the hamster Cor1 (30/33 kDa) protein and the
recognize predominantly the 125 kDa derived amino acid sequence (single letter designation). The cDNA sequence (upper line) is 1050
Syn1 protein in western blots of nucleotides up to the first A in the poly A sequence. The derived amino acid sequence (lower line)
hamster testicular extracts (Fig. 3B, begins at the first M in the longest open reading frame and terminates with adjacent TGA codons
lanes 2-5) while the original sera used (*). A perfect match to a nucleotide (ATP/GTP) binding site motif A (P-loop) is underlined. The
to screen the cDNA libraries accession number for this sequence is X77371.
SC proteins 2753
A
Fig. 3. (A) SDS-PAGE (Coomassie Blue,
lanes 1-4) and western blots (lanes 5-12) from
total protein from E. coli expressing Syn1GST fusion proteins or GST protein. Equal
amounts of protein from IPTG-induced E.
coli were loaded on an SDS-polyacrylamide
gel as follows: lane 1, construct carrying the
Syn1a fusion (major stained induced protein,
32 kDa); lane 2, construct carrying the Syn1d
fusion (major stained induced protein, 77
kDa, 50 + 27 GST); lane 3, construct carrying
the Syn1c fusion (major stained induced
protein, 75 kDa, 48 + 27 GST); and lane 4,
construct carrying parental vector pGEX-2T,
which expresses GST (27 kDa) but no Syn1
protein. Lanes 5-8 are a western blot of the
gel probed with a 1/3000 dilution of serum
from a mouse inoculated with Syn1d-GST
fusion protein (inclusion bodies) produced in
E. coli. An additional gel with the same
C
B
amounts of protein as on lanes 1-4 (lane 9,
pGEX-2T vector; lane 10, Syn1c-GST fusion;
lane 11, Syn1d-GST fusion; and lane 12,
Syn1a-GST fusion), was electrophoresed,
blotted to nitrocellulose and probed with antiGST antibody prepared in goat (Pharmacia).
Lane M between lanes 4 and 5 contains low
molecular mass markers (Bio-Rad); and lane
M between lanes 8 and 9 contains rainbow
markers (Amersham). Sizes in kDa are
indicated. (B) Western blot of proteins from
hamster testicular nuclei separated by SDSpolyacrylamide gel electrophoresis
(Coomassie Blue, lane 1) and probed with
D
antibodies generated in mice against Syn1GST fusion proteins expressed in E. coli or
with antibodies produced in rabbits against
purified hamster synaptonemal complexes.
Lane 2, mouse anti-Syn1b antibody; lane 3,
mouse anti-Syn1a antibody; lane 4, mouse
anti-Syn1d antibody; lane 5, mouse antiSyn1c antibody; lane 6, rabbit B anti-SC
antibody; and lane 7, rabbit D anti-SC
antibody (Moens et al., 1992). Sizes in kDa
are indicated. (C) Southwestern analysis of
the Syn1c (lane 1) and -d (lane 2) fusion
protein extracts. Lane 3, pGEX-2T extract.
Probe is rat DNA, sequence SCB9, known to
be tightly associated with rat SCs (Pearlman
et al., 1992). Sizes of immunoreactive Syn1c (75 kDa) and Syn1d (77 kDa) proteins (B and C) are given (arrows). (D) SDS-polyacrylamide gel
(Coomassie Blue, lanes 1 and 2) and western blot (lanes 3 and 4) from insoluble protein from E. coli expressing the Cor1a-GST fusion protein.
Lane 1, 42 kDa Cor1a-GST fusion protein; lane 2, 27 kDa GST; lane 3, western blot of lane 1; lane 3, western blot of lane 2 using rabbit antiSC antibody. Size markers (thin arrows), the 42 kDa Cor1a-GST fusion protein and the 27 kDa GST protein (thick arrows) are indicated.
375 bp EcoRI/BamHI fragment from pBR322 are also bound
by Syn1 (not shown).
