* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Synaptonemal complex proteins - Journal of Cell Science
Genetic code wikipedia , lookup
Paracrine signalling wikipedia , lookup
Signal transduction wikipedia , lookup
Polyclonal B cell response wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Biochemistry wikipedia , lookup
Ancestral sequence reconstruction wikipedia , lookup
G protein–coupled receptor wikipedia , lookup
Gene expression wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Metalloprotein wikipedia , lookup
Magnesium transporter wikipedia , lookup
Point mutation wikipedia , lookup
Expression vector wikipedia , lookup
Bimolecular fluorescence complementation wikipedia , lookup
Interactome wikipedia , lookup
Monoclonal antibody wikipedia , lookup
Protein structure prediction wikipedia , lookup
Nuclear magnetic resonance spectroscopy of proteins wikipedia , lookup
Protein purification wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Proteolysis wikipedia , lookup
2749 Journal of Cell Science 107, 2749-2760 (1994) Printed in Great Britain © The Company of Biologists Limited 1994 Synaptonemal complex proteins: occurrence, epitope mapping and chromosome disjunction Melanie J. Dobson*, Ronald E. Pearlman, Angelo Karaiskakis, Barbara Spyropoulos and Peter B. Moens† Department of Biology, York University, Downsview, Ontario, M3J 1P3, Canada *Present address: Department of Biochemistry, Faculty of Medicine, Dalhousie University, Halifax, Nova Scotia, B3H 4H7, Canada †Author for correspondence SUMMARY We have used polyclonal antibodies against fusion proteins produced from cDNA fragments of a meiotic chromosome core protein, Cor1, and a protein present only in the synapsed portions of the cores, Syn1, to detect the occurrence and the locations of these proteins in rodent meiotic prophase chromosomes. The 234 amino acid Cor1 protein is present in early unpaired cores, in the lateral domains of the synaptonemal complex and in the chromosome cores when they separate at diplotene. A novel observation showed the presence of Cor1 axial to the metaphase I chromosomes and substantial amounts of Cor1 in association with pairs of sister centromeres. The centromere-associated Cor1 protein becomes dissociated from the centromeres at anaphase II and it is not found in mitotic metaphase centromeres. The extended presence of Cor1 suggests that it may have a role in chromosome disjunction by fastening chiasmata at metaphase I and by joining sister kinetochores, which ensures co-segregation at anaphase I. Two-colour immunofluorescence of Cor1 and Syn1 demonstrates that synapsis between homologous cores is initiated at few sites but advances rapidly relative to the establishment of new initiation sites. If the rapid advance of synapsis deters additional initiation sites between pairs of homo- logues, it may provide a mechanism for positive recombination interference. Immunogold epitope mapping of antibodies to four Syn1 fusion proteins places the amino terminus of Syn1 towards the centre of the synaptonemal complex while the carboxyl terminus extends well into the lateral domain of the synaptonemal complex. The Syn1 fusion proteins have a non-specific DNA binding capacity. Immunogold labelling of Cor1 antigens indicates that the lateral domain of the synaptonemal complex is about twice as wide as the apparent width of lateral elements when stained with electron-dense metal ions. Electron microscopy of shadow-cast surface-spread SCs confirms the greater width of the lateral domain. The implication of these dimensions is that the proteins that comprise the synaptic domain overlap with the protein constituents of the lateral domains of the synaptonemal complex more than was apparent from earlier observations. This arrangement suggests that direct interactions might be expected between some of the synaptonemal complex proteins. INTRODUCTION 1992). In mammals, a number of SC-specific and SC-associated proteins have been identified (Heyting et al., 1987, 1988; Smith and Benevente, 1992; Chen et al., 1992; Moens et al., 1992; Moens and Earnshaw, 1989). In the absence of gene disruption experiments, their functions can be inferred indirectly from known functions, e.g. topoisomerase II, from known amino acid sequence motifs (Meuwissen et al., 1992), from their location (Heyting et al., 1987), or from assays that detect SC protein-protein or SC protein-DNA interactions. As these characteristics become known for several SC proteins, a comprehensive picture of SC function can be assembled. In an attempt to determine the occurrence and organization of meiosis-specific chromosome proteins, we constructed a cDNA expression library from hamster spermatocytes. This library was screened with sera from rabbits and mice inoculated with hamster SCs to identify clones producing SC antigens (Moens et al., 1992). Here we report characteristics During early prophase of meiosis in most sexually reproducing organisms, each chromosome develops a longitudinal axial core to which the chromatin loops are attached (Fig. 1). Subsequently, the cores of each pair of homologous chromosomes become aligned in parallel, thereby forming the lateral elements of the synaptonemal complex (SC). Later, the cores separate while remaining attached at a few points, presumably the sites of crossovers (von Wettstein, 1977; von Wettstein et al., 1984). Meiotic functions of the SCs have been detected in the yeast, Saccharomyces cerevisiae, where the Hop1 protein of the lateral element facilitates between-homologue recombination (Hollingsworth et al., 1990), the Zip1 protein of the SC functions in the pairing of homologues (Sym et al., 1993), and topoisomerase II as a component of the SC functions in chromosome segregation at meiosis (Rose et al., 1990; Klein et al., Key words: synaptonemal complex, immunocytochemistry, cDNA library, fusion protein, rodent spermatocyte, chromosome disjunction 2750 M. J. Dobson and others ne ch co tf le ce Fig. 1. A diagrammatic representation of the conventional image of a synaptonemal complex, SC. Meiotic prophase chromosome cores (co) with the attached chromatin (ch) become parallel aligned during chromosome synapsis and are then referred to as the lateral elements (le) of the SC. There are transverse filaments (tf) between the lateral elements and there is a median central element (ce). The SCs are usually attached to the nuclear envelope (ne). of two meiotic chromosome components whose encoding cDNAs were isolated with this approach. The SYN1 gene encodes a protein found only where the chromosome cores are synapsed. Accordingly, this protein is named Syn1 (meiotic chromosome Synaptic protein). The COR1 gene encodes a product that is a component of the chromosome core in the meiotic prophase chromosomes, referred to here as Cor1 protein (meiotic chromosome Core protein). In this report, immunofluorescent and immunogold labelling are used to determine the occurrence and locations of Syn1 and Cor1 antigens in rodent spermatocytes. MATERIALS AND METHODS cDNA library The construction of a Syrian golden hamster (Mesocricetus auratus) spermatocyte cDNA expression library has been reported previously (Moens et al., 1992). Briefly, the library