Download Designing and making sgRNA constructs

Cornell University Transgenic Core
CRISPR/Cas9 Genome editing
Figure 1. From Staying on target with CRISPR-Cas . Dana Carroll , Nature Biotechnology 31,807–809 (2013).
A. sgRNA design
sgRNA (sg = short guide) directs the Cas9 nuclease to a cleavage site in the genome.
sgRNA must match a 20 nt target sequence (protospacer sequence) in the genomic DNA and
must be followed by a protospacer adjacent motif (PAM) sequence of NGG (see Figs. 1,2).
This NGG motif is essential for DNA cleavage. The PAM site is not included in the sgRNA
sequence. The 12nt preceding the PAM is called the "seed" sequence; it is necessary for
efficient cleavage. A perfect match between your seed sequence and non-target loci should
be avoided when designing sgRNAs. Mismatches close to PAM site usually abolish DNA
cleavage.
NNNNNNNNNNNNNNNNNNNN
5’-----------NGG-----------3’-----------NCC-----------NNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN------Figure 2. sgRNA target sequence underlined. 12nt seed sequence is highlighted in yellow. Perfect match is
necessary for efficient cleavage.
The Cas9 nuclease generates a DNA Double Strand Break (DSB). DSBs are most efficiently
repaired by Non Homologous End Joining (NHEJ) creating InDels (Insertions/Deletions).
DSBs can be also repaired by Homology Directed Repair (HR) to introduce precise sequence
changes (editing). However, when using Cas9 nuclease, InDels are more common than
editing. To avoid InDels, Cas9 D10A nickase can be used. Nickase generates a Single
Strand Break (SSB) or nick which is repaired by HR, however editing efficiency can be low.
To off-target InDels, a double nicking strategy can be applied which also generates DSBs
(see Ran et al. Cell. 2013 Sep 12. )
Cornell University Transgenic Core
CRISPR/Cas9 Genome editing
Useful sites for sgRNA design and off-target testing
• http://www.genome-engineering.org/crispr/?page_id=41
• http://www.addgene.org/CRISPR/guide/
• http://crispr.mit.edu/
To find predesigned sets of sgRNAs (see example for mouse RAD51):
• http://genome.ucsc.edu/cgi-bin/hgTracks?db=mm9&position=chr2%3A118933851118949804&hgsid=369022555_n8aBpwayTCGjo561eWeJ8Z9QnyqL
B. sgRNA cloning
The pX330/335 plasmids are common vectors for cloning sgRNAs. To clone in your target sequence,
synthesize two partially complementary oligos with 4nt overhangs compatible for cloning into the vector. "N" and
"n" represent complementary base pairs. PAY CAREFUL ATTENTION TO THE 5' > 3' ORIENTATIONS
5’ –CACCGNNNNNNNNNNNNNNNNNNN –3’
5’ -AAACnnnnnnnnnnnnnnnnnnnC -3’
When annealed oligos form double stranded DNA with overhangs for cloning into BbsI site in px330/px335.
5’ –CACCGNNNNNNNNNNNNNNNNNNN –
3’
3’
–CNNNNNNNNNNNNNNNNNNNCAAA –5’
Design note for expressing sgRNA in cells from the U6 promoter in pX330/pX335: Please note that for the pX330/335
cloning backbone, the example guide sequence one base ‘G’ followed by 19 Ns, instead of the 20 Ns shown for the
PX260/334 cloning backbones. This difference in oligo design was due to the requirement of human U6 promoter to have a
‘G’ base at the transcription start site. Hence, we recommend finding a 20bp genome target starting with the base ‘G’. If you
have to use other bases at the starting position of your genome target, you could add an additional ‘G’ to the front of your
target. If you are going to use the construct simply to make RNA for microinjection into mouse embryos, then you can ignore
this issue.
Annealing and cloning procedure:
1. Anneal each pair of oligos:
1 µl oligo 1 (100 μM)
1 µl oligo 2 (100 μM)
8 µl H2O
10 µl total
Anneal in a thermocycler at 95oC 5 min and then leave on the bench at RT to cool down for 1hr.
Dilute the annealed oligo 1:250 (250 - fold).
2. Set up digestion reaction:
X µl pX330/pX335 or other backbone vector (at least 2 µg)
2 µl 10X NEBuffer 2.1
1 µl BbsI (NEB) Use more if cutting more DNA
H2O to final Volume of 20 µl
Incubate the digestion reaction at 37oC for at least 1hr. Run ~200ng on agarose gel to ensure COMPLETE
digestion. If not complete, add more enzyme and 1X buffer and go longer. Re-run a gel to confirm digestion.
When digest is complete, heat inactivate (65°C for 20 min) or column purify linearized plasmid.
Cornell University Transgenic Core
CRISPR/Cas9 Genome editing
3. Set up ligation reaction:
X µl pX330/pX335 BbsI digested vector (100ng)
2 µl annealed oligo duplex from step 1 (1:250 dilution)
2 µl 10x DNA ligase buffer (make sure fresh, else ATP or DTT may be shot)
1 µl T4 ligase
Y µl H2O to 20 µl final volume
- Incubate the ligation reaction according to manufacturer recommendations.
