Download HIV-1 Infection of Nondividing Cells: C-Terminal

Cell, Vol. 80, 379-388, February 10, 1995, Copyright © 1995 by Cell Press
HIV-1 Infection of Nondividing Cells:
C-Terminal Tyrosine Phosphorylation
of the Viral Matrix Protein Is a Key Regulator
Philippe Gallay, Simon Swingler, Christopher Aiken,
and Didier Trono
Infectious Disease Laboratory
The Salk Institute for Biological Studies
10010 North Torrey Pines Road
La Jolla, California 92037
Summary
The HIV-1 matrix (MA) protei n contains two subcellular
localization signals with opposing effects. A myristoylated N-terminus governs particle assembly at the
plasma membrane, and a nucleophilic motif facilitates
import of the viral preintegration complex into the nucleus of nondividing cells. Here, we show that myristoylation acts as the MA dominant targeting signal in
HIV-1 producer cells. During virus assembly, a subset
of MA is phosphorylated on the C-terminal tyrosine by
a virion-associated cellular protein kinase. Tyrosinephosphorylated MA is then preferentially transported
to the nucleus of target cells. An MA tyrosine mutant
virus grows normally in dividing cells, but is blocked
for nuclear import in terminally differentiated macrophages. MA tyrosine phosphorylation thus reveals the
karyophilic properties of this protein within the HIV-1
preintegration complex, thereby playing a critical role
for infection of nondividing cells.
Introduction
Retroviruses are single-stranded RNAviruses whose replication depends on the integration of a double-stranded
DNA intermediate, termed the provirus, into the host cell
genome. For oncoretroviruses, this process depends on
cell proliferation (Humphries and Temin, 1972, 1974), because the breakdown of the nuclear envelope at mitosis
is necessary for bringing the viral preintegration complex
in contact with the cell chromosomes (Roe et al., 1993;
Lewis and Emerman, 1994). In contrast, human immunodeficiency virus type 1 (HIV-1) has the ability to infect nondividing cells (Lewis et al., 1992). This property is shared
with other lentiviruses and reflects the existence of determinants that govern the active transport of the viral preintegration complex through the nucleopore (Bukrinsky et al.,
1992). It likely plays a crucial role in AIDS pathogenesis
because it allows the spread of HIV-1 in such critical targets as terminally differentiated macrophages (Weinberg
et al., 1991).
Two viral proteins, matrix (MA) and Vpr, have been
shown to participate in this process in a partly redundant
manner (Bukrinsky et al., 1993a; Heinzinger et al., 1994;
von Schwedler et al., 1994). MA is the N-term inal cleavage
product of the HIV-1 Gag precursor by the viral protease
and contains a nuclear localization signal (NLS) (Myers
et al., 1992) that closely resembles the prototypic SV40
large T antigen NLS (Kalderon et al., 1984). A peptide
based on the MA NLS acts as a nuclear targeting sequence when coupled to a heterologous protein in vitro
(Bukrinsky et al., 1993a). In cells acutely infected with H IV-l,
MA was detected in fractions containing partially purified
HIV-1 preintegration complexes (Bukrinsky et al., 1993b),
as well as in the nucleus (Sharova and Bukrinskaya, 1991).
In the absence of a functional vpr gene, the critical role
of the MA NLS is further revealed: vpr-MA-NLS double
mutant viruses show a defect in nuclear import and, as a
result, have an impaired ability to infect nondividing cells
such as macrophages (Bukrinsky et al., 1993a; Heinzinger
et al., 1994; von Schwedler et al., 1994).
In addition to fulfilling this critical function at an early
step of the infection process, MA also plays an essential
role in virus morphogenesis. Indeed, a myristate residue
at the N-terminus of MA directs Gag to the plasma membrane. This targeting is essential for the proper assembly
of viral particles and for their release into the extracellular
space (Varmus and Swanstrom, 1984). In the process, MA
also recruits the envelope glycoprotein at the surface of
virions (Yu et al., 1992a, 1992b; Dorfman et al., 1994).
Correspondingly, MA has been localized to the periphery
of mature HIV-1 particles, bound to the inner leaflet of the
virus lipid bilayer (Gelderblom et al., 1987).
Since the myristoylation signal and the N LS have opposing influences on the subcellular localization of MA, their
respective effects must be tightly regulated. The present
work reveals the mechanism of this regulation. We find
that myristoylation acts as a dominant targeting signal for
MA in HIV-1 producer cells, preventing the NLS-mediated
nuclear import of the protein. We further demonstrate that
a small subset of MA molecules undergo C-terminal tyrosine phosphorylation at the time of particle assembly. Both
membrane association and proteolytic cleavage of Gag
are necessary for this modification, which can be observed
in the absence of other viral proteins. Accordingly, tyrosine
phosphorylation can be observed when recombinant MA
is exposed to cellular extracts, as well as viral lysates.
Although only 1% of all MA molecules internalized by
newly infected cells migrate to the nucleus, the majority
of those phosphorylated on tyrosine are rapidly translocated to this compartment. Mutating the C-terminal tyrosine of MA to phenylalanine does not alter Gag processing,
nor replication of the resulting virus in dividing cells, such
as activated T lymphocytes. However, in the absence of
a functional vpr gene, the MA tyrosine mutant is profoundly
defective for growth in terminally differentiated macrophages, owing to a block in the nuclear import of the viral
preintegration complex. These results thus demonstrate
that tyrosine phosphorylation reveals the karyophilic function of MA in the context of the HIV-1 preintegration complex, thereby playing a crucial role for infection of nonproliferating cells such as macrophages.
Cell
380
Figure 1. Myristoylation Prevents the NLSMediatedNuclearImportof HIV-1 MA in Producer Cells
MA:
(A) Schematic representationof MA variants
TTK~LK.
analyzedin these experiments.
MAG2A/KK27Tr:
A
~
iii~ ~|~
(B) MA,H~sand MA~, variantsare nonmyristoyT~KLK*
rated. [3H]myristate-labeledextractsfrom 293
cells transfected with proviral constructs exCA:
pressing eitherwild-typeMA, or the two N-terCX
WT
MAG2A
minus mutatedforms of the protein(see [A]),
were analyzed by immunoprecipitationwith
MA-specific antibody.
(C) Subcellular localizationof MA in trans@ ~ ~
~
tubulir
fected cells. Cytoplasmic (CX) and nuclear
Irealrnent: -(NX) fractions of 293 cells transfected with
DNAs expressing the various forms of MA
shown in (A) (minus: mock)were analyzedby
1
2
3
4
5
6
1 2 3 4
5 6 7
1 2 3 4 5 6
Western blotting,with antibodiesagainst MA
(top), CA (middle),and tubulin (bottom).Wildtype MA (lane 2) is found exclusivelyin the cytoplasm,whereaslarge amountsof the two nonmyristoylatedforms of MA (lanes3 and 5) migrate
to the nucleus. Nucleartransportof nonmyristoylatedMA is greatly reducedby a mutationin the NLS (lanes4 and 6). CA and the tubulin control
are restrictedto the cytoplasm.
(D) Wild-type MA is tightly bound to the plasmamembrane.293 ceils expressingwild-typeand a nonmyristoylatedform of MA were separated
into plasmamembrane,cytosol,and nucleusfractions,followedby immunoprecipitationwith MA-specificantibodyand Western blotting.