was constructed from the poly(A)+ mRNA fraction of purified spermatocytes of young (25 day) males in the λZap II vector (Stratagene, La Jolla, CA), and was screened (Heyting and Dietrich, 1991) with SC-reactive serum from two rabbits and a mouse that had been inoculated with purified hamster SCs. Because the sera could contain antibodies against antigens other than meiotic chromosome proteins, the immunoreactive λ clones were screened by affinity elution (Sambrook et al., 1989). The eluted antibodies were immune tested on spermatocytes in order to detect those phage clones that have a cDNA insert that produces meiotic chromosome antigens. The inserts of choice were excised in vivo as Bluescript plasmids following the manufacturer’s protocol (Stratagene). Double- and single-stranded DNA isolated from these Bluescript plasmids or suitable subclones were sequenced in their entirety with the dideoxy-chain termination method of Sanger et al. (1977). Production of SC fusion proteins Hamster SC antigens were produced in Escherichia coli by subcloning partial cDNAs in the expression vector pGEX-2T (Pharmacia) to give a translational fusion of the cDNA fragment at the carboxyl terminus of the glutathione S-transferase (GST) protein. Fusion proteins derived from the SYN1 gene are named Syn1a, -b, etc. and those derived from the COR1 gene are named Cor1a, -b, etc. Expression of the fusion protein in these vectors is under the control of the highly inducible tac promoter. Expression and purification of the GST-SC fusion proteins were carried out according to the manufacturer’s protocol: transformed Escherichia coli cultures were grown to an A600 of 0.7 in YT medium supplemented with 50 µg/ml ampicillin before gene expression was induced for 1 hour at 37°C by the addition of 0.1 mM IPTG. Cultures were then chilled to 4°C, harvested by centrifugation, washed with cold phosphate buffered saline (PBS) and resuspended in cold PBS to which the following had been added: 50 mM EDTA, 10 mM DTT, 0.5 mM PMSF, 0.5 µg/ml leupeptin, 0.01 TIU/ml aprotinin. Triton X-100 was sometimes added to the extraction buffer at a final concentration of 1% but it was not found to aid the solubilization of any of the fusion proteins. Cells were lysed by sonication and a freeze-thaw cycle. The lysed mixture was centrifuged for 10 minutes at 4°C at 12,000 g. The supernatant from this spin was taken as the soluble protein and the pellet was washed a further time in the lysis buffer before being resuspended in lysis buffer as the insoluble protein. For injection into mice or rabbits, the insoluble protein from SC-positive bacterial extracts was washed twice in cold PBS and resuspended in this same buffer at a concentration of 0.5 mg/ml. Analysis of fusion proteins Extracts of E. coli induced with IPTG and containing GST fusion proteins were analysed for the presence of SC antigens by western blotting. Soluble protein, insoluble protein or total protein were separated by SDS-PAGE (Laemmli, 1970) in 10% running gels with 4% stacking gels and with a 29:1 (w/w), acrylamide:bisacrylamide ratio. Of duplicate gels, one was stained with Coomassie Blue and protein molecular masses were estimated from the relative mobilities of standard proteins (Bio-Rad Low Molecular Weight Markers). The duplicate gels had Amersham Rainbow Molecular Weight Markers and they were transferred to nitrocellulose membranes for staining with anti-SC antibodies by standard protocols (Sambrook et al., 1989). Transfers were incubated with the primary anti-hamster SC serum originally used to detect the SC-positive clones in the Stratagene λZap expression library. SC-positive bacterial extracts were used to generate antibodies to fusion proteins in mice and rabbits. Prior to use, the SC-positive serum from mice injected with bacterial fusion proteins was incubated with E. coli extract (Promega) to remove anti-E. coli antibodies. These primary antibodies were diluted either 1/1000 or 1/3,000 in antibody dilution buffer (ADB) (10%, v/v, goat serum; 3%, w/v, BSA; 0.05%, v/v, Triton X-100 in PBS). Secondary antibody was a 1/3000 dilution of goat anti-rabbit or goat anti-mouse conjugated to alkaline phosphatase and the positive polypeptides were identified with the NBT-BCIP colour reaction (Sambrook et al., 1989). For Southwestern analysis, SDS-PAGE gels were electrophoresed as usual, washed with gentle shaking for 30 minutes in a large volume of transfer buffer (25 mM Tris, pH 8.3, 192 mM glycine, 20% methanol) to remove the SDS and partially renature the proteins prior to transfer to the nitrocellulose membrane. After transfer, filters were washed twice for 15 minutes in blocking-binding-wash buffer, BBW (3 g/l Ficoll, 3 g/l polyvinylpyrollidone, 10 mM NaCl, 20 mM Tris, pH 8) and were then incubated with 32P-radiolabelled probe DNA (1×108 cpm/µg) for 1 hour at room temperature in 1 ml of BBW at 107 cpm/ml as described by Mellor et al. (1985). Filters were subsequently washed for 2 hours at room temperature in BBW before being exposed to X-ray film. Probes were end-labelled by a fill-in reaction using Klenow polymerase according to Sambrook et al. (1989). Binding was stable up to 100 mM NaCl. Production of antibodies to fusion proteins Mice and rabbits with SC-negative preimmune serum were inoculated two or more times with a 1:1 mixture of 50 µg insoluble SC-positive E. coli extract (inclusion bodies; Meuwissen et al., 1992) with adjuvant per mouse per intraperitoneal injection, or 150 µg protein extract with adjuvant per rabbit per subcutaneous injection. Cor1a SC proteins 2751 protein extract proved toxic to mice at this level but was tolerated when injections were reduced to 5 µg doses. To enhance antibody production, Syn1 fusion proteins were incubated with rabbit anti-SC antibody for injection into rabbits and Cor1 fusion proteins with the original mouse anti-SC antibody for injection into mice. The immune sera were reacted with E. coli extract to remove anti-bacterial protein antibodies. The immune sera were tested at dilutions of 1/1,000 and 1/10,000 on surface-spread hamster, rat and mouse testicular cells, on cryosections of various body tissues, on western blots of spermatocyte nuclear proteins, and on western blots of bacterial extract producing GST protein to assure specificity for meiotic chromosome proteins. Immunocytology The procedures used for immunocytology of meiotic prophase chromosomes have been reported previously (Moens et al., 1987; Moens and Earnshaw, 1989). Briefly, for epifluorescence microscopy, testicular cells collected in MEM were surface-spread on a hypotonic salt solution, picked up on a glass multiwell slide, fixed in 1% paraformaldehyde, pH 8.2, twice for 3 minutes, rinsed in 0.4% PhotoFlo wetting agent, pH 8.0, briefly air-dried, washed in PBS with 10% ADB, and incubated with various primary antibodies on the individual wells overnight at 4°C. After washing, the material was exposed to secondary antibody for 1 hour at 37°C or a few hours at 20°C. After washing the material was covered with an antifading mounting agent containing 5 ng/ml of DAPI or propidium iodide and a coverslip. For electron microscopy, cells were picked up on plastic-coated glass slides. Treatment