Download A Primer on Gene Regulation

11
A Primer on
Gene Regulation
Goal
To understand the principles
of gene regulation.
Objectives
After this chapter, you should be able to:
• distinguish between negative and
positive control.
• calculate Keq for repressor binding to
DNA.
• explain the lac operon AND gate.
Genes are the units of nucleotide sequence in DNA that specify a protein or
non-coding RNA. The full complement of genes in the genome of E. coli is
about 5,000 and that in the human genome about 20,000. These genes are
expressed by their transcription into RNA and subsequent (in the case of
protein-coding genes) translation into protein. Importantly, not all genes
are expressed at the same time. In bacteria, some genes are expressed at a
constant rate but others are turned ON (transcribed) or OFF in response to
cues from the environment. In multicellular organisms, such as the embryo
of an animal, genes are turned ON in a cell- or tissue-specific manner at the
right time and in the right place in response to developmental cues. Gene
regulation is a vastly complicated and fascinating subject encompassing an
extraordinary range of molecular mechanisms. This chapter is intended as a
primer for introducing the classic example of the lactose operon in bacteria
and the concepts of negative and positive control.
Genes involved in lactose metabolism are grouped in a single
transcription unit, the lactose operon
The subject of gene regulation derives from the seminal discoveries on the
lactose (lac) operon of E. coli made by François Jacob and Jacque Monod
while they were working at the Institut Pasteur in Paris and for which they
shared the Nobel Prize in Physiology and Medicine in 1965. An operon
is two or more genes that are co-transcribed from a common promoter as
part of a single transcription unit. Thus, an operon is transcribed as a single
transcript that contains the coding sequence for two or more proteins.
Glucose metabolism
Chapter 11
A Primer on Gene Regulation
2
OH
O
HO
HO
OH
OH
+
6 O2
6 CO2
+
6 H2O
+
Energy
Glucose
Lactose metabolism
cellular enzymes
OH OH
β-linkage
O
HO
OH
OH OH
OH
O
HO
Lactose
O
OH
O
β-galactosidase
OH
HO
H2 O
OH
OH
OH
+
HO
HO
Galactose
O
OH
OH
Glucose
Figure 1 β-galactosidase cleaves lactose, producing glucose that can fuel cellular metabolism
(The grouping of genes into operons is common in bacteria but rare in
eukaryotes.) The lactose or lac operon contains three genes: lacZ, lacY, and
lacA but we will only be concerned with the most promoter-proximal gene,
lacZ, which encodes β-galactosidase. β-galactosidase is an enzyme that
enables E. coli to metabolize the sugar lactose. The preferred carbon and
energy source for E. coli is glucose, but E. coli will metabolize lactose instead
if no glucose is present in the growth medium. Lactose is a disaccharide
composed of the sugars galactose and glucose. β-galactosidase cleaves the
glycosidic bond (a β-glycosidic bond that links the 1 position of galactose
to the 4 position of glucose) that connects galactose and glucose, thereby
releasing free glucose and free galactose, which another cellular enzyme
converts into glucose (Figure 1).
If E. coli is growing on its preferred carbon source, glucose, then it would
be wasteful to produce β-galactosidase. On the other hand, if the medium
contains lactose and not glucose, then production of β-galactosidase
is essential for growth and viability. How does E. coli cope with these
conflicting requirements? The answer is that transcription of the operon is
subject to a regulatory mechanism that turns ON the operon when lactose
is present. (Shortly, we will come to the interesting circumstance when
glucose and lactose are present simultaneously.)
The Lac repressor negatively regulates the lac operon
How does lactose turn ON transcription of the lac operon? Transcription is
controlled by a regulatory protein known as the lactose operon repressor
or LacI. The gene for LacI is located just upstream of the lac operon and is
transcribed from its own, separate promoter. The repressor is a tetramer of
four LacI subunits (it has quaternary structure). The LacI tetramer binds
to a nucleotide sequence known as the operator that overlaps with the
Chapter 11
A Primer on Gene Regulation
Figure 2 Expression of the lac
operon is negatively regulated by
LacI
repressor
(LacI)
operator
promoter
+1
lacZ
transcription
lacY
lacA
genes encoded by lac operon
downstream
upstream
promoter for the operon, thereby blocking access of RNA polymerase to
the promoter and hence blocking transcription (Figure 2). LacI is therefore
a paradigmatic example of negative regulation in which the binding of
a regulatory protein to DNA represses transcription. (We will come to
positive regulation presently.)
