Download A novel gene encoding a 54 kDa polypeptide is

Microbiology (2001), 147, 2479–2491
Printed in Great Britain
A novel gene encoding a 54 kDa polypeptide is
essential for butane utilization by
Pseudomonas sp. IMT37
R. S. Padda,† K. K. Pandey, S. Kaul,‡ V. D. Nair,§ R. K. Jain, S. K. BasuR
and T. Chakrabarti
Author for correspondence : T. Chakrabarti. Tel : j91 172 690562. Fax : j91 172 690585\690632.
e-mail : tapan!imtech.res.in
Institute of Microbial
Technology, Sector 39-A,
Chandigarh-160 036, India
Twenty-three propane- and butane-utilizing bacteria were isolated from soil
samples collected from oilfields. Three of them have been identified as
Rhodococcus sp. IMT35, Pseudomonas sp. IMT37 and Pseudomonas sp. IMT40.
SDS-PAGE analysis of the membrane of Rhodococcus sp. IMT35 revealed the
presence of at least four polypeptides induced by propane. Polyclonal antibody
raised against a 58 kDa polypeptide from Rhodococcus sp. IMT35 specifically
detected bacteria which were actively utilizing propane or butane.
Immunoscreening of a genomic library in λgt11 with this antibody resulted in
isolation of a clone containing a 49 kb EcoRI genomic DNA fragment. This
49 kb DNA fragment was found to hybridize specifically with organisms which
could grow on propane or butane. This fragment could therefore be used as a
probe for detection of such bacteria. A 23 kb fragment having an ORF encoding
a polypeptide of 54 kDa was identified by screening a genomic library of
Pseudomonas sp. IMT37 with this 49 kb EcoRI fragment. The sequence of the
ORF (designated orf54) was found to be novel. Primer extension and S1
nuclease mapping showed that transcription of the ORF starts at base 283 and
it had sequences upstream similar to that of a Pseudomonas promoter (N12,
N24 type). Disruption of the ORF by a kanamycin (‘ kan ’) cassette prevented the
organism from growing on any alkane but did not affect its ability to utilize
the respective alkanols and acids, indicating that alcohol dehydrogenase and
subsequent steps in the pathway remained unaltered. The mutants had no
detectable level of butane monooxygenase activity. Therefore, the product of
this gene plays a crucial role in the first step of the pathway and is an essential
component of monooxygenase. The findings imply that this bacterium either
employs a common genetic and metabolic route or at least shares the product
of this gene for utilization of many alkanes.
Keywords : alkane utilization, butane monooxygenase, primer extension, S1 nuclease
mapping, insertional inactivation
.................................................................................................................................................................................................................................................................................................................
The first four authors contributed equally to this work.
† Present address : Dept of Internal Medicine, University of Texas-Health Science Center, Houston, TX 77030, USA.
‡ Present address : Building 8, Room B2A-15, 8, Center Dr.MSC.0805, LMCB/NIDDK/NIH, Bethesda, MD 20892-0805, USA.
§ Present address : Dept of Neurology, Mount Sinai School of Medicine, New York, NY 10023, USA.
R Present address : National Institute of Immunology, Aruna Asaf Ali Marg, New Delhi-110 067, India.
Abbreviations : BMO, butane monooxygenase ; LPG, liquefied petroleum gas ; MMO, methane monooxygenase ; pMMO, particulate MMO ; PMO, propane
monooxygenase ; sMMO, soluble MMO.
The GenBank accession number for the orf54 sequence is L81125.
0002-4705 # 2001 SGM
2479
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:57:24
R. S. P A D D A a n d O T H E R S
INTRODUCTION
Gaseous hydrocarbons have long been known to act as
sole source of carbon and energy for many bacteria and
for a few yeasts and fungi (Miyoshi, 1895 ; So$ hngen,
1906 ; Lukins & Foster, 1963 ; Coleman & Perry,
1985 ; Woods & Murrell, 1989 ; Saeki & Furuhashi,
1994). Among the gaseous alkanes, methane, propane
and butane are the primary substrates which are
metabolized by these micro-organisms. A number of
review articles on the ecology, physiology and genetics
of methanotrophs have appeared in the literature
(Quayle & Ferenci, 1978 ; Colby et al., 1979 ; Dalton,
1980 ; Hanson, 1980 ; Quayle, 1980 ; Higgins, 1980 ;
Dalton et al., 1984 ; Lidstrom & Stirling, 1990). Usually
the presence and relative abundance of methane, propane and butane in subsoil are indicative of petroliferous
regions. It is, therefore, reasonable to assume that microorganisms capable of utilizing gaseous hydrocarbons
will be present in relative abundance in petroliferous
regions compared to non-petroliferous regions and such
correlations using methane utilizers were attempted
previously (Taggart, 1967 ; Sealy, 1974 ; Lonsane et al.,
1977). Methods proposed earlier were time-consuming
and may not be easy to perform in field conditions. One
objective of our study was to find out if the presence of
propane- or butane-utilizing bacteria could be detected
rapidly and unambiguously from environmental
samples. Since methane could also be of recent geological origin, methane-utilizing bacteria were not considered in our investigation.