with 1 µg/ml of DNase I in MEM for 20 minutes at 20°C was found to improve accessibility of SC antigens. After immunostaining, the plastic film was floated off and EM grids were placed on the film. Contrast was enhanced by post-fixation in 1% osmium tetroxide after the cells (on nickel grids) were thoroughly dried for a day. For comparisons of SC dimensions in sectioned and surface-spread spermatocytes, the same staining protocol was used for both (saturated uranyl acetate, 10 minutes; lead citrate, 5 minutes). Double labelling of SC antigens was performed using mouse serum reactive with one of the antigens and rabbit serum specific for the other. The secondary antibodies were conjugated with either FITC or rhodamine for detection by epifluorescence or confocal microscopy. For electron microscopy, the antigens were differentiated with 5 nm and 15 nm gold-conjugated secondary antibodies. For anti-centromere antibody, we used a 1/1000 dilution of the centromere positive serum from a scleroderma (CREST) patient from a local rheumatology clinic. Secondary antibody was goat anti-human FITC conjugated at a 1/1000 dilution. Epitope mapping The positions of about 500 5-nm immunogold grains were determined for each of the antibodies to the fusion proteins. Electron micrographs were printed at a magnification of ×150,000 to ×170,000. The dimensions of the SC were measured at each gold grain position with a digitizer and entered in a computer. The measurements include the width of the osmium tetroxide-stained lateral elements, the total SC width, and the position of the grain relative to the SC. The computations accumulated the gold grain position in 5 nm classes across an SC of standardized size (40 nm wide lateral elements and an 80 nm distance between them) (Moens et al., 1987). The distribution of grains was printed as smoothed curves by Harvard Graphics software. Shadow-casting Surface-spread DNase-treated hamster spermatocytes on a plastic film- (<80 nm) covered glass slide were exposed to platinum or goldpalladium evaporated in vacuum from a glowing tungsten wire at an angle of about 7° to the plane of the slide. A fine grain was achieved by placing the slide on a metal block at −80°C with some insulation to delay cooling of the slide until the vacuum is established. The plastic film was floated off the glass slide and recovered on EM grids. Electron micrographs were printed at ×150,000 magnification and width measurements were made with a digitizer. RESULTS SYN1 and COR1 cDNAs Sequence analysis of the hamster cDNAs encoding Syn1a-d fusion proteins (accession number L32978; Moens et al., 1992) proved that these represent overlapping cDNAs of the hamster homologue of the rat SCP1 gene that encodes a 125 kDa SC protein (Meuwissen et al., 1992). The hamster and rat proteins are 90% identical. We therefore adopt for Syn1 the numbering of the SCP1 deduced amino acids and the designation of other motifs. Our various cDNA clones of SYN1 are the result of internal priming on A-rich sequences in the mRNA during the construction of the library. Clones a to d correspond to clones 15, 14, 17 and 16, respectively, in the report on the isolation of those clones (Table 1) (Moens et al., 1992). Three co-terminal overlapping cDNAs encoding the hamster meiotic chromosome core protein, Cor1, were isolated with the following lengths, 680 bp (COR1a), 795 bp (COR1b) and 1070 bp (COR1c). The longest open reading frame in this cDNA beginning at the first ATG and terminating with two adjacent TGA codons (Fig. 2) encodes a putative 234 amino acid protein with a predicted Mr of 27,134. This size is consistent with data from western blots of hamster SC proteins in which the antiCor1a antibody reacts with a polypeptide of approximately 30 kDa molecular mass. The longest cDNA also contains 81 5′ untranslated nucleotides, 260 3′ untranslated nucleotides with two potential poly A addition signals (AATAAA) and a poly A tail. Northern hybridization analysis using COR1 cDNA as probe, identifies an approximately 1150 nucleotide polyadenylated transcript in both hamster and rat. The predicted protein is glutamine-rich (12% Q), most of the Q residues being in the carboxyl-terminal half of the protein. Overall, the protein is hydrophobic, with 34% hydrophobic residues, 18% basic and 15% acidic amino acids. A search of the PROSITE data base (Bairock, 1992) indicates the Cor1 protein has a potential ATP/GTP-binding site motif A (P-loop), potential cAMP- and cGMP-dependent protein kinase C and casein kinase II phosphorylation sites, as well as potential N-myristoylation and amidation sites. Significant similarity exists in both nucleotide and amino acid sequence (40% identity) with a cDNA encoding a 208 amino acid protein called pM1, a member of an X-linked, lymphocyte-regulated family (XLR) of the mouse (Siegel et al., 1987). The Cor1 protein also shows 16% identity over a 203 amino acid stretch with skeletal muscle myosin heavy chain, while the XLR family of proteins has similar Table 1. Names and lengths of the Syn1 fusion proteins Name Nucleotides Syn1e Syn1d Syn1f Syn1c Syn1b Syn1a Syn1g 292-927 403-1678 643-1678 1003-2235 1298-2235 1513-2286 2200-(A)n Length (bp) 653 1275 1035 1232 937 773 Amino acids Old name 98-309 135-560 215-560 336-745 434-745 505-762 734-end HSC16 HSC12 HSC17 HSC14 HSC15 2752 M. J. Dobson and others identity with nuclear structural proteins lamins A and C, and the structural protein mouse epidermal keratin II, members of the intermediate filament family of proteins. Cor1 protein, like myosin heavy chains, intermediate filament proteins and the pM1 protein, is predicted to have regions of heptad repeats and is therefore likely to form coiled-coil structures. recognize a number of SC proteins including the 125 kDa Syn1 and 30 kDa Cor1 proteins (Fig. 3B lanes 6 and 7). To determine whether the Syn1 protein might display DNA binding activity, a western blot suitable for Southwestern analysis was prepared from an SDS-PAGE gel on which insoluble protein from E. coli expressing SYN1c, SYN1d and GST had been electrophoresed. The transfer was incubated with a 0.4 kb [32P]dATP-radiolabelled DNA fragment excised from SCB9, a rat DNA sequence originally cloned on the basis of its co-purification with rat SCs (Pearlman et al., 1992) (Fig. 3C). The multiple bands in the Syn1c and -d lanes correspond with immunoreactive labelled species in these two extracts (Fig. 3A). GST and bands representing other abundant E. coli proteins did not bind the radiolabelled DNA probe. The data suggest that the SC Syn1 protein has DNA binding capability. This binding capability, however, is not sequence-specific, since other DNA sequences such as the Syn1 and Cor1 fusion proteins Syn1 We constructed translational fusion proteins in pGEX-2T from four overlapping partial cDNA clones derived from the SYN1 gene. Analysis of the soluble, insoluble and total proteins from the E. coli (DH5aF′) transformants by SDS-PAGE and western blotting, shows that for all four, SC-antigenic material is produced mainly in the insoluble fraction. Shown in Fig. 3A is the total Coomassie-stained E. coli protein from strains carrying the SYN1 fusion constructs: a (lane 1), d (lane 2), c (lane 