How does the lac operon escape repression to turn on the synthesis of
β-galactosidase when lactose is present in the growth medium instead of
glucose? The answer is that lactose acts as an inducer that binds to LacI,
preventing the repressor from binding to the operator (Figure 3). Because
LacI is a tetramer, the inducer has four binding sites on the repressor. The
inducer turns ON (derepresses) the operon by preventing the binding
of the repressor to the operator and allowing RNA polymerase to bind.
(Actually, the inducer is not lactose per se but rather a slightly modified
form of lactose called allolactose. When lactose enters the cell some of it
is converted to allolactose by β-galactosidase. The two disaccharides differ
only in that the 1 position of galactose is linked to the 4 position of glucose
in lactose and to the 6 position of glucose in allolactose. That the inducer is
allolactose and not lactose is an oddity of nature that need not concern us
further in what follows.)
repressor in highaffinity conformation
repressor bound
to inducer
inducer
operator DNA
operator DNA
transcription
repressed
+
transcription
not repressed
Figure 3 Inducer triggers the dissociation of the repressor from the operator
Notice that the repressor exists in two conformations as indicated in the cartoon by curved and rectangular shapes.
3
Chapter 11
A Primer on Gene Regulation
repressor bound
to inducer
inducer
Keq < 1
4
repressor
repressor
high-affinity
low-affinity
conformation
conformation
Figure 4 Inducer shifts the equilibrium between the lac repressor’s high-affinity and low-affinity DNA binding conformations towards the low-affinity conformation
How exactly does the inducer remove the repressor from the operator? The
inducer’s effect is another example of Le Chatelier’s principle (Figure 4). The
repressor exists in two conformations: a conformation in which it has high
affinity for DNA and a conformation in which it has low affinity for DNA. The
two conformations are in equilibrium, with the high-affinity conformation
being strongly favored. The inducer, however, only binds to the low- affinity
conformation. Therefore, when lactose is present, the inducer binds to
the low affinity conformation and removes it from the high-affinity/lowaffinity equilibrium. In order for the ratio of low-affinity to high-affinity
repressor to remain equal to the equilibrium constant, there must be a net
conversion of high-affinity repressor to the low-affinity conformation. This
depletes the amount of repressor in the high-affinity conformation. Taken
as a whole, the presence of inducer perturbs the equilibrium between lowaffinity and high-affinity conformations, decreasing the amount of highaffinity repressor and ultimately decreasing the amount of repressor bound
to DNA.
Let’s look more closely at how the repressor prevents RNA polymerase from
binding to the promoter. When RNA polymerase binds to the promoter
it physically contacts a stretch of DNA that extends upstream to roughly
position -40 relative to the start site of transcription (recall that the sigma
factor contacts the -35 and -10 sequences) and downstream to roughly
position +20. Meanwhile, the stretch of DNA contacted by the repressor, the
operator, overlaps with the downstream region of the promoter, covering
the transcription start site and extending to the end of the promoter (Figure
5). Thus, when the repressor binds to the operator, it physically occludes
RNA polymerase.
DNA covered by RNA polymerase
transcription
5’
3’
AATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACATTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACAC
TTACACTCAATCGAGTGAGTAATCCGTGGGGTCCGAAATGTAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTTAAAGTGTG
-35 sequence
CAP site
-10 sequence
+1
DNA covered by repressor
Figure 5 Binding of the repressor to the operator occludes RNA polymerase
Shown are the DNA binding sites for RNA polymerase, the repressor, and CAP, which is introduced below.