Cor1
Six independent cDNA fragments of this gene, all initiated at
the 3′ poly A tail, were isolated in multiple screening of the
hamster cDNA library and excised as Bluescript plasmids. Of
these, the longest fragments were apparently unclonable as inframe translational fusions in the pGEX-2T vector. Inserts
were recovered in the reverse orientation, however, suggesting
that the longer Cor1 fusion constructs may be toxic to the E.
coli host. The only cDNA to be subcloned in the correct orientation was COR1a, which encodes the carboxyl half of the
protein. Electrophoresis of protein extracts from this transformant on SDS-PAGE gels showed that a fusion protein of the
expected size was produced predominantly in the insoluble
fraction (Fig. 3D).
Antigen occurrence and localization
The polyclonal antibodies against the Syn1 and Cor1 fusion
proteins are specific for meiotic chromosome antigens (cores,
lateral domains, centromere regions and synapsed regions).
2754 M. J. Dobson and others
Fig. 4. Progression of chromosome synapsis at meiotic prophase in hamster spermatocytes is visualized with differential immunolabelling of
the core and synaptic proteins. For A, C and E the primary antibody is mouse anti-Cor1a and the secondary antibody is rhodamine-conjugated
goat anti-mouse IgG. For B, D and F the primary antibody is rabbit anti-Syn1c and the secondary antibody is FITC-conjugated goat anti-rabbit
IgG. Bar, 10 µm. (A,B) The earliest stage of chromosome synapsis, zygotene. The cores in A are mostly single except for a few synapsed
regions shown in B. Three synapsed regions are already quite lengthy and it appears that the extension of synapsis is rapid relative to the
establishment of new initiation sites. (C,D) Midway through the zygotene stage there is extensive synapsis. (E,F) The cores are completely
synapsed and the image of the Cor1 protein now coincide with the image of the Syn1 protein. Aggregates of Cor1 protein, separate from the
SCs, are present at early pachytene, E (arrow), but not at later stages. At the resolution of the epifluorescence microscope, the antibodies to the
several Syn1 fusion proteins give the same image.
SC proteins 2755
Cryosections of hamster body tissues are negative, with the
exception of testes where the spermatocyte nuclei are positive
(Fig. 5). Details of the occurrence and location of meiotic chromosome antigens was obtained from surface-spread spermatocyte preparations.
The Cor1 antigen is first detected when the cores are still
largely unpaired at the leptotene-zygotene stages of meiotic
prophase (Fig. 4A). In those cells the Syn1 antigen is present
where cores from homologous chromosomes have synapsed
(Fig. 4B). Although there are few such regions at early
zygotene, they are already quite long, indicating that synapsis
is rapid relative to the establishment of new pairing sites. As
synapsis progresses, the number of single cores is reduced (Fig.
4C, anti-Cor1), while the synapsed regions are longer and more
numerous (Fig. 4D, anti Syn1). The images of the core and
synaptic antigens are identical when all chromosomes are fully
synapsed (Fig. 4E and F), with the exception of some aggregates of core antigen at early pachytene (Fig. 4E, arrow). At
diplotene, the cores separate and the Syn1 antigen is present
only at the remaining points of contact (Fig. 6A; Cor1 antigen
is red, the Syn1 antigen is green but appears yellow when overlapped with red). The presence of one or two small pairing
regions for each of the 20 bivalents gives a noticeably different
staining pattern from the early zygotene configuration where
there are relatively few but long pairing regions. Therefore the
staging of these cell types is unambiguous.
At metaphase I substantial amounts of Cor1 antigen colocalize with each of the 40 double centromeres identified by
CREST immunostaining and small amounts of Cor1 antigen
are present along the long axis of the chromosomes. In Fig. 6B
the metaphase I bivalents are stained fluorescent blue with
DAPI and the Cor1 antigen is fluorescent red. The same
nucleus in Fig. 6C demonstrates the centromere positions that
coincide with the Cor1 positive regions in Fig. 6B. One of the
doubled centromeres is indicated by a double bar. At anaphase
II the 20 double centromeres separate leaving the Cor1 antigen
behind (Fig. 6D; centromeres in green and Cor1 antigen in
red). Cor1 antigen can be detected in later stage spermatids but
they are no longer associated with the kinetochores.