3); and from a strain carrying the parental pGEX-2T vector (lane CG -80 4). The predicted full-length fusion -1 proteins of 77 kDa (Syn1d, lane 2) CAAAGGCGCAGCCGGCTCAGAAGCGTCGAGGGAGCTGAGGCGTCGACCTCCGTCCCGGGCCGCTGAAGAAACTCTAAAG and 75 kDa (Syn1c, lane 3); are ATG GTG CCT GGT GGA AGA AAG CAC TCT GGG AAA TCT GGG AAG CCA CCA CTG GTG GAT CAG 60 clearly visible as are a truncated 32 M V P G G R K H S G K S G K P P L V D Q 20 kDa Syn1a fusion protein (lane 1) and GCT AAA ACA GCC TTT GAC TTT GAG AAA GAA GAT AAA GAA CTG AGT GGT TCA GAG GAG GAT 120 the 27 kDa GST protein (lane 4). A K T A F D F E K E D K E L S G S E E D 40 Lanes 5-8 are a western blot of lanes 1-4 visualized with antibody against GTT GCT GAT GAA AAG ACT CCA GTA ATT GAT AAA CAT GGA AAG AAA AGA TCT GGG GGA CTA 180 60 the fusion protein Syn1d produced in V A D E K T P V I D K H G K K R S G G L E. coli. Two E. coli proteins of GTT GAA GAT GTG GGA GGT GAA GTA CAG AAT ATG CTG GAA AAA TTT GGA GCT GAC ATT AAC 240 80 approximately 73 and 37 kDa stain V E D V G G E V Q N M L E K F G A D I N quite strongly with this and other AAA GCT CTT CTT GCC AAG AGA AAA AGA ATT GAA ATG TAT ACC AAA GCT TCT TTC AAA GCC 300 antibodies against fusion proteins, but K A L L A K R K R I E M Y T K A S F K A 100 this antibody does not recognize the GST segment of the fusion proteins AGT AAC CAG AAA ATT GAG CAA ATT TGG AAA ACA CAA CAA GAA GAA ATA CAG AAG CTT AAC 360 S N Q K I E Q I W K T Q Q E E I Q K L N 120 (Fig. 3A, lane 8). Other strongly staining bands in lanes 5-7 represent AGT GAA TAT TCT CAG CAA TTT ATG AGT GTG TTG CAG CAG TGG GAA CTG GAT ATG CAG AAA 420 140 full-length or truncated Syn1 fusion S E Y S Q Q F M S V L Q Q W E L D M Q K proteins. This is confirmed in the TTT GAG GAA CAA GGA GAA AAA CTA ACT AAT CTT TTT CGA CAA CAA CAG AAG ATT TTT CAG 480 western blot shown in Fig. 3A, lanes F E E Q G E K L T N L F R Q Q Q K I F Q 160 9 (pGEX-2T), 10 (Syn1c), 11 TCT AGA ATT GTT CAG AGC CAG AGA CTG AAA GCA ATC AAA CAG CTA CAT GAG CAG TTC 540 (Syn1d) and 12 (Syn1a), visualized CAG Q S R I V Q S Q R L K A I K Q L H E Q F 180 with anti-GST antibody. In protein produced from an E. coli strain ATA AAG AAT TTG GAG GAT GTG GAG AAA AAT AAT GAT AAT CTA TTT ACT GGC ACA CAA AGT 600 200 carrying pGEX-2T, only the 27 kDa I K N L E D V E K N N D N L F T G T Q S GST protein and an approximately 73 GAA CTT AAA AAA GAA ATG GCA ATG TTG CAA AAA AAA GTT ATG ATG GAA ACT CAG CAG CAA 660 220 kDa E. coli protein are visualized E L K K E M A M L Q K K V M M E T Q Q Q (lane 9). Fusion proteins visualized GAG ATG GCA AAT GTT CGA AAG TCT CTT CAA TCC ATG TTA TTC TGA TGA GTCTTTGAAGAAAGA 723 by the anti-GST antibody (Fig. 3A, E M A N V R K S L Q S M L F * * 234 lanes 12, 11, 10) are the same as those recognized by the anti-Syn1d fusion ACTTGAACCTATGTAATATATGATACAGTTAAAACATTATCTATGAGGCATGCCTATAGAAAGTATACTTTGAACTATA 802 protein antibody (Fig. 3A, lanes 5, 6, ACATTCATAACCATAGCTTGTTTAAGTGGAAGACTTCTGTTCCTGTTAACTTTTAAATAAAACTTAACAGCTGTATAAG 881 7), demonstrating that antibodies against different epitopes of the TAGCAGCTATTTCAGTGTATCAAGCTTTCAACTCTTATAATAGTGAATTGTTTGCTACTATTGTGTCAATAAAAATGAT 960 fusion proteins recognize the same TTAAATTTA(A)n 969 fusion proteins. Antibodies against the Syn1 fusion proteins also Fig. 2. Nucleotide sequence of the cDNA encoding the hamster Cor1 (30/33 kDa) protein and the recognize predominantly the 125 kDa derived amino acid sequence (single letter designation). The cDNA sequence (upper line) is 1050 Syn1 protein in western blots of nucleotides up to the first A in the poly A sequence. The derived amino acid sequence (lower line) hamster testicular extracts (Fig. 3B, begins at the first M in the longest open reading frame and terminates with adjacent TGA codons lanes 2-5) while the original sera used (*). A perfect match to a nucleotide (ATP/GTP) binding site motif A (P-loop) is underlined. The to screen the cDNA libraries accession number for this sequence is X77371. SC proteins 2753 A Fig. 3. (A) SDS-PAGE (Coomassie Blue, lanes 1-4) and western blots (lanes 5-12) from total protein from E. coli expressing Syn1GST fusion proteins or GST protein. Equal amounts of protein from IPTG-induced E. coli were loaded on an SDS-polyacrylamide gel as follows: lane 1, construct carrying the Syn1a fusion (major stained induced protein, 32 kDa); lane 2, construct carrying the Syn1d fusion (major stained induced protein, 77 kDa, 50 + 27 GST); lane 3, construct carrying the Syn1c fusion (major stained induced protein, 75 kDa, 48 + 27 GST); and lane 4, construct carrying parental vector pGEX-2T, which expresses GST (27 kDa) but no Syn1 protein. Lanes 5-8 are a western blot of the gel probed with a 1/3000 dilution of serum from a mouse inoculated with Syn1d-GST fusion protein (inclusion bodies) produced in E. coli. An additional gel with the same C B amounts of protein as on lanes 1-4 (lane 9, pGEX-2T vector; lane 10, Syn1c-GST fusion; lane 11, Syn1d-GST fusion; and lane 12, Syn1a-GST fusion), was electrophoresed, blotted to nitrocellulose and probed with antiGST antibody prepared in goat (Pharmacia). Lane M between lanes 4 and 5 contains low molecular mass markers (Bio-Rad); and lane M between lanes 8 and 9 contains rainbow markers (Amersham). Sizes in kDa are indicated. (B) Western blot of proteins from hamster testicular nuclei separated by SDSpolyacrylamide gel electrophoresis (Coomassie Blue, lane 1) and probed with D antibodies generated in mice against Syn1GST fusion proteins expressed in E. coli or with antibodies produced in rabbits against purified hamster synaptonemal complexes. Lane 2, mouse anti-Syn1b antibody; lane 3, mouse anti-Syn1a antibody; lane 4, mouse anti-Syn1d antibody; lane 5, mouse antiSyn1c antibody; lane 6, rabbit B anti-SC antibody; and lane 7, rabbit D anti-SC antibody (Moens et al., 1992). Sizes in kDa are indicated. (C) Southwestern analysis of the Syn1c (lane 1) and -d (lane 2) fusion protein extracts. Lane 3, pGEX-2T extract. Probe is rat DNA, sequence SCB9, known to be tightly associated with rat SCs (Pearlman et al., 1992). Sizes of immunoreactive Syn1c (75 kDa) and Syn1d (77 kDa) proteins (B and C) are given (arrows). (D) SDS-polyacrylamide gel (Coomassie Blue, lanes 1 and 2) and western blot (lanes 3 and 4) from insoluble protein from E. coli expressing the Cor1a-GST fusion protein. Lane 1, 42 kDa Cor1a-GST fusion protein; lane 2, 27 kDa GST; lane 3, western blot of lane 1; lane 3, western blot of lane 2 using rabbit antiSC antibody. Size markers (thin arrows), the 42 kDa Cor1a-GST fusion protein and the 27 kDa GST protein (thick arrows) are indicated. 375 bp EcoRI/BamHI fragment from pBR322 are also bound by Syn1 (not shown). Cor1 Six independent cDNA fragments of this gene, all initiated at the 3′ poly A tail, were isolated in multiple screening of the hamster cDNA library and excised as Bluescript plasmids. Of these, the longest fragments were apparently unclonable as inframe translational fusions in the pGEX-2T vector. Inserts were recovered in the reverse orientation, however, suggesting that the longer Cor1 fusion constructs may be toxic to the E. coli host. The only cDNA to be subcloned in the correct orientation was COR1a, which encodes the carboxyl half of the protein. Electrophoresis of protein extracts from this transformant on SDS-PAGE gels showed that a fusion protein of the expected size was produced predominantly in the insoluble fraction (Fig. 3D). Antigen occurrence and localization The polyclonal antibodies against the Syn1 and Cor1 fusion proteins are specific for meiotic chromosome antigens (cores, lateral domains, centromere regions and synapsed regions). 