3’
5’
Chapter 11
A Primer on Gene Regulation
Figure 6 The operator is composed of two palindromic “halfsites”
Shown is a surface representation of the
repressor. The repressor exists in the cell
as a tetramer composed of four polypeptide chains; however, only two polypeptide
chains that contact the operator are shown
(cyan and green). The lac operator DNA is
also shown. On the bottom is a diagram of
the two palindromic “half-sites” of the operator. Dashes indicate bases that are not
identical between the half sites.
repressor
lac operator
DNA
5’ GGAATTGTGAGCGGATAACAATTTC 3’
3’ CCTTAACACTCGCCTATTGTTAAAG 5’
5’ AATTGT-A-C 3’
3’ C-A-TGTTAA 5’
“half-site”
“half-site”
lac operator
The sequence of bases that make up the operator is present in two copies
in an inverted repeat (or head-to-head) orientation, meaning that the
operator is a palindrome (Figure 6). Because of its symmetry, the operator
can be divided into two “half-sites.” Two of the four polypeptide subunits of
the tetrameric repressor contact the operator, with one subunit contacting
one half-site and the other subunit contacting the other half-site. Proteins
that exhibit quaternary structure and bind to repeated sequences in DNA
is a common theme among DNA-binding proteins both in bacteria and
eukaryotes.
The equilibrium binding constant describes the affinity of the repressor
for the operator
How do we measure the affinity of the repressor for the operator, that is,
its equilibrium binding constant? Like a typical equilibrium constant,
the equilibrium binding constant can be expressed as the quotient of the
product concentrations divided by the reactant concentrations, as shown in
Figure 7. The value of the binding constant is proportional to the repressor’s
affinity for DNA. In other words, the conformation of the lac repressor that
has a high affinity for the operator would have a higher binding constant
than the conformation that has a low affinity for the operator.
Figure 7 The equilibrium binding
constant (Keq) for the formation of
the repressor-operator complex
Keq =
Repressor
“R”
+
[R-O]
[R] [O]
Operator
Repressor-Operator Complex
“O”
“R-O”
5
Chapter 11
A Primer on Gene Regulation
increasing repressor concentration*
[R]:
5x10-15 1x10-14 5x10-14 1x10-13 5x10-13 1x10-12 5x10-12
direction of DNA
migration
operator bound
by repressor
free operator
DNA
+
*[O] is the same in each lane.
repressor concentration at
which 50% of DNA is bound
Figure 8 Electrophoretic mobility shift assays are used to experimentally determine the equilibrium binding
constant
A simple experimental procedure for measuring the binding constant is
the electrophoretic mobility shift assay (Figure 8). A segment of DNA
containing an operator site is subjected to electrophoresis through a gel in
the presence of an electric field in which the negative pole is at one end (top
end in the figure) of the gel and the positive pole at the other. The DNA
is applied to the end with the negative pole. The DNA molecules, being
negatively charged, migrate through the gel, away from the negative pole
and towards the positive pole at the bottom of the gel. This procedure is
carried out in the presence of increasing concentrations of repressor. Free
DNA molecules migrate with the highest mobility, whereas DNA molecules
that are bound by repressor migrate slower through the gel, owing to their
cargo of repressor protein. This experiment results in a gel that shows the
proportion of DNA that is bound to the repressor at each concentration of
repressor. A plot of the data yields a simple saturation curve in which DNA
binding increases with increasing repressor concentration, as shown in
Figure 9. A control experiment (not shown in the figures) employs a DNA
segment lacking an operator to which repressor has low affinity.
The binding constant (Keq) can be calculated from the saturation curve by
determining the repressor concentration at which half of the DNA is bound
to repressor. At this concentration, the concentration of repressor bound to
DNA [R-O] is equal to the concentration of unbound operator [O]. Thus, in
the equation for the binding constant, [R-O] and [O] cancel out, leaving Keq
being equal to the inverse of the repressor concentration (1/[R]). This yields
an equilibrium binding constant for repressor binding of 1013 M-1. (Strictly
speaking, this is an approximation because the concentration of free
repressor molecules when 50% of the operator DNA is bound is slightly less
than the original repressor concentration used to set up the electrophoretic
6
Chapter 11
A Primer on Gene Regulation
% DNA bound to repressor
100
80
60
Keq =
40
[R-O]
[R] [O]
=
1
[R]
[R-O] = [O] when 50% of the
operator DNA is bound by the
repressor. Since these values
are equal, they cancel out in
the equation.
20
=
1
1x10
-13
= 1x1013
This is the specific value
of [R] at which 50% of the
operator DNA is bound
by the repressor.
0
10-14
1x10-13
3x10-13
5x10-13
7x10-13
9x10-13
Repressor concentration (M)
repressor concentration
when 50% of DNA is
bound by repressor.