(E) Nuclearimportof nonmyristoylatedMA is blockedby NLS peptideand wheatgerm agglutinin(WGA), 293 cellsexpressingMAGu,were treated
overnightas indicatedabove each lane (minus: mock). Nuclearfractionswere then analyzedby immunoprecipitationwith MA-specificantibody,
followedby Western blotting.The effect of WGA could be preventedby additionof N-acetylglucosamine,as described(Forbes, 1992).
KK*~KLKH
..... ~ , ,,J-C'~~
' !!!!!!!!iia~mm~I
S,
C
Results
Myristoylation Prevents the NLS-Mediated
Transport of MA to the Nucleus
of HIV-1 Producer Cells
Altered forms of the HIV-1 MA protein were generated in
the context of a full-length proviral construct (Figure 1A).
First, two nonmyristoylated variants were created, one by
replacing the MA N-terminal glycine by alanine, the second by introducing six histidines at the proximal end of
Gag. Both mutations effectively prevented myristoylation
(Figure 1B). N LS-defective versions of these proteins were
also derived by replacing two lysines in the NLS by threonines, a change previously shown to abrogate the function
of this motif (von Schwedler et al., 1994). Cytoplasmic and
nuclear extracts of cells transfected with these constructs
were then analyzed by Western blotting (Figure 1C). Wildtype MA was found exclusively in the cytoplasm (Figure
1C, lane 2), as was the viral capsid (CA); tubulin, a protein
normally restricted to this compartment, sewed as a control. Further separation of the cytoplasm in membrane and
cytosol fractions revealed that myristoylated MA was associated with the plasma membrane, as previously described (Varmus and Swanstrom, 1984; Spearman et al.,
1994) (Figure 1D, lanes 1-3). In contrast, large amounts
of both forms of nonmyristoylated MA were associated
with the nucleus (Figure 1C, lanes 3 and 5; Figure 1D,
lanes 4-6). This process was NLS-dependent, since mutations in this motif induced the partial redistribution of nonmyristoylated MA to the cytoplasm (Figure 1C, lanes 4
and 6). Furthermore, the nuclear import of nonmyristoylated MA was effectively blocked by peptide containing
the prototypic SV40 large T antigen NLS (Figure 1E, lanes
1-4). This correlates the previous demonstration that such
peptide can inhibit the MA-mediated nuclear import of the
HIV-1 preintegration complex (Gulizia et al., 1994), as well
as that of other karyophiles harboring a related signal (Michaud and Goldfarb, 1993). Finally, nuclear import of nonmyristoylated MA could be prevented by wheat germ agglutinin (Figure 1E, lanes 5-7), a lectin that specifically
blocks transport through the nuclear pore (reviewed by
Forbes, 1992).
In these experiments, MA was expressed together with
the other products of the gag and pol genes, raising the
possibility that these additional polypeptides altered its
localization. These studies were thus repeated with HIV-1derived constructs in which the sequence encoding wildtype or nonmyristoylated MA was immediately followed by
a stop codon. The respective distribution of these proteins
was similar to that observed in the context of full-length
precursors, indicating that MA subcellular targeting is independent from other Gag and Pol proteins (data not
shown).
MA Molecules Imported to the Nucleus of Newly
Infected Cells Are Myristoylated
The above data indicate that MA has intrinsic nucleophilic
properties conferred by the NLS, but in virus producer
cells, these are masked by myristoylation. Yet, once HIV-1
enters target cells, a functional MA NLS prevails and plays
a major role in facilitating the nuclear import of the viral
preintegration complex (Bukrinsky et al., 1993a; von
Schwedler et al., 1994). One possible explanation for this
paradox was that some unmyristoylated MA was incorporated in vidons and was selectively imported to the nucleus
of newly infected cells. Alternatively, proteolytic cleavage
could occur on a subset of MA molecules, removing the
myristoylated N-terminus. To test these hypotheses, growtharrested cells were acutely infected with viruses labeled
with either [3sS]cysteine or [3H]myristic acid. Cytoplasmic
MA TyrosinePhosphorylationand HIV NuclearImport
381
A 35S-cysteine-labelledvirions
V
cpm:
CX
NX
treatment:
(z-MA:
_ o ~
x
14,422 134 (0.93%)
c~-pTyr:
B 3H-myristate-labelledvitions:
V
CX
p17-IP'
NX
1
2
3
MA-"~
B
cpm:
19,516 192 (0.98%)
Figure 2. MAMoleculeslmportedtotheNucleusofHIV-1TargetCells
Are Myristoylated
Cytoplasmic(CX)and nuclear(NX)fractionsof y-irradiatedP4-2cells
acutely infectedwith virions purifiedfrom Molt IIIB cells labeledwith
either pS]cysteine (A) or [3H]myristate(B) were immunoprecipitated
with MA-specificantibody. V, virions. After autoradiography,bands
were excised and counted; the number of cpm recoveredin each
case is shown.Approximately1% of internalizedMA molecules,fully
myristoylated, migrateto the nucleusof acutelyinfectedcells.
@
c~-MA:
pt7"1~'
c~-pTyr:
pl 7 "
1
~
1
KKKYKLKH
~
2
3
4
Y
The C-Terminal Tyrosine of MA Is Phosphorylated
Taken together, these results demonstrate that myristoylation acts as a dominant targeting signal for MA during
viral particle formation, yet for 1% of the molecules, it
becomes recessive once HIV-1 enters target cells. This
suggests a model in which some modification of MA, during or after assembly, is responsible for silencing the influence of myristoylation, thereby revealing the NLS effect.
Interestingly, the membrane association of HIV-1 Gag depends not only on myristate, but also on nearby positively
charged residues predicted to interact with negatively
charged phospholipids in the plasma membrane (Zhou et
al., 1994). Such an electrostatic mechanism implies that
reversible membrane binding of MA might be achieved
by introduction of appropriately placed negative charges
into the protein, for instance through phosphorylation. By
analogy, platelet-derived growth factor stimulation of 3T3
cells is accompanied by N-terminal phosphorylation of
myristoylated pp60°src, which is then released from the
cell membrane (Walker et al., 1993). Similarly, phosphorylation of membrane-bound myristoylated alanine-rich C
kinase substrate (MARCKS) by protein kinase C releases
this protein into the cytosol (Thelen et al., 1991).
Based on these precedents, the phosphorylation status
of HIV-1 MAwas examined. It was thus found that, in HIV-1
virions purified from acutely infected T lymphoid cells, MA
6
7
VSQNYPIVQN
myr-G
and nuclear extracts, prepared at 6 hr postinfection, were
then analyzed for their respective MA contents. This revealed that approximately 99% of internalized MA molecules were found in a cytoplasmic fraction (Figure 2),
mostly in association with the plasma membrane (data not
shown). In contrast, 1% of MA molecules were present in
a nuclear fraction. An identical nucieocytoplasmic ratio for
MA was obtained when radioactive counts obtained from
[3sS]cysteine- or from [3H]myristic acid-labeled protein
were used to calculate this number. On that basis, it can
be inferred that MA molecules associated with the nucleus
of newly infected cells are fully myristoylated.
5
~
C
-Fill
-F~I.
Figure3. HIV-1 MA Is Phosphorylatedon C-TerminalTyrosine
(A) Lysates of virions purified from HIV-l-infectedCEM cells were
analyzedby Western blottingwith MA- and phosphotyrosine-specific
antibodies,as indicated,with or withoutprior treatmentwith phosphatase (CIP), or phosphataseplus orthovanadate(CIP + OV).
(B) The same analysis, on virions produced by transfection of 293
cells with constructs containing indicatedtyrosine-to-phenylalanine
mutations in MA. The C-terminaltyrosineof MA (Y132) is the target
of phosphorylation.