2754 M. J. Dobson and others Fig. 4. Progression of chromosome synapsis at meiotic prophase in hamster spermatocytes is visualized with differential immunolabelling of the core and synaptic proteins. For A, C and E the primary antibody is mouse anti-Cor1a and the secondary antibody is rhodamine-conjugated goat anti-mouse IgG. For B, D and F the primary antibody is rabbit anti-Syn1c and the secondary antibody is FITC-conjugated goat anti-rabbit IgG. Bar, 10 µm. (A,B) The earliest stage of chromosome synapsis, zygotene. The cores in A are mostly single except for a few synapsed regions shown in B. Three synapsed regions are already quite lengthy and it appears that the extension of synapsis is rapid relative to the establishment of new initiation sites. (C,D) Midway through the zygotene stage there is extensive synapsis. (E,F) The cores are completely synapsed and the image of the Cor1 protein now coincide with the image of the Syn1 protein. Aggregates of Cor1 protein, separate from the SCs, are present at early pachytene, E (arrow), but not at later stages. At the resolution of the epifluorescence microscope, the antibodies to the several Syn1 fusion proteins give the same image. SC proteins 2755 Cryosections of hamster body tissues are negative, with the exception of testes where the spermatocyte nuclei are positive (Fig. 5). Details of the occurrence and location of meiotic chromosome antigens was obtained from surface-spread spermatocyte preparations. The Cor1 antigen is first detected when the cores are still largely unpaired at the leptotene-zygotene stages of meiotic prophase (Fig. 4A). In those cells the Syn1 antigen is present where cores from homologous chromosomes have synapsed (Fig. 4B). Although there are few such regions at early zygotene, they are already quite long, indicating that synapsis is rapid relative to the establishment of new pairing sites. As synapsis progresses, the number of single cores is reduced (Fig. 4C, anti-Cor1), while the synapsed regions are longer and more numerous (Fig. 4D, anti Syn1). The images of the core and synaptic antigens are identical when all chromosomes are fully synapsed (Fig. 4E and F), with the exception of some aggregates of core antigen at early pachytene (Fig. 4E, arrow). At diplotene, the cores separate and the Syn1 antigen is present only at the remaining points of contact (Fig. 6A; Cor1 antigen is red, the Syn1 antigen is green but appears yellow when overlapped with red). The presence of one or two small pairing regions for each of the 20 bivalents gives a noticeably different staining pattern from the early zygotene configuration where there are relatively few but long pairing regions. Therefore the staging of these cell types is unambiguous. At metaphase I substantial amounts of Cor1 antigen colocalize with each of the 40 double centromeres identified by CREST immunostaining and small amounts of Cor1 antigen are present along the long axis of the chromosomes. In Fig. 6B the metaphase I bivalents are stained fluorescent blue with DAPI and the Cor1 antigen is fluorescent red. The same nucleus in Fig. 6C demonstrates the centromere positions that coincide with the Cor1 positive regions in Fig. 6B. One of the doubled centromeres is indicated by a double bar. At anaphase II the 20 double centromeres separate leaving the Cor1 antigen behind (Fig. 6D; centromeres in green and Cor1 antigen in red). Cor1 antigen can be detected in later stage spermatids but they are no longer associated with the kinetochores. Epitope mapping Syn1a (aa 505-762) and Syn1b (aa 434-745) Polyclonal antibodies are against the carboxyl region of the SYN1 gene product (Table 1). The mode and mean of the gold grain distribution are at the inner edge of the lateral element as defined by osmium tetroxide staining (Fig. 7). The distribution of grains to either side of the mean can be attributed, in part, to the size of the antibodies, the size of the gold grain, and the unbiased error of each measurement. About 50% of the grains are over the central region (Table 2). Syn1b is detected marginally more towards the centre of the SC, concomitant with an additional 71 amino acids towards the amino terminus of Syn1. Both these fusions lack the Syn1 leucine zipper domain. Syn1c (aa 336-745) and Syn1d (aa 135-560) The carboxyl end of Syn1c is identical to Syn1b but there are 100 additional amino acids towards the amino end, including eight heptad repeats of the leucine zipper motif. Relative to Syn1a and -b, the mode and mean of the gold grain distribution are shifted more than 10 nm towards the centre of the SC and some 70% of the grains are over the central region (Table Table 2. Numerical values of the gold grain distributions shown in Fig. 7 Percentage of grains Antigen Mode (nm) Mean (nm) Outside LE* Central Syn1a Syn1b Syn1c Syn1d 35-40 30-40 20-25 20-30 44.67 44.56 31.45 28.55 11.14 10.57 3.46 2.75 38.39 40.38 22.63 16.28 50.47 49.06 73.90 80.97 Cor1a 80-90 71.89 45.72 39.12 15.16 For each of the anti-fusion protein antibodies the positions of 400-500 grains were digitized and computationally accumulated (Moens et al., 1987). *Lateral element. 2). This portion of the Syn1 protein appears to occupy a position in the central region of the SC, about 20-25 nm from the middle of the SC (Fig. 7). Compared to Syn1c, Syn1d lacks 185 amino acids at the carboxyl end and has an additional 201 amino acids at the amino end. It includes the complete leucine zipper motif. The mode and mean of the immunogold grain distribution are similar to that of Syn1c, shifted slightly more towards the centre of the SC. Approximately 80% of the grains are over the central region of the SC (Table 2). Cor1a The Cor1a fusion protein contains a 130 amino acid carboxylterminal fragment of the Cor1 protein. The immunogold detects the Cor1 antigen in a broad lateral domain of the SC (Figs 7, 8B). This distribution is much broader than the conventional lateral element as visualized with electron-dense stains (Fig. 8A,B). The distribution coincides with the dimensions of the shadow-cast image of the lateral domain (Fig. 8C,D). SC dimensions Electron micrographs of sectioned or surface-spread meiotic prophase cells stained with electron-dense stains (uranyl acetate, lead citrate, osmium tetroxide or phosphotungstic acid) reveal lateral elements of about 47±6 nm width and a central region of 100±25 nm, for a total width of about 194±13 nm (60 OsO4-stained SCs measured, ± standard error) (Fig. 8A,B). Different dimensions are apparent in electron micrographs of shadow-cast SC preparations (Fig. 8C, D). The lateral domains are considerably wider, on average about 110 nm (range 80170 nm), and the central region is narrower, on average only 50 nm, and the total width is approximately 260 nm. The cores and the lateral elements that react with