Epitope mapping
Syn1a (aa 505-762) and Syn1b (aa 434-745)
Polyclonal antibodies are against the carboxyl region of the
SYN1 gene product (Table 1). The mode and mean of the gold
grain distribution are at the inner edge of the lateral element as
defined by osmium tetroxide staining (Fig. 7). The distribution
of grains to either side of the mean can be attributed, in part,
to the size of the antibodies, the size of the gold grain, and the
unbiased error of each measurement. About 50% of the grains
are over the central region (Table 2). Syn1b is detected marginally more towards the centre of the SC, concomitant with
an additional 71 amino acids towards the amino terminus of
Syn1. Both these fusions lack the Syn1 leucine zipper domain.
Syn1c (aa 336-745) and Syn1d (aa 135-560)
The carboxyl end of Syn1c is identical to Syn1b but there are
100 additional amino acids towards the amino end, including
eight heptad repeats of the leucine zipper motif. Relative to
Syn1a and -b, the mode and mean of the gold grain distribution are shifted more than 10 nm towards the centre of the SC
and some 70% of the grains are over the central region (Table
Table 2. Numerical values of the gold grain distributions
shown in Fig. 7
Percentage of grains
Antigen
Mode
(nm)
Mean
(nm)
Outside
LE*
Central
Syn1a
Syn1b
Syn1c
Syn1d
35-40
30-40
20-25
20-30
44.67
44.56
31.45
28.55
11.14
10.57
3.46
2.75
38.39
40.38
22.63
16.28
50.47
49.06
73.90
80.97
Cor1a
80-90
71.89
45.72
39.12
15.16
For each of the anti-fusion protein antibodies the positions of 400-500
grains were digitized and computationally accumulated (Moens et al., 1987).
*Lateral element.
2). This portion of the Syn1 protein appears to occupy a
position in the central region of the SC, about 20-25 nm from
the middle of the SC (Fig. 7). Compared to Syn1c, Syn1d lacks
185 amino acids at the carboxyl end and has an additional 201
amino acids at the amino end. It includes the complete leucine
zipper motif. The mode and mean of the immunogold grain
distribution are similar to that of Syn1c, shifted slightly more
towards the centre of the SC. Approximately 80% of the grains
are over the central region of the SC (Table 2).
Cor1a
The Cor1a fusion protein contains a 130 amino acid carboxylterminal fragment of the Cor1 protein. The immunogold
detects the Cor1 antigen in a broad lateral domain of the SC
(Figs 7, 8B). This distribution is much broader than the conventional lateral element as visualized with electron-dense
stains (Fig. 8A,B). The distribution coincides with the dimensions of the shadow-cast image of the lateral domain (Fig.
8C,D).
SC dimensions
Electron micrographs of sectioned or surface-spread meiotic
prophase cells stained with electron-dense stains (uranyl
acetate, lead citrate, osmium tetroxide or phosphotungstic acid)
reveal lateral elements of about 47±6 nm width and a central
region of 100±25 nm, for a total width of about 194±13 nm
(60 OsO4-stained SCs measured, ± standard error) (Fig. 8A,B).
Different dimensions are apparent in electron micrographs of
shadow-cast SC preparations (Fig. 8C, D). The lateral domains
are considerably wider, on average about 110 nm (range 80170 nm), and the central region is narrower, on average only
50 nm, and the total width is approximately 260 nm. The cores
and the lateral elements that react with metal ions appear to be
an internal component of the lateral domain. The broad lateral
domain as seen in shadow-cast images corresponds to the
structure detected by antibodies to the chromosome core
protein, Cor1a, where the major portion of the immuno-gold
grains cover a lateral domain of about 100 nm in width (Table
2, Figs 7, 8B,D).