(C) Two-dimensionalphosphoaminoacid analysisof s2P-labeledMA
(wild type and Y132F) from virions isolatedfrom infectedCEM cells.
Wild type (WT) containsphosphoserineand phosphotyrosine;MAy132F
contains phosphoserineonly.
reacted with an anti-phosphotyrosine antibody in Western
blots (Figure 3A, lane 1). The signal could be abolished
by prior treatment of viral extracts with calf intestine phosphatase (Figure 3A, lane 2), unless the phosphatase inhibitor orthovanadate was added (Figure 3A, lane 3). MA tyrosine phosphorylation was not restricted to T cell-produced
virus, as it was also observed with virions purified from
the supernatant of transfected fibroblasts (Figure 3B).
HIV-1 MA contains three highly conserved tyrosines, at
positions 29, 86, and 132, respectively (Myers et al., 1992).
Each of these tyrosines was changed individually to phenylalanine, in the context of a full-length proviral construct.
Virions obtained from cells transfected with the resulting
plasmids were analyzed by anti-phosphotyrosine Western
blotting (Figure 3B). This identified the C-terminal tyrosine
of MA, at position 132, as the target of phosphorylation.
Phosphoamino acid analysis of virions produced from 32p.
labeled cells confirmed that MA is phosphorylated on Tyr-
Cell
382
A
A
'k'~"c "~-~'~"~" '~'Y'~
c~-MA:
c~-CA:
B
~,0
p55 -~'
(~-pTyr:
p55
~-pTyr:
12345
4-'11
+q
p18
p17 ,~"
4
1 2
3
~J
4
##~o o~-MA:
%&"~ t~"
t*~"
17
p24(ng): 70 7070 8 0
lane:
2 3 4 5
p68~
Fraction No.
c~-pTyr:
p68 "~'
1
2
3
CD4
Figure 4. Requirements of MA Tyrosine Phosphorylation
(A) 293 cells stably expressing various forms of Gag (Figure 1; MAsTop
encodes a truncated Gag precursor, owing to a stop codon right after
the MA coding sequence), or a protease-defective provirus (APro),
were analyzed by Western blotting with MA-, CA- and phosphotyrosinespecific antibodies as indicated. MA tyrosine phosphorylation depends
on myristoylation and proteolytic cleavage of Gag.
(B) The same analysis on 293 cells transiently transfected with vectors
expressing a CD4/MA chimera represented below blot, with tyrosine
(44MA) or phenylalanine (44MAy~32F)at the MA C-terminus. MA undergoes tyrosine phosphorylation when recruited to the membrane as
part of an integral membrane protein.
132, as well as on serine (Figure 3C). Furthermore, radioactive measurements, d o n e by comparing the amounts
of [~S]cysteine and 32p incorporated in virus-associated
MA when producer cells w e r e labeled for 2 days, indicated
that a p p r o x i m a t e l y lS/o of M A molecules present in virions
are phosphorylated (data not shown).
Requirements for MA Tyrosine Phosphorylation
The requirements for MA tyrosine phosphorylation were
then determined. It revealed that this modification was
d e p e n d e n t on the plasma m e m b r a n e association of Gag,
as nonmyristoylated forms of MA were not tyrosine phosphorylated (Figure 4A, lanes 1 and 2). If MA was produced
in the absence of other Gag and Psi proteins, its e x p o s e d
C-terminus underwent tyrosine phosphorylation (Figure
4A, lane 4). However, no phosphotyrosine was detected in
the p55 Gag precursor, w h e t h e r it was produced in normal
a m o u n t s by wild-type virus or accumulated by a proteasedefective mutant (Figure 4A, lane 5). The need for Gag
proteolytic c l e a v a g e implies that MA tyrosi ne phosphorylation is coupled with virus maturation, as might be expected
Figure 5. MA Protein Kinase Activity in Cells and in Virions
(A) In vitro phosphorylation of recombinant wild-type and Y132F MA
protein, using [7-32P]ATP and pelleted supernatant from human T
lymphoid CEM cells (PCS). After reactions were performed as indicated, MA was purified on a nickel column, resolved by SDS-PAGE,
and transferred to a PVDF membrane that was exposed to X-ray film.
(B) Two-dimensional phosphoamino acid analysis of in vitro phosphorylated recombinant MA recovered from (A), showing incorporation of
phosphate on serine, threonine and tyrosine in the case of wild-type,
and on serine and threonine only in the case of MAY132F.
(C, left panel) in vitro phosphorylation of recombinant MA, using
[y;32P]ATPand fractions from a Sephacryl S-1000 gel filtration purification of HIV-1 virions from chronically infected Molt IIIB cells. Curve
indicates p24 antigen content of each fraction. Phosphoamino acid
analysis (inset) shows that serine, threonine, and tyrosine kinase activities are associated with HIV-1 particles.
(C, right panel) Virions present in fractions 3 and 4 were further immunoprecipitated with a mixture of gp120 and gp41 antibodies, or with
a control antiserum; the products were then used in an in vitro kinase
assay with recombinant MA as substrate. Lane 1, crude viral pellet;
lane 2, Sephacryl S-1000-purified virions; lane 3, as lane 2, followed
by immunoprecipitation with envelope-specific antibodies; lane 4, as
lane 2, followed by immunoprecipitation with control serum, lane 5,
negative control (no lysate). The amount of p24 antigen present in
each sample is indicated below each lane.
for a regulatory event controlling, in a timely manner, the
karyophilic properties of this protein.
To explore further the factors important for MA tyrosine
phosphorylation, a chimeric integral m e m b r a n e protein
was constructed, with an extracellular and transmembrane region derived from CD4 and a cytoplasmic domain
made by MA. A variant of this chimera, in which the C-terminal tyrosine of MA was changed to phenylalanine, served
as control. These proteins, called 4 4 M A and 44MAyt32F,
respectively, w e r e then analyzed by Western blotting with
MA- and phosphotyrosine-specific antibodies (Figure 4B).
The result showed that the tyrosine phosphorylation of the
MA C-terminus occurred efficiently in the 4 4 M A protein.
It confirmed that this process is independent of the recognition of a specific receptor by the myristoylated end of
MA. Furthermore, it demonstrated that MA tyrosine phosphorylation does not require particle formation per se, nor
the presence of any other viral protein.
MA TyroeinePhosphorylationand HIV NuclearImport
383
A
Co-culture:
hours;
0
1
2
3
6
0
1
2
3
6
~-pTyr
B
Cell free infection:
hours:
0
2
4
8
0
2
4
8
o~-MA - ~
c~-pTyr
Cytoplasm
C
Nucleus
+ NLS pepticle:
hours:
0
2
4
0
2
4
8
~-MA -~"
c(-pTyr
Cytoplasm
The pattern of tryptic phosphopeptides of phosphorylated
MA molecules obtained in these experiments was examined and found to be comparable to that observed with
virus-associated MA labeled in vivo (data not shown). Significant levels of MA serine, threonine, and tyrosine kinase
activities were also found in HIV-1 virions, purified from
a chronically infected human T lymphoid cell line by size
fractionation (Figure 5C, left). Moreover, the MA protein
kinase activity remained associated with the viral particles
when these were purified further by immunoprecipitation
with antibodies against the viral envelope (Figure 5C,
right).