Figure 9 The equilibrium binding constant is the inverse of the [R] at which 50% of the operator DNA is
bound by
The percentage of operator DNA that is bound by repressor is plotted versus the repressor concentration, [R]. These data represent the
data shown in Figure 8. The value of [R] at which 50% of the operator is bound by repressor, 1x10-13 M, is indicated.
mobility shift experiment. This is because some of the repressor molecules
are bound to the operator. Since the concentration of repressor in these
experiments is much larger than the concentration of operator DNA, the
discrepancy is negligible.) The equilibrium binding constant for the binding
of a repressor to DNA is sometimes referred to as an association constant
or, alternatively, as a dissociation constant, which is simply the inverse of
the association constant or, in this case, 10-13 M.
The lac operon is subject to both positive and negative control
Although the lac operon was and is a paradigmatic example of negative
control, it later emerged that it is also a classic example of positive
regulation. Many genes, indeed most, are subject to positive control. That is,
their expression depends on an activator, which is a DNA-binding protein
that turns ON transcription by binding to DNA (as opposed to blocking
transcription as in negative regulation). In addition to being subject to
negative control by repressor binding to the operator at the downstream
end of the promoter, the lac operon is subject to positive control by an
activator called CAP. CAP binds to a site just upstream of the promoter
such that both CAP and RNA polymerase can sit side-by-side on the DNA.
This is in contrast with the repressor, whose binding site overlaps with the
binding site for RNA polymerase.
7
Chapter 11
A Primer on Gene Regulation
Why does RNA polymerase require the assistance of CAP to bind to the
promoter in the presence of inducer? If inducer is present, then, as we
have seen, the LacI repressor is not bound to the operator and hence RNA
consensus TTGACA TATAAT
polymerase should be able to bind to the promoter and initiate transcription.
The answer is that the lac promoter is a poor match to the -35 and -10
lac promoter TTTACA TATGTT
consensus sequences. As you will recall, the ideal -35 and -10 sequences
are 5’-TTGACA-3’ and 5’-TATAAT-3’, respectively. The promoter for the
Figure 10 The lac operon requires lac operon differs from these ideal sequences at three positions, as shown
positive regulation because its
in Figure 10. Hence, the lac promoter is an intrinsically weak promoter to
promoter sequence deviates from
which RNA polymerase only weakly binds. This is the basis for positive
the consensus
control; an activator compensates for the promoter’s poor match to the
consensus sequence by helping to facilitate the binding of RNA polymerase.
-35
-10
How does CAP facilitate the binding of RNA polymerase? It does so by
directly contacting the RNA polymerase, and the favorable free energy
from this protein-protein interaction helps to stabilize the binding of RNA
polymerase to the otherwise weak promoter (Box 1). Situations such as
these in which an activator stabilizes the binding of RNA polymerase to
DNA are often referred to as recruiting RNA polymerase.
Box 1 Many antibiotics target the ribosome
What is the nature of the contact site between CAP and RNA polymerase? The cartoon of Figure 11 shows
that RNA polymerase is a heteromeric complex consisting of subunits known as α, β, and β’ in addition
to the sigma (σ) subunit, which contacts the -35 and -10 sequences. The α subunit has two domains, an
N-terminal domain (NTD) and a C-terminal domain (CTD). CAP, which binds to DNA as a dimer, makes
contact with the RNA polymerase in the C-terminal domain of the α subunit, which protrudes from the
back side of the RNA polymerase.
cAMP
CAP
RNA polymerase
(α CTD)
CAP
α CTD
α NTD
β
β’
σ
CAP site
-35
-10
transcribed
into mRNA
Figure 11 CAP enhances RNA poly-
merase’s ability to bind to the promoter
RNA polymerase is shown in shades of purple;
CAP is shown in green.
Figure 12 A dimer of CAP∙cAMP bound to DNA contacts
the C-terminal domain of the α subunit of RNA polymerase
Shown is a CAP∙cAMP dimer (green and cyan) bound to its contact site on
RNA polymerase (red) and the CAP binding site on DNA.