DISCUSSION
SC dimensions
The substructure of the SC as it is disclosed by antibody
epitope mapping and shadow-casting shows noticeable differ-
2756 M. J. Dobson and others
ences from the standard descriptions of SCs, which are based
on electron microscopy of SCs stained with metal ions
(tungsten, lead, uranium, osmium). For the rat, mouse and
hamster, the electron-dense lateral elements are about 50 nm
6
6
wide, separated by a central region of about 80-100 nm. This
image leads to the expectation that the structural components
of the central region abut the distinctive lateral elements. Antibodies against the carboxyl end of hamster chromosome-core
6
SC proteins 2757
protein 1, Cor1, indicate a much broader lateral element
domain than is apparent in the traditional electron-dense lateral
element of rodents (Figs 7, 8, Table 2). The gold grain distribution extends some 40 nm to the outside of the dense lateral
element. That lateral element domains are indeed broader than
is apparent from electron microscopy of metal-ion-stained
lateral elements is further evident from shadow-cast preparations, which show that the chromosome cores and the lateral
domains are about twice as broad as the metal-ion-stained
electron-dense lateral elements (Fig. 8). The broader
dimension is in part at the expense of the central region, which
becomes narrower, and in part due to a widening of the SC
from approximately 200 nm to 260 nm or more. A mode of the
gold grain distribution to the outside of the lateral element has
also been observed for the 190 kDa lateral element protein (C.
Heyting and E. Hartsuiker, personal communication). ApparFig. 5. A cryosection of hamster testicular tubules immunostained
with antibody to Syn1c fusion protein and stained with the DNA
binding stain propidium iodide. The FITC-conjugated secondary
antibody marks the SCs of the spermatocytes in green. Other
spermatogenic and non-spermatogenic nuclei are red and lack the
Syn1 antigen.
Fig. 6. Chromosome disjunction. (A) Cor1 antigen in red (rhodamine
fluorescence), Syn1 antigen in green (FITC fluorescence), and
overlapping areas in yellow. Surface-spread mouse spermatocyte. At
diplotene the chromosomes separate but remain attached at a few
points, the chiasmata, presumably the sites of crossovers. The Syn1
antigen gradually disappears, lastly from the chiasmata sites. The
Cor1 antigen remains present axial to each chromosome. (B) Cor1
antigen in red (rhodamine fluorescence), chromatin in blue (DAPI
fluorescence). At metaphase I most of the Cor1 antigen co-locates
with the 40 doubled centromeres while small amounts are present
along the chromosome axes. The X-chromosome (x) retains more
Cor1 antigen than the other chromosomes. Bar, 10 µm. (C) The same
nucleus as in B immunostained with human anti-centromere CREST
serum and FITC-conjugated secondary antibody. The corresponding
centromeres in B and C are marked (c). A doubled centromere is
marked with two short bars. The superimposed FITC and DAPI
images are slightly offset. (D) Cor1 antigen red, centromeres green
(FITC fluorescence). The association between centromeres and Cor1
antigen persists till anaphase II at which time the sister centromeres
separate and the Cor1 antigen appears to lag between the separating
centromeres.
Fig. 7. Distributions of 5 nm immune gold grains over hamster SCs
detected by polyclonal antibodies to Syn1 and Cor1 fusion proteins.
Since the SC is bilaterally symmetrical, only one half of the SC is
shown, with position 0 nm in the centre and position 140 nm on the
outside. The positions of the electron-dense lateral element and the
broader lateral domain are marked as such. Computation adjusts all
measurements to an arbitrary standard SC (central region 80 nm,
lateral element 40 nm). The Syn1 fusion proteins to which the
antibodies were made are defined by the amino acid numbers starting
at the amino end of the protein (Meuwissen et al., 1992) and are
shown diagrammatically at the top of the graph. The region of the
leucine zipper in 1c and 1d is an open rectangle. The graph
demonstrates that the peaks of the gold grain distributions shift from
a central position to a lateral position as the fusion protein fragments
shift from the amino to the carboxyl end of the protein. It is
concluded that Syn1 is oriented with the amino end towards the
centre and the carboxy end extends into the lateral domain. The
graph also demonstrates that the method is sensitive to shifts of a few
nanometres in the antigen location. Polyclonal antibodies to the
carboxy end of Cor1 detect a broad lateral domain of the SC (purple
curve, Cor 1a).
ently, traditional EM staining with metal ions has visualized
only a specific portion of the lateral domain.
The implication of these new dimensions is that the proteins
that comprise the synaptic domain have a greater degree of
overlap with the protein constituents of the lateral domains of
the SC than was apparent from earlier observations. This
arrangement suggests that direct interactions might be
expected between some of the SC proteins. The availability of
SC protein-encoding genes will allow in vitro assessment of
potential protein-protein interactions.