Nucleus
Figure 6. Tyrosine-PhosphorylatedMA Is RapidlyTransportedto the
Nucleus of Acutely InfectedCells
Cytoplasmicand nuclear fractions of ,'/-irradiatedP4-2 cells acutely
infected either by coculture(at a ratio of 50:1 with Molt IIIB cells) (A)
or with cell-freevirions (5 Ilg of p24) (B), harvestedat the indicated
times postinfection,were analyzedby immunoprecipitationwith antiMA antibody,followedby Western blottingwith MA- or phoephotyrosine-specific antibody. Whereas the majority of MA remains in the
cytoplasm (associatedwith the plasma membrane,.data not shown),
most tyrosine-phosphorylatedMA rapidly migratesto the nucleus.
((3) Cell-freeinfection repeatedin the presenceof NLS peptide(500
IIM). Nuclear import of MA is blocked, but tyroeine-phosphorylated
species are still detected,demonstratingthat they are not generated
in the nucleus.
MA Tyrosine Phosphorylation Is Accomplished by
a Cellular Protein Kinase Present in Virions
The last point implied that a cellular kinase is responsible
for MA tyrosine phosphorylation. This was tested by in
vitro kinase assays employing recombinant MA protein as
substrate (Figure 5). When incubated in the presence of
reaction buffer and ATP, MA did not autophosphorylate.
In contrast, phosphate moieties were transferred from
[y-32P]ATP to MA, when either crude extracts of CEM or
293 cells or pelleted CEM supernatant were added (Figure
5A). Greater levels of 3~p incorporation were seen when
pelleted cell supernatant, as opposed to cellular extract,
was used as the source of protein kinase activity. However,
this was due to higher levels of endogenous ATP in the
cells, which interfered with the incorporation of 32p into the
MA substrate: when reactions were normalized by adding
nonradioactive ATP to 20 raM, cell extracts were found
to be more effective at phosphorylating MA (data not
shown). In these in vitro assays, incorporation of phosphate was less efficient on tyrosine than on serine, and
some phosphothreonine was also observed, whereas
none was found with in vivo labeled MA. However, the
C-terminal tyrosine of MA was specifically modified, as
no phosphotyrosine was recovered when reactions were
performed on a recombinant MAy~32Fvariant (Figure 5B).
Tyrosine-Phosphorylated MA Is Rapidly Imported
to the Nucleus of Newly Infected Cells
To ask whether tyrosine phosphorylation influences the
karyophilic properties of MA, growth-arrested cells were
exposed to HIV-1 and fractionated in cytoplasmic and nuclear fractions, at various times postinfection. These fractions were then analyzed by Western blotting, with MAand phosphotyrosine-specific antibodies (Figures 6A and
6B). As seen previously (Figure 3), the vast majority of
MA molecules remained associated with the cytoplasm.
In contrast, most of those phosphorylated on tyrosine were
rapidly transported to the nucleus. If cells were treated
with NLS peptide, total levels of phosphotyrosine-containing MA were not significantly changed, but this protein
was retained in the cytoplasm (Figure 6C). This indicates
that the nuclear accumulation of tyrosine-phosphorylated
MA does not reflect de novo phosphorylation in this compartment, but instead the rapid and preferential translocation of this protein from the cytoplasm to the nucleus of
acutely infected cells.
An HIV-1 Strain Defective for MA Tyrosine
Phosphorylation Is Blocked for Growth in
Terminally Differentiated Macrophages
Owing to a Defect in Nuclear Import
Our findings were compatible with a role for MA tyrosine
phosphorylation in HIV-1 nuclear import and, hence, for
infection of nondividing cells. To probe this issue, the replication of viruses containing wild-type and phosphotyrosine-defective versions of MA were compared under conditions of cell proliferation and growth arrest. A virus with
a mutation in the MA NLS served as additional control,
as it was previously shown to be defective specifically in
nondividing cells (von Schwedler et al., 1994). Since Vpr
can partly substitute for MA in facilitating the nuclear migration of HIV-1 in nonmitotic targets (Heinzinger et al.,
1994), these experiments were done with viral strains carrying a defective vprgene. Substituting a phenylalaninefor
the C-terminal tyrosine of MA did not alter Gag processing
(Figure 3) nor replication of the resulting HIV-1 mutant in
activated peripheral blood lymphocytes (Figure 7, top).
However, like the MA NLS mutant, this variant was unable
to grow in terminally differentiated macrophages (Figure
7, bottom).
To examine further this parallel and to determine the
level at which the replication of the tyrosine mutant was
Cell
384
3o I
tLme:
28 Target: PHA-activeted PBL
26
24
•
2021 -- O-" --O"18" "-•'"
p,\
R7Bal
;
MAKK27.n-.R7Bal ,,./
24 h
32 h
48 h
a F " ~ ¢ l a b clla b c '
•
MAyI32F.RTBal
R7
*"
16 '
'"
*.
,;'
12"
14"
10"
8"
6"
3h
8h
ar'-~-]c ~
y
~
O
LL -Ib
/,
/4
4'
¢
2
4
6
~ 30"
28 " Target:Macrophages
8
10
12
Ci
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
24
22
2O
18
16
14
12
10
8
62
42
22
5
10
15
20
25
30
days post-infection
Figure 7. MA Phosphotyrosine Mutant HIV-1 Is Unable to Grow in
Figure 8. NuclearImportof MA PhosphotyrosineMutant HIV-1 Is Defective in Macrophages
Terminally differentiated macrophages infected with wild-type MA
(a: R7BaL), MA phosphotyrosine-defective(b: MA¥132~R7BaL),or
NLS-defective (c: MAKK2TI-FR7BaL)viruses (all of which encode a
nonfunctional Vpr protein) were analyzed by PCR at the indicated
timepoints, with primersspecificfor variousproductsof reversetranscription. EL, early linear products (elongated minus-standDNA); LL,
late linear products (generated after the second template switch);Ci,
two-LTRcircles(formed in the nucleus).Both MA mutantsinducewildtype levelsof linear DNA but dramaticallyreducedamountsof circles.
Macrophages
Growth of NLS-defective (MAKK2rcrR7Bak) and MA phosphotyrosine-
defectiveviruses(MA¥132FR7BaL)were comparedwith that of the wildtype parent (R7Bak) in PHA-activated PBL (top) and terminally differentiated macrophages(bottom).The T cell tropic strain R7, which cannot
infect macrophages, served as control. All viruses encode a truncated
Vpr that cannnotsubstitutefor MA NLS functionin macrophages(yon
Schwedler et al., 1994).
blocked, viral DNA synthesis in freshly infected macrophages was studied. The accepted model for reverse
transcription includes a series of steps, beginning with the
synthesis of DNA complementary to the U5 and R regions
of the viral long terminal repeat (minus-strand strong-stop
DNA), continuing with the elongation of this minus-strand
after a first template switch, and culminating in the generation of a full-length double-stranded DNA molecule following a second template switch. Once the viral DNA is transported to the nucleus, full-length linear molecules can
circularize either by ligation of their two ends or through
recombinatorial events (Varmus and Swanstrom, 1984).
The appearance of these various intermediates and products of reverse transcription was thus monitored by polymerase chain reaction (PCR), in terminally differentiated
macrophages acutely infected with the HIV-l-derived viruses (Figure 8). This revealed that the phosphotyrosinedefective virus directed the synthesis of wild-type amounts
of viral linear DNA, indicating that its entry and reverse
transcription proceeded normally. In contrast, and like the
NLS mutant, this variant produced much lower levels of
viral DNA circles compared with wild type. These results
indicated that the absence of tyrosine at the C-terminal
end of MA specifically impairs the nuclear import of HIV-1
DNA. These data thus allow us to conclude that tyrosine
phosphorylation reveals the karyophilic properties of MA
in the context of the HIV-1 preintegration complex, thereby
playing an esential role for infection of terminally differentiated macrophages.