8
Chapter 11
A Primer on Gene Regulation
Binding of CAP to DNA depends on a cyclic nucleotide
NH2
N
O
N
O
O P
O
O
N
N
OH
Figure 13 3’,5’-cyclic adenosine
monophosphate (cAMP)
Just as the affinity of the LacI repressor for DNA is governed by a small
molecule, the inducer allolactose, the ability of CAP to adhere to its binding
site is strongly influenced by a small molecule, 3’,5’-cyclic adenosine
monophosphate (cAMP) (Figure 13). Whereas the lactose inducer lowers
the affinity of repressor for operator, cAMP stimulates the binding of CAP
to its binding site in DNA.
What is the meaning of subjecting the lac operon to positive control
by a complex of CAP and cAMP? The answer is that the concentration
of cAMP in the cell is not constant. Rather, it varies in a manner that is
influenced by the carbon source. If the cells are growing on glucose,
then the levels of cAMP in the cell are low. But if the cell is growing on a
carbon source other than glucose (e.g., lactose), then the levels of the cyclic
nucleotide are high. Thus, subjecting the lac operon to positive control by
CAP∙cAMP ties expression of the lac operon to whether or not the cells are
growing on glucose. If cells are growing on glucose, the preferred carbon
source for E. coli, then cAMP levels will be low and the lac operon will
be OFF whether or not lactose is present. If, on the other hand, the only
carbon source is lactose, then cAMP levels will be high, enabling CAP to
bind to its binding site and allowing the lac operon to be ON.
The lac operon is subject to an AND gate
As we have seen, the lac operon is subject to both positive and negative
control. When lactose is present, the LacI repressor dissociates from the
operator. But the presence of lactose is not the only condition that must
be met in order for the lac operon to be expressed. If, and only if, two
conditions are met–glucose is absent and lactose is present–is the operon
ON (Figure 14). Thus, if E. coli is growing on glucose alone or a mixture of
glucose and lactose, then the operon is OFF. Thus, the lac operon is said to
be subject to the logic of an AND gate, borrowing the term from computer
sciences. From the cell’s perspective, the AND gate is exquisitely sensible. E.
coli does not wastefully express the lac operon when its favored food source
glucose is available, nor it does express the operon when both glucose and
lactose are absent and the cells are growing on some other carbon source
(e.g., maltose).
Summary
The lac operon in E. coli is a three-gene transcription unit that includes the
gene for β-galactosidase, an enzyme that converts the disaccharide lactose
to galactose and glucose. The lac operon is subject to negative control by the
LacI repressor. The repressor binds to an operator site that overlaps with the
promoter for the operon, thereby occluding RNA polymerase and blocking
transcription. Repression is relieved by the presence of lactose, from which
the inducer is derived.
The repressor, a tetramer, exists in an equilibrium between a conformation
with a high affinity for the operator and a conformation with a low affinity.
When lactose is present, the inducer binds to the low-affinity conformation
9
Chapter 11
Figure 14 The lac operon is regulated by an “AND” gate
A Primer on Gene Regulation
glucose
repressor
lactose
operator
Yes
Yes
10
CAP site
-35
-10
Transcription
OFF
CAP site
-35
-10
Transcription
OFF
-10
Transcription
OFF
No
Yes
CAP
No
No
CAP site
-35
RNA polymerase
No
Yes
CAP site
-35
-10
Transcription
ON
of the repressor, draining it from the equilibrium and decreasing the amount
of repressor that is bound to DNA.
A simple technique for measuring the binding of repressor to operator is the
electrophoretic mobility shift assay, which takes advantage of the impaired
mobility in an electric field of DNA molecules to which repressor is bound.
The equilibrium binding constant of the repressor for its operator can be
derived from the experimentally determined concentration of repressor at
which half of the operator DNA is bound and from the equation Keq = [RO]/([R][O]).
The lac operon is also subject to positive regulation by CAP and cAMP,
which compensates for the poor match to consensus of the -35 and -10
sequences of the operon’s promoter. A dimer of CAP∙cAMP binds to a site
just upstream of the promoter, contacting RNA polymerase and stabilizing
its binding to the promoter (that is, recruiting the RNA polymerase).
Because cAMP levels are depressed under conditions of growth on glucose,
the operon is OFF when cells are grown on their preferred carbon source
whether or not lactose is present. Thus, the lac operon is subject to an AND
gate in which two conditions must be met in order for the operon to be
expressed: the absence of glucose and the presence of lactose.