Epitope mapping
The characteristics of SCP1, the rat homologue of the hamster
synaptic protein Syn1, have been reported by Meuwissen et al.
(1992). It is predicted to consist of 946 amino acids and has
long regions that show sequence similarity to the coiled-coil
region of the myosin heavy chain. In addition, there is a leucine
zipper, DNA binding motifs, and potential target sites for
P34cdc2 protein kinase (Meuwissen et al., 1992). The published
numbering of the SCP1 amino acid sequence is used here to
identify the hamster fusion proteins Syn1a to -d in Table 1, and
in Fig. 7. It is clear from Fig. 7 that each extension of the fusion
protein in the direction of the amino end of the Syn1 protein
coincides with a displacement of the peak of the gold grain distribution towards the centre of the SC. The polyclonal antibodies against the fusion protein products of these four cDNA
fragments demonstrate that the Syn1 protein is oriented with
the amino end towards the centre of the SC and with the
carboxyl end extending into the lateral domain. The orientation agrees with the more general observation of Meuwissen
et al. (1992) that a monoclonal antibody against an epitope at
the carboxyl end of rat synaptic protein SCP1 produces a gold
grain distribution that is closer to the lateral element than that
of a polyclonal antibody against SCP1 as a whole. A different
synaptic protein, Zip1, has been identified in the yeast, S. cerevisiae. Sym et al. (1993) calculated that the 875 amino acid
Zip1 is sufficiently long to span the distance between the
lateral elements.
The in vivo significance of the apparent DNA binding characteristics of the Syn1 protein, indicated by the DNA binding
motifs (Meuwissen et al., 1992) and the non-specific DNA
binding in Southwestern blots of the Syn1 fusion proteins
reported here (Fig. 3D), remains to be determined. Traditionally, the chromosome cores are thought to be the binding sites
for the chromatin loops because the meiotic prophase chromosomes usually acquire their cores before synapsis. At a later
stage, when the homologous cores are being aligned, the
synaptic protein becomes part of the SC. The deduced amino
acid sequence of Cor1 (Fig. 2) does not have a recognizable
DNA binding motif. DNA binding may be the function of other
core proteins. A nucleotide (ATP/GTP) binding site motif may
be of functional significance as might putative cAMP- and
cGMP-dependent, protein kinase C and casein kinase II phosphorylation sites. The rat homologue of the COR1 gene, SCP3,
has also recently been cloned (C. Heyting, personal communication).
Cor1 antigens in rodent spermatocyte nuclei can occur
outside the context of the chromosome core or SC. At the time
that chromosome synapsis is being completed there are small
aggregates of antigen among the SCs but not necessarily
connected to the SCs (Fig. 4E). Such extra-SC material has
2758 M. J. Dobson and others
Fig. 8. SC ultrastructural dimensions revealed by different techniques. Bar, 200 nm. (A) A thin section stained with uranyl acetate and lead
citrate. Typically, the lateral elements are rather narrow, about 40 nm, while there is a wide central region of about 80-100 nm. (B) In surfacespread preparations, the uranyl/lead-stained lateral elements are similar in width and spacing to the sectioned material in (A), but the
distribution of the Cor1 antigen detected by the 5 nm gold grains betrays a wider lateral domain, particularly to the outside of the lateral
element. (C) The greater width of the lateral domain is also evident in shadow-cast preparations of surface-spread SCs. As a result, the SC as a
whole is wider and the space between the lateral domains is reduced, leaving room only for the central element. (D) The coincidence of the
immuno-stained (5 nm gold grains) lateral domains and the shadow-cast image is apparent in this diplotene SC where the chromosome cores
are starting to separate. The implication is that there is a considerable overlap between locations of the core and the synaptic proteins.
Fig. 9. A summary diagram of the positions of
core and synaptic proteins in the SC. No details of
the protein structures, their interactions and
association with chromatin are known as yet.
been observed in several organisms and has been associated
with the self-assembly of excess SC material; for example, in
pachytene-arrested yeast mutants (Moens and Kundu, 1982).