Discussion
The HIV-1 MA protein fulfills two crucial functions at different stages of the virus life cycle, as it is required for both
particle assembly and nuclear import of the viral preintegration complex. The myristoylation signal and the NLS,
which exert contradictory influences on the subcellular localization of MA, are each essential for one of these two
functions. Here, we present a model for the regulatory
mechanism that allows MA to play its dual role. We first
show that myristoylation acts as a dominant targeting signal for MA in virus producer cells, leading to particle formation at the plasma membrane and release of new virions
into the extracellular space. We then demonstrate that a
small subset of MA molecules undergo tyrosine phosphorylation. The dependence of this process on both membrane association and proteolytic cleavage of Gag suggests that it occurs concomitantly with virus maturation.
A protein kinase activity that transfers phosphate to the
C-terminal tyrosine of recombinant MA can be detected
in cells as well as in purified virions. A crucial link between
MA tyrosine phosphorylation and the subsequent import
of the HIV-1 preintegration complex is revealed by two
lines of evidence. First, there is rapid translocation of tyrosine-phosphorylated MA to the nucleus of newly infected
cells, whereas the bulk of MA, not phosphorylated on tyrosine, remains at the plasma membrane. Second, a mutant
virus in which the critical MA tyrosine is changed to phenylalanine is selectively impaired for growth in terminally
differentiated macrophages, owing to a block in nuclear
import.
MA Tyrosine Phosphorylation and HIV-1 Nuclear
Import: Potential Mechanisms
The nucleophilic properties of several other proteins are
derepressed following phosphorylation, For instance, treat-
MA Tyrosine Phosphorylationand HIV Nuclear Import
385
ment of cells with interferon-a (IFN-~) induces tyrosine
phosphorylation and nuclear translocation of the IFN-ccstimulated gene factor 3 (ISGF3), a transcriptional regulator involved in mediating cellular responses to the cytokine
(Schindler et al., 1992). In that case, an interaction between the phosphotyrosine and an SH2 domain mediates
the dimerization of the protein, perhaps exposing a yet
unidentified nucleophilic motif (Shuai et al., 1994). Also,
the nuclear import of SV40 large T antigen is significantly
reduced when sequences flanking the NLS and containing
casein kinase II (CKII) phosphorylation sites are removed
(Rihs and Peters, 1989). This might reflect an increased
affinity of phosphorylated T antigen for a cytoplasmic receptor responsible for its routing to the nuclear envelope.
It is likely that tyrosine phosphorylation enhances the
nuclear transport of HIV-1 MA through a different mechanism. Indeed, nonmyristoylated MA is effectively imported
to the nucleus even though it is not tyrosine phosphorylated (Figures 1 and 4). Based on this, it is probable that
phosphorylation triggers the redistribution of MA from the
membrane to the inner region of the virus, thereby allowing
the NLS to play its role in the context of the viral preintegration complex. This could be accomplished by at least two
nonmutually exclusive mechanisms: by simply disrupting
interactions between MA and the viral membrane, or by
stimulating the binding of MA to another component of
the viral core nucleoprotein complex.
Membrane release of MA could result from a major conformational change in the protein following phosphorylation. However, a more subtle mechanism could achieve
the same result. Indeed, the proximal region of HIV-1 Gag
contains a bipartite membrane targeting signal, comprising the myristoylated N-terminal 14 residues, plus an adjacent sequence of 17 amino acids, a number of which are
positively charged (Spearman et al., 1994; Zhou et al.,
1994). This more distal region, which has been shown to
bind to acidic phospholipids in vitro (Zhou et al., 1994), is
predicted to establish electrostatic interactions with negatively charged phospholipids located on the inner leaflet
of the membrane bilayer. Thus, by introducing negative
charges in MA, phosphorylation could disrupt these interactions, thereby releasing the protein from the plasma
membrane. A similar mechanism has been shown to account for the release of myristoylated pp60~~'°and MARCKS
from the plasma membrane into the cytosol following
phosphorylation by protein kinases A and C, respectively
(Walker et al., 1993; Thelen et al., 1991). With MA, detachment from the membrane would unleash the karyophilic
potential conferred by the NLS.
However, two arguments can be advanced against this
simple model. First, the tyrosine that becomes phosphorylated is at a significant distance from the region of MA
involved in membrane binding, not only considering a linear map of the protein but also its recently proposed structure (Matthews et al., 1994). Second, tyrosine-phosphorylated MA is detected in virus producer or MA-expressing
cells (Figure 1; data not shown), yet in these cells it resides in the cytoplasm but not the nucleus. This suggests
that an additional factor potentiates the effect of MA tyrosine phosphorylation once HIV-1 leaves producer cells.
On the one hand, there could be an additive effect of MA
serine phosphorylation, and in agreement with such a
model, our preliminary studies indicate that this modification too is coupled to virus maturation (S. S. and
D. T., unpublished data). Alternatively, it could be that MA
is preferentially released from the membrane of virions
rather than from the membrane of virus producer cells. In
that respect, the fluidity and lipidic composition of the
HIV-1 membrane have been shown to significantly differ
from those of the host cell plasma membrane (Aloia et al.,
1993). Finally, tyrosine phosphorylation could trigger an
association between MA and one of the proteins that are
directed to the central region of the core during virus maturation and are ultimately involved in forming the virus preintegration complex, such as the integrase and the reverse
transcriptase. The nuclear magnetic resonance analysis
of MA predicts that the C-terminal 20 amino acids of the
protein do not adopt a rigid conformation and, therefore,
might be available for such an interaction (Matthews et
al., 1994).
An implication of all the above models is that tyrosinephosphorylated MA molecules might be found inside the
viral core. Previous immunoelectron microscopic studies
have instead localized MA at the periphery of virions,
tightly bound to the inner leaflet of the virus membrane
(Gelderblom et al., 1987). However, of the 1500 MA molecules estimated to be present in each virion (Gelderblom,
1991), on the basis of our data, we would not expect more
than 1 ° , or approximately 15, to be associated with the
core. Indeed, this represents the fraction subsequently
imported to the nucleus of newly infected cells (Figure 3).
It is reasonable to assume that such a small number of
MA molecules would have escaped detection by electron
microscopy. Another prediction derived from our experiments is that, following fusion of the virus and target cell
membranes, tyrosine-phosphorylated MA molecules are
the ones whose NLS is recognized by a cytoplasmic chaperone responsible for leading the preintegration complex
to the nucleopore (Adam and Gerace, 1991; Forbes,
1992). Our preliminary analyses show that MA molecules
contained in the preintegration complex are indeed phosphorylated on tyrosine, supporting this hypothesis (P. G.
and D. T., unpublished data).
A Virus-Associated Cellular Protein Kinase
Responsible for MA Tyrosine Phosphorylation
The data presented here provide strong evidence indicating that MA tyrosine phosphorylation is accomplished by
a cellular protein kinase. The MA tyrosine kinase activity
is not restricted to T lymphocytes but is also found in fibreblasts. It fails to phosphorylate nonmyristoylated MA, and
so it is likely associated with the cell membrane. This activity can also be detected in the cell supernatant, most probably due to cellular breakdown, rather than to secretion.