metal ions appear to be an internal component of the lateral domain. The broad lateral domain as seen in shadow-cast images corresponds to the structure detected by antibodies to the chromosome core protein, Cor1a, where the major portion of the immuno-gold grains cover a lateral domain of about 100 nm in width (Table 2, Figs 7, 8B,D). DISCUSSION SC dimensions The substructure of the SC as it is disclosed by antibody epitope mapping and shadow-casting shows noticeable differ- 2756 M. J. Dobson and others ences from the standard descriptions of SCs, which are based on electron microscopy of SCs stained with metal ions (tungsten, lead, uranium, osmium). For the rat, mouse and hamster, the electron-dense lateral elements are about 50 nm 6 6 wide, separated by a central region of about 80-100 nm. This image leads to the expectation that the structural components of the central region abut the distinctive lateral elements. Antibodies against the carboxyl end of hamster chromosome-core 6 SC proteins 2757 protein 1, Cor1, indicate a much broader lateral element domain than is apparent in the traditional electron-dense lateral element of rodents (Figs 7, 8, Table 2). The gold grain distribution extends some 40 nm to the outside of the dense lateral element. That lateral element domains are indeed broader than is apparent from electron microscopy of metal-ion-stained lateral elements is further evident from shadow-cast preparations, which show that the chromosome cores and the lateral domains are about twice as broad as the metal-ion-stained electron-dense lateral elements (Fig. 8). The broader dimension is in part at the expense of the central region, which becomes narrower, and in part due to a widening of the SC from approximately 200 nm to 260 nm or more. A mode of the gold grain distribution to the outside of the lateral element has also been observed for the 190 kDa lateral element protein (C. Heyting and E. Hartsuiker, personal communication). ApparFig. 5. A cryosection of hamster testicular tubules immunostained with antibody to Syn1c fusion protein and stained with the DNA binding stain propidium iodide. The FITC-conjugated secondary antibody marks the SCs of the spermatocytes in green. Other spermatogenic and non-spermatogenic nuclei are red and lack the Syn1 antigen. Fig. 6. Chromosome disjunction. (A) Cor1 antigen in red (rhodamine fluorescence), Syn1 antigen in green (FITC fluorescence), and overlapping areas in yellow. Surface-spread mouse spermatocyte. At diplotene the chromosomes separate but remain attached at a few points, the chiasmata, presumably the sites of crossovers. The Syn1 antigen gradually disappears, lastly from the chiasmata sites. The Cor1 antigen remains present axial to each chromosome. (B) Cor1 antigen in red (rhodamine fluorescence), chromatin in blue (DAPI fluorescence). At metaphase I most of the Cor1 antigen co-locates with the 40 doubled centromeres while small amounts are present along the chromosome axes. The X-chromosome (x) retains more Cor1 antigen than the other chromosomes. Bar, 10 µm. (C) The same nucleus as in B immunostained with human anti-centromere CREST serum and FITC-conjugated secondary antibody. The corresponding centromeres in B and C are marked (c). A doubled centromere is marked with two short bars. The superimposed FITC and DAPI images are slightly offset. (D) Cor1 antigen red, centromeres green (FITC fluorescence). The association between centromeres and Cor1 antigen persists till anaphase II at which time the sister centromeres separate and the Cor1 antigen appears to lag between the separating centromeres. Fig. 7. Distributions of 5 nm immune gold grains over hamster SCs detected by polyclonal antibodies to Syn1 and Cor1 fusion proteins. Since the SC is bilaterally symmetrical, only one half of the SC is shown, with position 0 nm in the centre and position 140 nm on the outside. The positions of the electron-dense lateral element and the broader lateral domain are marked as such. Computation adjusts all measurements to an arbitrary standard SC (central region 80 nm, lateral element 40 nm). The Syn1 fusion proteins to which the antibodies were made are defined by the amino acid numbers starting at the amino end of the protein (Meuwissen et al., 1992) and are shown diagrammatically at the top of the graph. The region of the leucine zipper in 1c and 1d is an open rectangle. The graph demonstrates that the peaks of the gold grain distributions shift from a central position to a lateral position as the fusion protein fragments shift from the amino to the carboxyl end of the protein. It is concluded that Syn1 is oriented with the amino end towards the centre and the carboxy end extends into the lateral domain. The graph also demonstrates that the method is sensitive to shifts of a few nanometres in the antigen location. Polyclonal antibodies to the carboxy end of Cor1 detect a broad lateral domain of the SC (purple curve, Cor 1a). ently, traditional EM staining with metal ions has visualized only a specific portion of the lateral domain. The implication of these new dimensions is that the proteins that comprise the synaptic domain have a greater degree of overlap with the protein constituents of the lateral domains of the SC than was apparent from earlier observations. This arrangement suggests that direct interactions might be expected between some of the SC proteins. The availability of SC protein-encoding genes will allow in vitro assessment of potential protein-protein interactions. Epitope mapping The characteristics of SCP1, the rat homologue of the hamster synaptic protein Syn1, have been reported by Meuwissen et al. (1992). It is predicted to consist of 946 amino acids and has long regions that show sequence similarity to the coiled-coil region of the myosin heavy chain. In addition, there is a leucine zipper, DNA binding motifs, and potential target sites for P34cdc2 protein kinase (Meuwissen et al., 1992). The published numbering of the SCP1 amino acid sequence is used here to identify the hamster fusion proteins Syn1a to -d in Table 1, and in Fig. 7. It is clear from Fig. 7 that each extension of the fusion protein in the direction of the amino end of the Syn1 protein coincides with a displacement of the peak of the gold grain distribution towards the centre of the SC. The polyclonal antibodies against the fusion protein products of these four cDNA fragments demonstrate that the Syn1 protein is oriented with the amino end towards the centre of the SC and with the carboxyl end extending into the lateral domain. The orientation agrees with the more general observation of Meuwissen et al. (1992) that a monoclonal antibody against an epitope at the carboxyl end of rat synaptic protein SCP1 produces a gold grain distribution that is closer to the lateral element than that of a polyclonal antibody against SCP1 as a whole. A different synaptic protein, Zip1, has been identified in the yeast, S. cerevisiae. Sym et al. (1993) calculated that the 875 amino acid Zip1 is sufficiently long to span the distance between the lateral elements. The in vivo significance of the apparent DNA binding characteristics of the Syn1 protein, indicated by the DNA binding motifs (Meuwissen