(NOTE: many protocols call for phosphatasing the oligonucleotides. This won't hurt, but it doesn't matter since
the vector ends are phosphorylated. Also, some people gel purify the plasmid after digestion. It can't hurt, but if
your digest went to completion, this is a waste of time. Essentially, this procedure is "forced" cloning, since the
sites in the plasmid are incompatible and the annealed oligos can only clone in the correct orientation and the
plasmid cannot recircularize.
4. Transformation with 1 - 2 ul of the final product into competent cells
5. Pick colony and sequence verify with U6 sequencing primer (U6seqF:ACTATCATATGCTTACCGTAAC)
C. In Vitro Transcription (IVT) of sgRNA for microinjection into zygotes.
For injection to zygotes sgRNA needs to be in vitro transcribed. pX330/pX335 plasmids containing sgRNA lack
a T7 promoter site (new plasmids with T7 promoters are coming soon). We use PCR products as templates for
the IVT. The fwd primer introduces the T7 promoter into the sgRNA DNA template.
T7-sgR Fwd:
T7-sgR Rev:
+1
5'-TAATACGACTCACTATAGGGN18-20 -3'
5'- AAAAGCACCGACTCGGTGCC -3’
• The underline shows the minimum promoter sequence needed for efficient transcription. N18-20 represents your
target sequence.
•The +1 base (G) (in bold) is the first base incorporated into RNA. Note that the last three Guanines in the T7
promoter are the first bases that are transcribed. If you have a target site that does not have GG at the 5′ end
you can add these bases to the 5′ end of the target sequence.
1. Production of a T7-PCR template for IVT by PCR:
Any Taq polymerase can be used to amplify T7-PCR template (high fidelity preferred).
X ul plasmid containing your sgRNA (10ng NO MORE!!! less is better!!!!)
5 ul 10x polymerase buffer
1 ul 10 mM dNTPs
1 ul T7-sgR Fwd
1 ul T7-sgR Rev
1 ul Taq polymerase
Y ul ddH2O
50 ul total
Example program:
94oC 60s; 35 cycles of [94oC-30s; 58oC-30s; 72oC-30s]; 72oC-10 min
• PCR should be optimized to yield single specific band to avoid gel purification which decreases the efficiency
of IVT.
• We usually run 5x50ul PCR reactions and pull them together for purification using Qiagen PCR purification kit.
Elute with 30-50ul RNAse free water. Quantify using Nanodrop.
Cornell University Transgenic Core
CRISPR/Cas9 Genome editing
2. In Vitro Transcription (IVT).
The sgRNA template is then in-vitro transcribed using the Ambion MEGAshortscriptT7 Kit according to the
manual. For optimal results we use 0.5-1ug PCR template and incubate at least 4h.
http://www.lifetechnologies.com/order/catalog/product/AM1354M?ICID=search-product
3. sgRNA purification
We use the Ambion MEGAclear kit to purify the in vitro transcribed RNA according to the manual. We elute in
30-50ul of pre-warmed elution buffer. After purification we usually recover good quality sgRNA at a
concentration between 0.5-2ug/ul (measured by Nanodrop). Run 200ng of denatured sgRNA on a gel to confirm
integrity before injection.
https://www.lifetechnologies.com/order/catalog/product/AM1908M?ICID=search-product
D. Designing an ssODN template for HR-mediated repair
5’ — (~60 - nt 5’ homology) NNN NGG (~60 - nt 3' homology) — 3’
For precise genome editing, we use single stranded oligonucleotides (ssODNs) as repair templates.
120- 200nt can be ordered from Integrated DNA Technologies (IDT). We use desalted oligos. Do not use
PAGE-purified oligos, as this can introduce trace chemical contaminants that reduce embryo viability.
ssODN usually come from 4nm scale synthesis. Re-suspend your oligo to a concentration of 1ug/ul (or 10ug/ul)
using this calculator: http://www.idtdna.com/Calc/resuspension/
All required information is included on your oligo specification sheet.
For microinjection, resuspend ssODN at concentration 1-10 µg/ul in RNAse free H2O. We use final 100ng/µl of
ssODN in the microinjection buffer.
Note: When introducing single nucleotide changes we recommend adding a silent change to the PAM site if
possible (changing Gs to other nt), or to the next 1-2 bases most adjacent/upstream to PAM site. If introducing
LoxP or other changes, design your insertion site close to PAM site (within 8-12nt). Destroying the PAM site or
sgRNA binding will prevent re-cutting of properly edited allele by Cas9/sgRNA, leading to NHEJcatalyzed mutations. Also, if using a dsDNA for HR, make sure it does not contain a perfect match to the
sgRNA, or the Cas9 will cut it!
E. Preparing reagents for CRISPR/Cas9 microinjections.
All sgRNAs and ssOND should be provided as concentrated stocks. We will provide Cas9 (nuclease or nickase)
mRNA and mix all the components at standard concentrations unless requested otherwise.
sgRNA : 50ng/ul
ssODN: 100ng/ul
Cas9mRNA: 100ng/ul