Remarkably, the MA tyrosine kinase is present in HIV-1
virions purified by size fractionation followed by immuneprecipitation with anti-envelope antibodies. Whether this
reflects the stable binding of the enzyme to its MA substrate or the passive incorporation of a membrane-bound
Cell
386
e n z y m e in b u d d i n g v i r i o n s is still to be d e f i n e d . T h e t a r g e t
o f t h e t y r o s i n e k i n a s e is t h e last a m i n o acid o f MA, a prev i o u s l y u n s e e n p l a c e m e n t for a p h o s p h o t y r o s i n e . O n l y the
f r e e e n d o f M A is r e c o g n i z e d , e i t h e r a f t e r it is l i b e r a t e d by
p r o t e o l y t i c c l e a v a g e o f the G a g p r e c u r s o r or w h e n it is
n a t u r a l l y e x p o s e d , for i n s t a n c e in the MAsToP a n d 4 4 M A
m o l e c u l e s ( F i g u r e 4). T h i s a p p e a r s to p e r m i t a c o u p l i n g
between virus maturation and MA tyrosine phosphorylation.
T h e M A t y r o s i n e k i n a s e r e m a i n s to be f o r m a l l y identified. H o w e v e r , t h e p r e s e n t w o r k e s t a b l i s h e s that it p l a y s
a crucial role in facilitating HIV-1 r e p l i c a t i o n in t e r m i n a l l y
d i f f e r e n t i a t e d m a c r o p h a g e s , cells t h o u g h t to be critical for
both the p e r s i s t e n c e a n d t h e d i s s e m i n a t i o n o f the infection
( G a r t n e r a n d P o p o v i c , 1990). Efforts a i m e d at i d e n t i f y i n g
c o m p o u n d s t h a t b l o c k M A t y r o s i n e p h o s p h o r y l a t i o n are
t h u s w a r r a n t e d , as t h e y m a y lead to n o v e l t h e r a p i e s for
s l o w i n g the s p r e a d o f the v i r u s in H I V - i n f e c t e d individuals.
Experimental Procedures
DNA Constructions
PCR-mediated mutagenesis was used to introduce site-specific mutations in the MA- or protease-encoding regions of plasmid R7 (Kim et
al., 1989; yon Schwedler et al., 1993), which contains the HIV-1HXB2D
provirat DNA (Shaw et al., 1984) with a full-length nef reading frame,
as well as in R7BaL, which encodes a macrophage-tropic virus (von
Schwedler et al., 1994). Both R7 and R7BaL produce a truncated Vpr
protein, 78 amino acids in length, previously shown to be unable to
substitute for the NLS function of MA in macrophages (von Schwedler
et al., 1994). The MAG~ variant has the N-terminal glycine of Gag
changed to alanine. The proximal sequence of the MA,H,, protein is
Met/Gly/(His)JSer, in which Ser is normally the sixth residue of Gag.
APro has a 45 nt deletion in the pol gene (bases 2384-2428, as numbered by Ratner et al., 1985). The various mutations were also introduced in a modified proviral DNA construct, 3E-neo, which expresses
an env-defective version of R7 and contains the sequence encoding
for neomycin phosph0transferase instead of nef (Trono, 1992). The
44MA and 44MA~132Fchimeras were constructed by PCR, introducing
a unique cloning site at the junction between the transmembrane region of CD4 and the N-terminal end of MA, in the context of a CMVbased expression vector (Aiken et al., 1994). Recombinant MA carrying
an N-terminal histidine tag was produced in Escherichia coil using the
bacterial expression vector pET-15b (Novagen) and purified by affinity
chromatography on a nickel-Sepharose column according to the instructions of the manufacturer.
Cells
All cells were maintained as previously described (Aiken et al., 1994;
von Schwedler et al., 1994). HIV-t-infected Molt IIIB human T lymphoid
cell lines were obtained from C. Farnet through the NIH AIDS Research
and Reference Program. HeLa-derived P4-2 cells (Charneau et al.,
1990) were a gift from F. Clavel. Peripheral blood lymphocytes (PBLs)
and monocyte-derived macrophages were purified as previously described (von Schwedler et al., 1994). Macrophages were kept in culture
for 2 weeks before infection. For stimulation, PBLs were incubated
with phytohemagglutinin (Bethesda Research Laboratories) at 3 ~g/
ml for 48 hr and then maintained in RPMI 1640 containing 10% fetal
calf serum and recombinant interleukin-2 (Sigma) at 10 U/ml. To induce
growth arrest, P4-2 cells were exposed for 20 min to a 61Co source
calibrated at 200 rad/min. After irradiation, cells were diluted for infection to 1 x 106/ml and plated. The arrested state of the cells at the
time of infection was verified by propidium iodide staining of their DNA
and flow cytometry to ascertain that all cells were in the G2 phase of
the cycle. Stable 293 cell lines expressing various MA variants, as
well as APro, were created by transfection with LIE-neo-derived plasraids and selection in 0.5 mg/ml G418.
TransfecUons and Infections
Tranfections and preparations of viral stocks were as previously described (von Schwedler et al., 1993; Aiken et al., 1994). Infections of
PBLs (2 x 106 cells) and macropbages (0.5 x 10e cells) were performed with 20 ng of p24 of 293 cell-produced viruses as previously
described (von Schwedler et al., 1994). For virus growth curves, cells
were washed extensively after virus adsorption and p24 antigen production was monitored by ELISA (DuPont). Experiments were repeated many times with cells from different donors, with similar resu Its.
In rare instances, however, both NLS and tyrosine mutants showed
a less pronounced phenotype, perhaps linked to the state of arrest
or differentiation of the macrophages. To follow MA nuclear import,
infections of P4-2 irradiated cells were performed either by coculture
with Molt IIIB cells at a ratio of 50 to 1, or by the addition of cell-free
virus purified from the same cells (5 p.g of p24 antigen per 3 x 107
P4-2 cells). In the experiments of Figure 2, infections were performed
using cell-free virus produced by Molt IIIB cells radiolabeled for 20 hr,
either with 200 p.Ci/ml of Tran~S-label (ICN) or with 500 i~Ci/ml of
[3H]myristic acid (Amersham). Virions used for in vitro kinase assays
were prepared by gel fractionation on a Sephacryl S-100O column as
previously described (Trono, 1992).
Western Blots and Immunoprecipitstions
Rabbit anti-HIV-1 MA serum was obtained by immunization with the
above described recombinant histidine-tagged HIV-1 MA protein.
Monoclonal antibodies against p24/p55 (ST-3) and tubulin were purchased from Bethesda Research Laboratories and Boehringer Mannhelm, respectively. Rabbit anti-phosphotyrosine serum was a gift from
B. Seffon, Salk institute. Of note, several commercially available antiphosphotyrosine monoclonal antibodies failed to recognize the tyrosine-phosphorylated form of MA. Western blot and immunoprecipitation studies were as previously described (Aiken et al., 1994).
Subcellular FracUonation
Cells were lysed in cold hypotonic buffer (20 mM potassium HEPES
[pH 7.8], 5 mM potassium acetate, 0.5 mM MgCI2, 0.5 mM dithiothreitol,
1 mM sodium orthovanadate, 1 p.g/ml leupeptin, 1 p~g/ml aprotinin, 1
~g/ml pepstatin A, 1 mM phenylmethylsulfonyl fluoride [PMSF]) using
several strokes of a Dounce homogenizer as described by Sugasawa
et al. (1990). Nuclear preservation during cell lysis was followed by
phase-contrast microscopy. Cytoplasmic and nuclear extracts were
separated by centrifugation at 750 x g for 5 rain, and nuclei were
extracted with a hypertonic buffer (20 mM potassium HEPES [pH 7.8],
0.5 mM MgCI2, 500 mM potassium acetate, 0.5 mM dithiothreitol, 1
mM sodium orthovanadate, 1 p.g/ml leupeptin, 1 ~g/ml aprotinin, 1
p.g/ml pepstatin A, 1 mM PMSF). Membrane and cytosol fractions were
isolated from cytoplasmic extracts as described (Lin et al., 1991). High
pressure liquid chromatography (H PLC)-purified peptides corresponding to the prototypic SV40 T antigen NLS in the sense (PKKKRKVEDPYC) and reverse (PDEVKRKKKPYC) orientations were used
as described (Gulizia et al., 1994). Wheat germ agglutinin (WGA) was
used at 10 I~M, with or without addition of N-acetylglucosamine (450
I~M), as described in Finlay et al. (1987).