The structural aspects of the SC are summarized in Fig. 9,
an elaboration of Fig. 1. The Syn protein is shown extending
from the middle of the SC out into the lateral domain. Alternative arrangements, such as a Syn1 protein that bridges the
entire distance between the lateral elements or a bidirectional
orientation of the Syn1 protein, are not supported by the
evidence shown in Fig. 7. The binding of DNA to the Syn1
protein is not addressed in the diagram. It is clear, however,
from a separate study that combines SC immunofluorescence
with in situ hybrization of probe that is specific for a 2 Mb
phage DNA insert on mouse chromosome no. 4, that the DNA
loops attach to the SC (Heng et al., 1994), but the details of
the attachment are not clear as yet. Since the chromatin
becomes attached to the cores before Syn1 is associated with
the cores, the diagram shows chromatin attached to the lateral
domain proteins. The known lateral domain proteins of rodents
such as SCP2 (190 kDa) (E. Hartsuiker and C. Heyting,
SC proteins 2759
personal communication) and Cor1 all have a broad distribution that exceeds the more narrow lateral element as seen with
electron-dense stains. The implication is that synaptic and core
proteins have a broad region of overlap. No antibodies that
recognize the central element have been reported to date, nor
any antibodies against the SC-associated dense nodes, some of
which may be implicated in reciprocal crossovers (Carpenter,
1975; Albini and Jones, 1988).
Chromosome synapsis
Using antibodies raised in different hosts against various
meiotic chromosome components, the temporal and spacial
relationships of cores, lateral domain proteins and synaptic
proteins can be visualized simultaneously with two-colour
immuno-labelling for epifluorescence microscopy or by differential immunogold labelling for electron microscopy. At the
onset of chromosome synapsis (Fig. 4A), there are predominantly unpaired chromosome cores (Cor1) and a few synapsed
regions (Fig. 4B, Syn1). There are relatively few synapsed
regions but the ones that are there are already fairly lengthy,
about 5 µm, indicating that the progression of synapsis is rapid
relative to the rate with which new initiation sites are established. The same conclusion holds for later zygotene (Fig.
4C,D) where synapsis is more advanced. It has been argued
that the initial sites of pairing require homology recognition
and may represent potential sites of genetic recombination
(Radman and Wagner, 1993; review, Moens, 1994). The
extension of synapsis may be less dependent on homology than
initiation of synapsis. The rapid, possibly non-homologous,
extension of SCs observed here may be the mechanism that
forestalls additional homology searches near an initiation site
and thereby provides a mechanism for positive recombination
interference. In support of such a mechanism is the observation that in organisms with limited SC formation, such as
Schizosaccharomyces pombe, or with faulty SC formation as
in asynaptic meiosis, positive genetic interference tends to be
absent or reduced (Bahler et al., 1992; Havekes, 1992; Moens,
1969). The use of two-colour immune-staining permits an
efficient quantification of the process of chromosome synapsis
at meiotic prophase but is beyond the scope of the present
report.
Chromosome disjunction
At anaphase of mitosis sister chromatids separate, but at
anaphase I of meiosis the sister chromatids remain associated
at their centromeres and chromosomes rather than chromatids
segregate. Regular chromosome disjunction at meiosis I of
most sexually reproducing organisms is thought to depend on
at least two mechanisms: chiasma maintenance and sister kinetochore cohesion. Observations on the orientation of acentric
fragments that result from a crossover in an inversion in maize
meiosis has lead Maguire (1993) to a preference for sister
chromatid cohesion as one of the main factors responsible for
the maintenance of chiasmata (reciprocal cross-over). She
proposes that SC components are likely candidates for sister
chromatid cohesion at metaphase I. The presence of SC components axial to the sister chromatids was demonstrated by
electron microscopy of serially sectioned grasshopper
metaphase I chromosomes (Moens and Church, 1979). Here
we report the presence of Cor1 protein in the metaphase chromosome I axis (Fig. 6B). Because the Cor1 protein is associ-
ated with sister chromatids throughout prophase we assume
that Cor1 continues in that role during metaphase I, thereby
giving support to the suggested function for SC components in
sister chromatid cohesion and chiasma maintenance. The axis
of the X chromosome has more Cor1 antigen than the
autosomes (Fig. 6B).