et al., 1992) and the non-specific DNA binding in Southwestern blots of the Syn1 fusion proteins reported here (Fig. 3D), remains to be determined. Traditionally, the chromosome cores are thought to be the binding sites for the chromatin loops because the meiotic prophase chromosomes usually acquire their cores before synapsis. At a later stage, when the homologous cores are being aligned, the synaptic protein becomes part of the SC. The deduced amino acid sequence of Cor1 (Fig. 2) does not have a recognizable DNA binding motif. DNA binding may be the function of other core proteins. A nucleotide (ATP/GTP) binding site motif may be of functional significance as might putative cAMP- and cGMP-dependent, protein kinase C and casein kinase II phosphorylation sites. The rat homologue of the COR1 gene, SCP3, has also recently been cloned (C. Heyting, personal communication). Cor1 antigens in rodent spermatocyte nuclei can occur outside the context of the chromosome core or SC. At the time that chromosome synapsis is being completed there are small aggregates of antigen among the SCs but not necessarily connected to the SCs (Fig. 4E). Such extra-SC material has 2758 M. J. Dobson and others Fig. 8. SC ultrastructural dimensions revealed by different techniques. Bar, 200 nm. (A) A thin section stained with uranyl acetate and lead citrate. Typically, the lateral elements are rather narrow, about 40 nm, while there is a wide central region of about 80-100 nm. (B) In surfacespread preparations, the uranyl/lead-stained lateral elements are similar in width and spacing to the sectioned material in (A), but the distribution of the Cor1 antigen detected by the 5 nm gold grains betrays a wider lateral domain, particularly to the outside of the lateral element. (C) The greater width of the lateral domain is also evident in shadow-cast preparations of surface-spread SCs. As a result, the SC as a whole is wider and the space between the lateral domains is reduced, leaving room only for the central element. (D) The coincidence of the immuno-stained (5 nm gold grains) lateral domains and the shadow-cast image is apparent in this diplotene SC where the chromosome cores are starting to separate. The implication is that there is a considerable overlap between locations of the core and the synaptic proteins. Fig. 9. A summary diagram of the positions of core and synaptic proteins in the SC. No details of the protein structures, their interactions and association with chromatin are known as yet. been observed in several organisms and has been associated with the self-assembly of excess SC material; for example, in pachytene-arrested yeast mutants (Moens and Kundu, 1982). The structural aspects of the SC are summarized in Fig. 9, an elaboration of Fig. 1. The Syn protein is shown extending from the middle of the SC out into the lateral domain. Alternative arrangements, such as a Syn1 protein that bridges the entire distance between the lateral elements or a bidirectional orientation of the Syn1 protein, are not supported by the evidence shown in Fig. 7. The binding of DNA to the Syn1 protein is not addressed in the diagram. It is clear, however, from a separate study that combines SC immunofluorescence with in situ hybrization of probe that is specific for a 2 Mb phage DNA insert on mouse chromosome no. 4, that the DNA loops attach to the SC (Heng et al., 1994), but the details of the attachment are not clear as yet. Since the chromatin becomes attached to the cores before Syn1 is associated with the cores, the diagram shows chromatin attached to the lateral domain proteins. The known lateral domain proteins of rodents such as SCP2 (190 kDa) (E. Hartsuiker and C. Heyting, SC proteins 2759 personal communication) and Cor1 all have a broad distribution that exceeds the more narrow lateral element as seen with electron-dense stains. The implication is that synaptic and core proteins have a broad region of overlap. No antibodies that recognize the central element have been reported to date, nor any antibodies against the SC-associated dense nodes, some of which may be implicated in reciprocal crossovers (Carpenter, 1975; Albini and Jones, 1988). Chromosome synapsis Using antibodies raised in different hosts against various meiotic chromosome components, the temporal and spacial relationships of cores, lateral domain proteins and synaptic proteins can be visualized simultaneously with two-colour immuno-labelling for epifluorescence microscopy or by differential immunogold labelling for electron microscopy. At the onset of chromosome synapsis (Fig. 4A), there are predominantly unpaired chromosome cores (Cor1) and a few synapsed regions (Fig. 4B, Syn1). There are relatively few synapsed regions but the ones that are there are already fairly lengthy, about 5 µm, indicating that the progression of synapsis is rapid relative to the rate with which new initiation sites are established. The same conclusion holds for later zygotene (Fig. 4C,D) where synapsis is more advanced. It has been argued that the initial sites of pairing require homology recognition and may represent potential sites of genetic recombination (Radman and Wagner, 1993; review, Moens, 1994). The extension of synapsis may be less dependent on homology than initiation of synapsis. The rapid, possibly non-homologous, extension of SCs observed here may be the mechanism that forestalls additional homology searches near an initiation site and thereby provides a mechanism for positive recombination interference. In support of such a mechanism is the observation that in organisms with limited SC formation, such as Schizosaccharomyces pombe, or with faulty SC formation as in asynaptic meiosis, positive genetic interference tends to be absent or reduced (Bahler et al., 1992; Havekes, 1992; Moens, 1969). The use of two-colour immune-staining permits an efficient quantification of the process of chromosome synapsis at meiotic prophase but is beyond the scope of the present report. Chromosome disjunction At anaphase of mitosis sister chromatids separate, but at anaphase I of meiosis the sister chromatids remain associated at their centromeres and chromosomes rather than chromatids segregate. Regular chromosome disjunction at meiosis I of most sexually reproducing organisms is thought to depend on at least two mechanisms: chiasma maintenance and sister kinetochore cohesion. Observations on the orientation of acentric fragments that result from a crossover in an inversion in maize meiosis has lead Maguire (1993) to a preference for sister chromatid cohesion as one of the main factors responsible for the maintenance of chiasmata (reciprocal cross-over). She proposes that SC components are likely candidates for sister chromatid cohesion at metaphase I. The presence of SC components axial to the sister chromatids was demonstrated by electron microscopy of serially sectioned grasshopper metaphase I chromosomes (Moens and Church, 1979). Here we report the presence of Cor1 protein in the metaphase chromosome I axis (Fig. 6B). Because the Cor1 protein is associ- ated with sister chromatids throughout prophase we assume that Cor1 continues in that role during metaphase I, thereby giving support to the suggested