Phosphorylation Studies
HIV-1 DNA (40 I~g) was transfected into 5 × 106 CEM ceils by electroporation. At the peak of p24 viral antigen production, ceils were radiolabeled with 35 mCi of ~P H3PO4 (DuPont) for 48 hr at 37°C. Labeled
virions were first filtered and pelleted, and then incubated for 10 rain
in viral lysis buffer (12 mM Tris-HCI [pH 8.0], 0.5% Triton X-100, 300
mM NaCI, 1 mM MgCI2, 0.5 mM dithiothreitol, and 100 rim sodium
orthovanadate). M A protein was the n immunoprecipitated with a monoclonal anti-HIV-1 IIIB MA antibody (Advanced Biotechnologies Inc.)on
protein A-Sepharose beads. After SDS-PAGE and electrobiotting to
polyvinylidene difluoride (PVDF) membrane, phosphorylated MA was
visualized by autoradicgraphy and analyzed further for phosphoamino
acid content, essentially as described by Boyle et al. (1991).
PCR Analysis of Acutely Infected Cells
PCR analysis was performed as previously described (yon $chwedler
et al., 1993). The sequences of HIV-specific primers are as follows
(positions of nucleotides in the HIV-1H×B~Dsequence, according to
MA Tyrosine Phosphorylation and HIV Nuclear tmport
387
Ratner etal. [1985], are indicated in parentheses). Vif6: GGGAAAGCTAGGGGATGGI-]TTAT (5136-5159); Vif?: CAGGGTCTACTTGTGTGCTATTC (5340-5317); LTR5: GGCTAACTAGGGAACCCACTGCTT
(496-516); 5NC2: CCGAGTCCTGCGTCGAGAGAGC (698-677); LTRS,
TCCCAGGCTCAGATCTGGTCTAAC (488-465 and 9572-9549); L TRg,
GCCTCAATAAAGCTTGCCTTG (522-542 and 9606-9626). Vif6 plus
Vif7 amplify elongated minus-strand DNA, LTR5 plus 5NC2 amplify
double-stranded molecules generated after the second template
switch, and LTR8 plus LTR9 amplify two-LTR circles.
Acknowledgments
Correspondence should be addressed to D. T. We thank Tony Hunter
for helpful suggestions during the course 0I t'nese studies, as well as
critical reading of this manuscript. We are indebted to Bart Sefton for
the gift of the anti-phosphoryrosine antibody, to Inder Verma, Tom
Hope, and Rick Bushman for insightful cormnents, to Jinping Song
for technical assistance, and to Verna Stitt for the artwork. This study
was supported by a grant from the Berger Foundation to D. T. and
by postdoctoral fellowships from the Swiss National Science Foundation to P. G. and from the National Institutes of Health to C. A. As a
Pew Scholar in the Biomedical Sciences, D. T. receives support from
the Pew Charitable Trust.
Received November 9, 1994; revised December 22, 1994.
References
Adam, S. A., and Gerace, L. (1991). Cytosolic proteins that specifically
bind nuclear location signals are receptors for nuclear import. Cell 66,
837-847.
Aiken, C., Konner, J., Landau, N. R., Lenburg, M. E., and Trono, D.
(1994). Nef induces CD4 endocytosis: requirement for a critical dileucine motif in the membrane-proximal CD4 cytoplasmic domain. Cell
76, 853-864.
Aloia, R. C., Tian, H., and Jensen, F. C. (1993). Lipid composition and
fluidity of the human immunodeficiency virus envelope and host cell
plasma membranes. Prec. Natl. Acad. Sci. USA 90, 5181-5185.
Boyle, W. J., Van Der Geer, P., and Hunter, T. (1991). Phosphopeptide
mapping and phosphoamino acid analysis by two-dimensional separation on thin-layer cellulose plates. Meth. Enzymol. 201, 110-256.
Bukrinsky, M I., Sharova, N., Dempsey, M. P., Stanwick, T. L., Bukrinskaya, A. G., Haggerty, S., and Stevenson, M. (1992). Active nuclear
import of human immunodeficiency virus type 1 preintegration complexes. Proc. Natl. Acad. Sci. USA 89, 6580-6584.
Bukrinsky, M. I., Haggerty, S., Dempsey, M. P., Sharova, N., Adzhubei,,,
A., Spitz, L., Lewis, P., Goldfarb, D., Emerman, M., and Stevenson,,,
M. (1993a). A nuclear localization signal within HIV-1 matrix protein
that governs infection of non-dividing cells. Nature 365, 666-669.
Bukrinsky, M. I., Sharova, N., McDonald, T. L., Pushkarskaya,, T.,
Tarpley, W. G., and Stevenson, M. (1993b). Association of integTase,
matrix, and reverse transcriptase antigens of human immu~odeficiency virus type 1 with viral nucleic acids following acute infection.
Proc. Natl. Acad. Sci. USA 90, 6125-6129.
Charneau, P., Alizon, M., and Clavel, F. (1990). A second origin of DNA
plus-strand synthesis is required for optimal human immunodeficiency
virus replication. J. Virol. 66, 2814-2820.
Dorfman, T., Mammano, F., Haseltine, W. A., and GSttlinger, H. G.
(1994). Role of the matrix protein in the virion association of the human
immunodeficiency virus type 1 envelope glycopro,tein. J. Virol. 68,
1689-1696.
Finlay, D. R., Newmeyer, D. D., Price, T. M., and: Forbes, D. J. (1987).
Inhibition of in vitro nuclear transport by a lectin that binds to nuclear
pores. J. Cell Biol. 104, 189-200.
Forbes, D. J. (1992). Structure and function of the nuclear pore complex. Annu. Rev. Cell Biol. 8, 495-527.
Gartner, S., and Popovic, M. (1990). Macrophage. trapism of HIV-I.
AIDS Res. Hum. Retroviruses 8, 1017-1021.
Gelderblom, H. R. (1991). Assembly and morphology of HIV: potential
effect of structure on viral function. AIDS 5, 617-638.
Gelderblom, H. R., Hausmann, E. H. S., C)zel, M., Pauli, G., and Koch,
M. A. (1987). Fine structure of human immunodeficiency virus (HIV)
and immunolocalization of structural proteins. Virology 156, 171-176.
Gulizia, J., Dempsey, M. P., Sharova, N., Bukrinsky, M. I., Spitz, L.,
Goldfarb, D., and Stevenson, M. (1994). Reduced nuclear import of
human immunodeficiency virus type 1 preintegration complexes in the
presence of a prototypic nuclear targeting signal. J. Virol. 68, 20212025.