The conventional method for detection of specific microorganisms is selective plating. Although easy to use, this
method takes time and can cover only limited types of
bacteria, and selection, being a growth-dependent process, may miss out organisms which require different
media or temperatures. Polyclonal and monoclonal
antibodies have proved to be more reliable and easy to
use for detection of target organisms. However, this
method of detection depends on the product(s) of a
gene(s) which may or may not be expressed depending
on the environmental conditions the microbes encounter. Another approach is the use of nucleic acid probes
because they can recognize target sequences at any stage
of growth, even if specific micro-organisms are in low
abundance, and unlike immunological probes do not
require expression of a specific gene(s). Function-specific
DNA probes whether based on DNA hybridization or
PCR amplification can detect a range of microbes
irrespective of their taxonomic affiliation (Grunstein &
Hogness, 1975 ; Torsvik, 1980 ; Sayler et al., 1985 ;
Ogram et al., 1987 ; Holben et al., 1988).
In order to develop a function-specific probe, it is
necessary to identify one or more novel properties
shared by the target micro-organisms. The first crucial
step in the oxidation of alkanes is catalysed by monooxygenases. Among the various alkane monooxygenases
known, methane monooxygenase (MMO) is the best
studied to date. The soluble (sMMO) and particulate
(pMMO) MMOs have been purified and characterized
(Colby et al., 1977 ; Fox & Lipscomb, 1988 ; Fox et al.,
1988, 1989 ; Green & Dalton, 1989 ; Woodland &
Dalton, 1984 ; Stainthorpe et al., 1990 ; Semrau et al.,
1995). MMO is a multicomponent enzyme consisting of
a hydroxylase, a coupling protein and a reductase. A
crystal structure of the hydroxylase component of
MMO has been elucidated (Rosenzweig et al., 1993).
The alkane monooxygenase from Pseudomonas
oleovorans, like MMO, is also a multicomponent
enzyme and consists of alkB, alkG and alkT gene
products – alkane hydroxylase, rubredoxin and rubredoxin reductase, respectively (Kok et al., 1989a, b ;
Eggink et al., 1987a, b, 1988, 1990).
In propane and butane metabolism, the first and the key
step is presumably catalysed by propane and butane
monooxygenase (PMO and BMO), respectively. The
presence of PMO has been shown in Rhodococcus
rhodochrous PNKb1 but the enzyme has eluded purification because of its unstable nature (Woods &
Murrell, 1989) and characterization has not been possible. PMO and BMO may also be multicomponent
enzymes. Based on biochemical evidence and product
accumulation, a pathway for butane metabolism in
Nocardia TB1 (Van Ginkel et al., 1987) and
‘ Pseudomonas butanovora ’ (Arp, 1999) has been
proposed which in both organisms appears to be very
similar. Comparative physiological studies using three
butane-grown bacteria, ‘ P. butanovora ’, Mycobacterium vaccae JOB5 and an environment isolate
CF8, led to the conclusion that there is diversity in
BMOs (Hamamura et al., 1999). The genetic
organization of pMMO (Semrau et al., 1995) and
sMMO (Stainthorpe et al., 1990) is now known.
However, virtually no information is available about the
biochemical, genetic and molecular basis of C –C
# &
alkane metabolism.
In this paper, we report the isolation of three gaseousalkane-utilizing bacteria and describe the identification
of a 58 kDa polypeptide induced by butane. Polyclonal
antibody raised against this polypeptide was used to
detect butane-utilizing bacteria and for identification of
a 4n9 kb DNA fragment containing the gene encoding
this protein. This DNA fragment could also be used as
a probe for specific detection of propane- and butaneutilizing bacteria. The gene encoding this 58 kDa protein
has been characterized and its role in butane and higher
alkane utilization has been established in a facultative
butanotroph, Pseudomonas sp. IMT37.
METHODS
Bacterial strains and plasmids. The bacterial strains and
plasmids are listed in Table 1 and Table 2, respectively.
Materials. Butane, propane, hexane, octane, nonane and
decane were purchased from Aldrich and Matheson Gases.
Liquefied petroleum gas (LPG) was obtained from the Oil and
Natural Gas Commission (ONGC), India. Zero air was
purchased from Indian Oxygen. Freund’s complete and
incomplete adjuvants were purchased from Difco
Laboratories. Acrylamide, agarose, ethidium bromide, DTT,
2480
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:57:24
Involvement of a novel gene in butane utilization
Table 1. Bacterial strains used in this study
.....................................................................................................................................................................................................................................
MTCC, Microbial Type Culture Collection & Gene Bank, Chandigarh (India) ; NCIB, National
Collection of Industrial Bacteria, UK.