function for SC components in sister chromatid cohesion and chiasma maintenance. The axis of the X chromosome has more Cor1 antigen than the autosomes (Fig. 6B). Most of the Cor1 antigen at metaphase I occurs in association with the pairs of sister kinetochores (Fig. 6B, C). Here, too, the Cor1 protein may function as a cohesive element between the sister kinetochores. As such, it can contribute to the mechanism for chromosome, rather than chromatid, segregation at anaphase I. The finding that the Cor1 protein lags between the separating sister kinetochores at anaphase II (Fig. 6D) and that it has not been observed in association with mitotic metaphase centromeres, further supports the suggested function of Cor1 in sister kinetochore cohesion at meiotic metaphase I/anaphase I. The loss of a kinetochore-associated protein at anaphase is not uncommon (for reviews see Earnshaw and Bernat, 1991; Rattner, 1992). The observed presence of a silverstained centromeric filament at metaphase I/anaphase I in a number of mammalian species also led Solari and Tandler (1991) to the conclusion that the sister kinetochores remain joined together and co-oriented by this SC remnant. The research was supported by grants from NSERC to R.E.P. and P.B.M. We gratefully acknowledge the technical assistance of Nora Tsao and Anita Samardzic with the molecular biology, and thank Mary Lou Ashton for help with the confocal and electron microscopy. REFERENCES Albini, S. M. and Jones, G. H. (1988). Synaptonemal complex spreading in Allium cepa and A. fistulosum. II. Pachytene observations: the SC karyotype and the correspondence of late recombination nodules and chiasma. Genome 30, 399-410. Bahler, J., Wyler, T. G., Loidl, J. and Kohli, J. (1992). Unusual nuclear structure in meiotic prophase of fission yeast: a cytological approach. J. Cell Biol. 121, 241-256. Bairoch, A. (1992). PROSITE: A dictionary of sites and patterns in proteins. Nucl. Acids Res. 20 (suppl.), 2013-2018. Carpenter, A. T. C. (1975). Electron microscopy of meiosis in Drosophila melanogaster females. I. The RN - a recombination-associated structure at pachytene? Proc. Nat. Acad. Sci. USA 72, 3186-3189. Chen, Q., Pearlman, R. E. and Moens, P. B. (1992). Isolation and characterization of a gene encoding a protein of the rat synaptonemal complex. Biochem. Cell Biol. 70, 1030-1038. Earnshaw, W. C. and Bernat, R. L. (1991). Chromosomal passengers: Towards an integrated view of mitosis. Chromosoma 100, 139-146. Havekes, F. (1992). Chromosome pairing and recombination in synaptic mutants of tomato. Boone Chromosome Conf. III, Boone, NC. Heng, H. H. Q., Tsui, L-C. and Moens, P. B. (1994). Visualizing chromosome condensation: Combined fluorescent immune-staining and in situ hybridization. Chromosoma (in press). Heyting, C., Moens, P. B., van Raamsdonk, W., Dietrich, A. J. J., Vink, A. C. G., Redeker, E. J. W. (1987). Identification of two major components of the lateral elements of synaptonemal complexes of the rat. Eur. J. Cell Biol. 43, 148-154. Heyting, C., Dietrich, A. J. J., Moens, P. B., Dettmers, R. J. Offenberg, H. H., Redeker, E. J. W. and Vink, A. C. G. (1988). Synaptonemal complex proteins. Genome 31, 81-87. Heyting, C. and Dietrich, A. J. J. (1991). Meiotic chromosome preparation and protein labelling. Functional Organization of the Nucleus, A Laboratory Guide. Meth. Cell Biol. (ed. B. A. Hamkalo and S. C. R. Elgin), vol. 35, pp. 177-202. Academic Press, San Diego. Hollingsworth, N. M., Goetsch, L. and Byers, B. (1990). The HOP1 gene encodes a meiosis-specific component of yeast chromosomes. Cell 61, 7384. 2760 M. J. Dobson and others Klein, F., Laroche, T., Cardenas, M. E., Hofmann, J. F.-X., Schweizer, D. and Gasser, S. M. (1992). Localization of RAP1 and topoisomerase II in nuclei and meiotic chromosomes of yeast. J. Cell Biol. 117, 935-948. Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. Maguire, M. P. (1993). Sister chromatid association at meiosis. Maydica 38, 93-106. Mellor, J., Fulton, A. M., Dobson, M. J., Roberts, N. A., Wilson, W., Kingsman, A. J. and Kingsman, S. M. (1985). The Ty transposon of Saccharomyces cerevisiae determines the synthesis of at least three proteins. Nucl. Acids Res. 13, 6249-6263. Meuwissen, R. L. J., Offenberg, H. H., Dietrich, A. J. J., Riesewijk, A., van Iersel, M. and Heyting, C. (1992). A coiled-coil related protein specific for synapsed regions of meiotic prophase chromosomes. EMBO J. 11, 50915100. Moens, P. B. (1969). Genetic and cytological effects of three desynaptic genes in the tomato. Can. J. Gen. Cytol. 11, 857-869. Moens, P. B. and Church, K. (1979). The distribution of synaptonemal complex material in metaphase I bivalents in Locusta and Chloealtis (Orthroptera: Acrididae). Chromosoma 73, 117-134. Moens, P. B. and Kundu, S. C. (1982). Meiotic arrest and synaptonemal complexes in yeast ts spo 10 (Saccharomyces cerevisiae). Can. J. Biochem. 60, 284-289. Moens, P. B., Heyting, C., Dietrich, A. J. J., van Raamsdonk, W. and Chen, Q. (1987). Synaptonemal complex antigen localization and conservation. J. Cell Biol. 105, 93-103. Moens, P. B. and Earnshaw, W. C. (1989). Anti-topoisomerase II recognizes meiotic chromosome cores. Chromosoma 98, 317-322. Moens, P. B., Spyropoulos, B., Dobson, M. J., Karaiskakis, A. and Pearlman, R. E. (1992). Searching for synaptonemal complex proteins and their genes. Dev. Genet. 13, 435-439. Moens, P. B. (1994). Molecular perspectives of chromosome pairing at meiosis. BioEssays 16, 101-106. Pearlman, R. E. Tsao, N. and Moens, P. B. (1992). Synaptonemal complexes from DNase-treated rat pachytene chromosomes contain (GT)n and LINE sequences, but no MARs/SARs. Genetics 130, 865-872. Radman, M. and Wagner, R. (1993). Mismatch recognition in chromosomal interactions and speciation. Chromosoma 102, 369-373. Rattner, J. B. (1992). Integrating chromosome structure with function. Chromosoma 101, 259-264. Rose, D., Thomas, W. and Holm, C. (1990). Segregation of recombined chromosomes in meiosis I requires DNA topoisomerase II. Cell 60, 10091017. Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. Sanger, F., Nicklen, S. and Coulson, A. R. (1977). DNA sequencing with chain terminating inhibitors. Proc. Nat. Acad. Sci. USA 74, 5463-5467. Siegel, J. N., Turner, C. A., Klinman, D. M., Wilkinson, M., Steinberg, A. D., MacLeod, C. L., Paul, W. E., Davis, M. M. and Cohen, D. I. (1987). Sequence analysis and expression of an X-linked, lymphocyte-regulated gene family (XLR). J. Exp. Med. 166, 1702-1715. Smith, A. and Benevente, R. (1992). Identification of a structural protein component of rat synaptonemal complexes. Exp. Cell Res. 198, 291-297. Solari, A. J. and Tandler, C. J. (1991). Presence of a centromeric filament during meiosis. Genome 34, 888-894. Sym, M., Engebrecht, J. and Roeder, G. S. (1993). ZIP1 is a synaptonemal complex protein required for meiotic chromosome synapsis. Cell 72, 365378. von Wettstein, D. (1977). The assembly of the synaptonemal complex. Phil. Trans. R. Soc. London Ser. B 277, 235-243. von Wettstein, D, Rasmussen, S. W. and Holm, P. B. (1984). The synaptonemal complex in genetic segregation. Annu. Rev. Genet. 18, 331431. (Received 25 January 1994 - Accepted, in revised form, 6 June 1994)