Heinzinger, N. K., Bukrinsky, M. I., Haggerty, S. A., Ragland, A. M.,
Kewalramani, V., Lee, M.-A., Gendelman, H. E., Ratner, L., Stevenson,
M., and Emerman, M. (1994). The Vpr protein of human immunodeficiency virus type 1 influences nuclear localization of viral nucleic acids
in nondividing host cells. Proc. Natl. Acad. Sci. USA 91,7311-7315.
Humphries, E. H., and Temin, H. M. (1972). Cell cycle dependent
activation of Rous sarcoma virus-infected stationary chicken cells:
avian leukosis virus group-specific antigens and ribonucleic acid. J.
Virol. 10, 82-87.
Humphries, E. H., and Temin, H. M. (1974). Requirement for cell division for initiation of transcription of Rous sarcoma virus RNA, J. Virol.
14, 531-546.
Kalderon, D., Roberts, B. L., Richardson, W. D., and Smith, A. E.
(1984). A short amino acid sequence able to specify nuclear location.
Cell 39, 499-509.
Kim, S., Byrn, R., Groopman, J., and Baltimore, D. (1989). Temporal
aspects of DNA and RNA synthesis during human immunodeficiency
virus infection: evidence for differential gone expression. J. Virol. 63,
3708-3713.
Lewis, P. F, and Emerman, M. (1994). Passage through mitosis is
required for oncoretroviruses but not for the human immunodeficiency
virus. J. Virol. 68, 510-516.
Lewis, P, Hensel, M., and Emerman, M. (1992). Human immunodeficiency virus infection of cell arrested in the cell cycle. EMBO J. 11,
3053-3058.
Lin, P. H., Selinfreund, R., and Wharton, W. (1991). Isolation of cell
membrane for epidermal growth factor receptor studies. Meth. Enzymol. 198, 251-259
Matthews, S., Badow, P., Boyd, J., Barton, G., Russell, R., Mills, H.,
Cunningham, M., Meyers, N., Burns, N., Clark, N., Kingsman, S.,
Kingsman, A., and Campbell, I. (1994). Structural similarity between
the p17 matrix protein of HIV-1 and interferon-~/. Nature 370, 666668.
Michaud, N., and Goldfarb, D. S. (1993). Most nuclear proteins are
imported by a single pathway. Exp. Cell Res. 208, 128-136.
Myers, G., Berzofsky, J. A., Pavlakis, G. N., Korber, B., and Smith,
R.F., eds. (1992). Human Retroviruses and AIDS 1992: A Compilation
and Analysis of Nucleic Acid and Amino Acid Sequences (Los Alamos,
New Mexico: Los Alamos National Laboratory).
Ratner, L., Haseltine, W. A., Patarca, R., Livak, K. J., Starcich, B.,
Josephs, S. F., Doran, E. Z., Rafalski, J. A., Whitehorn, E. A., Baumeister, K., Ivanoff, L., Petteway, S. R., Pearson, M. L., Lautenberger, J. A.,
Papas, T. S., Ghrayeb, J., Chang, N., Gallo, R. C., and Wong-Staal, F.
(1965). Complete nucleotide sequence of the AIDS virus, HTLV-III.
Nature 313, 277-283.
Rihs, H.-P., and Peters, R. (1989). Nuclear transport kinetics depend
on phosphorylation-site-containing sequences flanking the karyophilic
signal of the Simian virus 40 T-antigen. EMBO J. 7, 1479-1484.
Roe, T., Reynolds, T. C., Yu, G., and Brown, P. O. (I993). Integration
of murine leukemia virus DNA depends on mitosis'..EMBO J. 12, 20992108.
Schindler, C., Shuai, K., Prezioso, V. R., and Darnell, J. E., Jr. (19921,
Interferon-dependent tyrosine phosphoryla~ion of a latent cytoplasmic
transcription factor. Science 257, 809-813.
Sharova, N., and Bukrinskaya, A. (1991)~ p17 and p17-contai~ihg gag
precursors of input human immunodeficiency virus are tra~,ported
into the nuclei of i~fected cells. AIDS Res. Hum. Retroviruse~ 7, 303306.
Shaw, G. M., Hahn, B. H., Arya, S. K., Groopman, J. E--~.Gallo, R. C.,
Cell
388
and Wong-Staal, F. (1984). Molecular characterization of human T-cell
leukemia (lymphotropic) virus type III in the acquired immune deficiency syndrome. Science 226, 1165-1171.
Shuai, K., Horvath, C. M., Tsai Huang, L. H., Qureshi, S. A., Cowburn,
D., and DarneU, J. E., Jr. (1994). Interferon activation of the transcription factor Stat91 involves dimerization through SH2-phosphotyrosyl
peptide interactions. Cell 76, 821-826.
Spearman, P., Wang, J.-J., Vander Heyden, N., and Rather; L. (1994).
Identification of human immunodeficienvy virus type 1 Gag protein
domains essential to membrane binding and particle assembly. J.
Virol. 68, 3232-3242.
Sugasawa, K., Murakami, Y., Miyamoto, N., Hanaoka, F., and Ui, M.
(1990). Assembly of nascent DNA into nucleosome structures in simian
virus 40 chromosomes by HeLa cell extract. J. Virol. 64, 4820-4829.
Thelen, M., Rosen, A., Nairn, A. C., and Aderem, A. (1991). Regulation
by phosphorylation reversible association of a myristoylated protein
kinase C substrate with the plasma membrane. Nature 351,320-322.
Trono, D. (1992). Partial reverse transcripts in virions from human
immunodeficiency and routine leukemia viruses. J. Virol. 66, 48934900.
Varmus, H. E., and Swanstrom, R. (1984). Replication of Retroviruses.
In RNA Tumor Viruses, Second Edition, R. A. Weiss, N. Teich, H. E.
Varmus, and J. Coffin, eds. (Cold Spring Harbor, New York: Cold
Spring Harbor Laboratory Press), pp. 369-512.
von Schwedler, U., Song, J., Aiken, C., and Trono, D. (1993). vif is
crucial for human immunodeficiency virus type 1 proviral DNA synthesis in infected cells. J. Virol. 67, 4945-4955.
von Schwedler, U., Kornbluth, R. S., and Trono, D. (1994). The nuclear
localization signal of the matrix protein of human immunodeficiency
virus type 1 allows the establishment of infection in macrophages and
quiescent T lymphocytes. Proc. Natl. Acad. Sci. USA 91, 6992-6996.
Walker, F., deBlaquiere, J., and Burgess, A. W. (1993). Translocation
of pp60~'`rcfrom the plasma membrane to the cytosol after stimulation
by platelet-derived growth factor. J. Biol. Chem. 268, 19552-19558.
Weinberg, J. B., Matthews, T. J., Cullen, B. R., and Malim, M. H. (1991).
Productive human immunodeficiency virus type 1 (HIV-1)infection of
nonproliferating human monocytes. J. Exp. Med. 174, 1477-1482.
Yu, X., Yu, Q,-C., Lee, T.-H., and Essex, M. (1992a)~ The C terminus
of human immunodeficiency virus type 1 matrix protein is involved in
early steps of the virus life cycle. J. Virol. 66, 5667-5670.
Yu, X., Yuan, X., Matsuda, Z., Lee, T.-H., and Essex, M. (1992b). The
matrix protein of human immunodeficiency virus type 1 is required for
incorporation of viral envelope protein into mature virions. J. Virol. 66,
5966-5971.
Zhou, W., Parent, L. J., Wills, J. W., and Resh, M. D. (1994). Identification of a membrane-binding domain within the amino-terminal region
of human immunodeficiency virus type 1 Gag protein which interacts
with acidic phospholipids. J. Virol. 68, 2556-2569.