Most of the Cor1 antigen at metaphase I occurs in association with the pairs of sister kinetochores (Fig. 6B, C). Here, too,
the Cor1 protein may function as a cohesive element between
the sister kinetochores. As such, it can contribute to the
mechanism for chromosome, rather than chromatid, segregation
at anaphase I. The finding that the Cor1 protein lags between
the separating sister kinetochores at anaphase II (Fig. 6D) and
that it has not been observed in association with mitotic
metaphase centromeres, further supports the suggested function
of Cor1 in sister kinetochore cohesion at meiotic metaphase
I/anaphase I. The loss of a kinetochore-associated protein at
anaphase is not uncommon (for reviews see Earnshaw and
Bernat, 1991; Rattner, 1992). The observed presence of a silverstained centromeric filament at metaphase I/anaphase I in a
number of mammalian species also led Solari and Tandler
(1991) to the conclusion that the sister kinetochores remain
joined together and co-oriented by this SC remnant.
The research was supported by grants from NSERC to R.E.P. and
P.B.M. We gratefully acknowledge the technical assistance of Nora
Tsao and Anita Samardzic with the molecular biology, and thank
Mary Lou Ashton for help with the confocal and electron microscopy.
REFERENCES
Albini, S. M. and Jones, G. H. (1988). Synaptonemal complex spreading in
Allium cepa and A. fistulosum. II. Pachytene observations: the SC karyotype
and the correspondence of late recombination nodules and chiasma. Genome
30, 399-410.
Bahler, J., Wyler, T. G., Loidl, J. and Kohli, J. (1992). Unusual nuclear
structure in meiotic prophase of fission yeast: a cytological approach. J. Cell
Biol. 121, 241-256.
Bairoch, A. (1992). PROSITE: A dictionary of sites and patterns in proteins.
Nucl. Acids Res. 20 (suppl.), 2013-2018.
Carpenter, A. T. C. (1975). Electron microscopy of meiosis in Drosophila
melanogaster females. I. The RN - a recombination-associated structure at
pachytene? Proc. Nat. Acad. Sci. USA 72, 3186-3189.
Chen, Q., Pearlman, R. E. and Moens, P. B. (1992). Isolation and
characterization of a gene encoding a protein of the rat synaptonemal
complex. Biochem. Cell Biol. 70, 1030-1038.
Earnshaw, W. C. and Bernat, R. L. (1991). Chromosomal passengers:
Towards an integrated view of mitosis. Chromosoma 100, 139-146.
Havekes, F. (1992). Chromosome pairing and recombination in synaptic
mutants of tomato. Boone Chromosome Conf. III, Boone, NC.
Heng, H. H. Q., Tsui, L-C. and Moens, P. B. (1994). Visualizing chromosome
condensation: Combined fluorescent immune-staining and in situ
hybridization. Chromosoma (in press).
Heyting, C., Moens, P. B., van Raamsdonk, W., Dietrich, A. J. J., Vink, A.
C. G., Redeker, E. J. W. (1987). Identification of two major components of
the lateral elements of synaptonemal complexes of the rat. Eur. J. Cell Biol.
43, 148-154.
Heyting, C., Dietrich, A. J. J., Moens, P. B., Dettmers, R. J. Offenberg, H.
H., Redeker, E. J. W. and Vink, A. C. G. (1988). Synaptonemal complex
proteins. Genome 31, 81-87.
Heyting, C. and Dietrich, A. J. J. (1991). Meiotic chromosome preparation
and protein labelling. Functional Organization of the Nucleus, A Laboratory
Guide. Meth. Cell Biol. (ed. B. A. Hamkalo and S. C. R. Elgin), vol. 35, pp.
177-202. Academic Press, San Diego.
Hollingsworth, N. M., Goetsch, L. and Byers, B. (1990). The HOP1 gene
encodes a meiosis-specific component of yeast chromosomes. Cell 61, 7384.
2760 M. J. Dobson and others
Klein, F., Laroche, T., Cardenas, M. E., Hofmann, J. F.-X., Schweizer, D.
and Gasser, S. M. (1992). Localization of RAP1 and topoisomerase II in
nuclei and meiotic chromosomes of yeast. J. Cell Biol. 117, 935-948.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of
the head of bacteriophage T4. Nature 227, 680-685.
Maguire, M. P. (1993). Sister chromatid association at meiosis. Maydica 38,
93-106.
Mellor, J., Fulton, A. M., Dobson, M. J., Roberts, N. A., Wilson, W.,
Kingsman, A. J. and Kingsman, S. M. (1985). The Ty transposon of
Saccharomyces cerevisiae determines the synthesis of at least three proteins.
Nucl. Acids Res. 13, 6249-6263.
Meuwissen, R. L. J., Offenberg, H. H., Dietrich, A. J. J., Riesewijk, A., van
Iersel, M. and Heyting, C. (1992). A coiled-coil related protein specific for
synapsed regions of meiotic prophase chromosomes. EMBO J. 11, 50915100.
Moens, P. B. (1969). Genetic and cytological effects of three desynaptic genes
in the tomato. Can. J. Gen. Cytol. 11, 857-869.
Moens, P. B. and Church, K. (1979). The distribution of synaptonemal
complex material in metaphase I bivalents in Locusta and Chloealtis
(Orthroptera: Acrididae). Chromosoma 73, 117-134.
Moens, P. B. and Kundu, S. C. (1982). Meiotic arrest and synaptonemal
complexes in yeast ts spo 10 (Saccharomyces cerevisiae). Can. J. Biochem.
60, 284-289.
Moens, P. B., Heyting, C., Dietrich, A. J. J., van Raamsdonk, W. and Chen,
Q. (1987). Synaptonemal complex antigen localization and conservation. J.
Cell Biol. 105, 93-103.
Moens, P. B. and Earnshaw, W. C. (1989). Anti-topoisomerase II recognizes
meiotic chromosome cores. Chromosoma 98, 317-322.
Moens, P. B., Spyropoulos, B., Dobson, M. J., Karaiskakis, A. and
Pearlman, R. E. (1992). Searching for synaptonemal complex proteins and
their genes. Dev. Genet. 13, 435-439.
Moens, P. B. (1994). Molecular perspectives of chromosome pairing at
meiosis. BioEssays 16, 101-106.
Pearlman, R. E. Tsao, N. and Moens, P. B. (1992). Synaptonemal complexes
from DNase-treated rat pachytene chromosomes contain (GT)n and LINE
sequences, but no MARs/SARs. Genetics 130, 865-872.
Radman, M. and Wagner, R. (1993). Mismatch recognition in chromosomal
interactions and speciation. Chromosoma 102, 369-373.
Rattner, J. B. (1992). Integrating chromosome structure with function.
Chromosoma 101, 259-264.
Rose, D., Thomas, W. and Holm, C. (1990). Segregation of recombined
chromosomes in meiosis I requires DNA topoisomerase II. Cell 60, 10091017.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor Laboratory Press, New York.
Sanger, F., Nicklen, S. and Coulson, A. R. (1977). DNA sequencing with
chain terminating inhibitors. Proc. Nat. Acad. Sci. USA 74, 5463-5467.
Siegel, J. N., Turner, C. A., Klinman, D. M., Wilkinson, M., Steinberg, A.
D., MacLeod, C. L., Paul, W. E., Davis, M. M. and Cohen, D. I. (1987).
Sequence analysis and expression of an X-linked, lymphocyte-regulated
gene family (XLR). J. Exp. Med. 166, 1702-1715.
Smith, A. and Benevente, R. (1992). Identification of a structural protein
component of rat synaptonemal complexes. Exp. Cell Res. 198, 291-297.
Solari, A. J. and Tandler, C. J. (1991). Presence of a centromeric filament
during meiosis. Genome 34, 888-894.
Sym, M., Engebrecht, J. and Roeder, G. S. (1993). ZIP1 is a synaptonemal
complex protein required for meiotic chromosome synapsis. Cell 72, 365378.
von Wettstein, D. (1977). The assembly of the synaptonemal complex. Phil.
Trans. R. Soc. London Ser. B 277, 235-243.
von Wettstein, D, Rasmussen, S. W. and Holm, P. B. (1984). The
synaptonemal complex in genetic segregation. Annu. Rev. Genet. 18, 331431.
(Received 25 January 1994 - Accepted, in revised form,
6 June 1994)