Micro-organism
Propane/butane
utilization
Arthrobacter viscosus sp. (MTCC 22)
Bacillus subtilis* (MTCC 121)
Corynebacterium liquefaciens (MTCC 25)
Escherichia coli JM109
Escherichia coli MC1061
Escherichia coli (MTCC 131)
Escherichia coli* (MTCC 118)
Flavobacterium antarcticus (MTCC 675)
Gluconobacter oxydans (MTCC 904)
Lactobacillus fermentum (MTCC 903)
Micrococcus roseus (MTCC 678)
Mycobacterium sp. (MTCC 290)
Nocardia petroleophila (MTCC 273)
Pseudomonas cepacia (MTCC 438)
Pseudomonas putida* (MTCC 102)
Pseudomonas sp. (MTCC 129\NCIB 11309)
Pseudomonas sp. IMT37
Pseudomonas sp. IMT40*
Rhodococcus rhodochrous (MTCC 289) (J. J. Perry, USA)
Rhodococcus sp. IMT35*
Serratia marcescens (MTCC 97)
Vibrio sp. (MTCC 866)
Xanthobacter autotrophicus* (MTCC 133)
Zymomonas mobilis* (MTCC 88)
Cultures yet to be identified : IMT14, IMT21, IMT23, IMT24,
IMT32a and b, IMT33, IMT34, IMT39, IMT41
k
k
k
k
k
k
k
k
k
k
k
k
k
k
k
G†
j
j
H†
j
k
k
k
k
j
* These strains were used for dot-ELISA.
† These strains are reported as natural gas (G) and hydrocarbon (H) utilizers, respectively.
Table 2. Plasmids used/constructed during this study
Plasmid
pUC19
pHC79
pRT1–pRT7
pRT3A
pRT3B
pRT3A.1–pRT3A.10
pRT3B.1
pRT3A∆A–pRT3A∆J
pTC4
PGEMPstRT3
Properties
Ampr, ColE1 replicon, plasmid of 2n69 kb
Ampr Tetr, pMB1 replicon, cosmid of 6n4 kb
pHC79-based plasmids carrying inserts of 6–26 kb from Pseudomonas
sp. IMT37 which shows positive signal with 4n9 kb fragment
Subclone of pRT3 in pUC19 carrying 2n3 kb KpnI–HindIII fragment
Subclone of pRT3 in pUC19 carrying 3n7 kb KpnI–HindIII fragment
Subclones of pRT3A in pUC19 constructed for sequencing
Subclone of pRT3B carrying 0n3 kb KpnI–PstI fragment
Deletion subclones of pRT3A in pUC19 constructed for sequencing
pUC18 carrying the 4n9 kb fragment as insert
pGEM5Z carrying the 1n4 kb PstI fragment of pRT3
Reference
Yanisch-Perron et al. (1985)
Hohn & Collins (1980)
This study
This study
This study
This study
This study
This study
This study
This study
2481
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:57:24
R. S. P A D D A a n d O T H E R S
EDTA, formamide, lysozyme, proteinase, RNase, TEMED,
SDS, ampicillin, tetracycline, kanamycin and streptomycin
were purchased from Sigma. Nylon membranes were purchased from Amersham ; IPTG, restriction endonucleases and
other DNA-modifying enzymes from Promega, Boehringer
Mannheim, New England Biolabs, Stratagene ; sequencing
kits (Sequenase version 2.0) from United States Biochemicals
and X-ray films from Hindustan Photo Films. Unless specified
otherwise, analytical grade chemicals from commercial
sources were used.
Isolation of propane- and butane-utilizing bacteria. Soil
samples were collected from known oilfields of Gujarat, India.
One gram of soil was suspended in 10 ml mineral salt medium
(Whittenbury et al., 1970) in 50 ml vials fitted with gas-tight
closures and then crimped. The vials were filled with LPG
(55 %, v\v, propane ; 45 %, v\v, butane ; minor amounts of
butene, propene and mercapton) and then incubated at 30 mC
for 3–4 d on an orbital shaker at 200 r.p.m. Subculturing was
carried out for five cycles in mineral salt medium with LPG as
sole source of carbon. Hydrocarbon gases (LPG, butane,
propane, ethane and methane) were always used as a mixture
with air in a ratio of 40 : 60. Serial dilutions of the final cultures
were then spread on mineral medium agarose (MMA ; 2 %,
w\v) plates. The plates were placed in a desiccator, which was
then filled with LPG and incubated at 30 mC. After 7 d
incubation, colonies from these plates were picked up at
random and streaked on MMA plates for isolation of single
colonies. The purified single colonies were replica-plated onto
MMA and their growth was checked on propane, butane and
air in the presence and absence of KOH. This combination of
growth conditions was used to avoid the selection of CO
#
fixers.
Growth studies. For growth on propane and butane, cells
were streaked on MMA plates and were placed in a desiccator.
The desiccator was evacuated and then filled with a propane
or butane and air mixture (40 : 60 ratio). Incubation was
carried out at 30 mC. For large-scale culturing, 1 l medium in a
2 l flask was inoculated with the pure culture grown on
propane or butane to give an initial OD of 0n03–0n05. The
'!!
flasks were made air-tight with rubber stoppers, flushed with
butane (or propane when required) for 10 min and incubated
on an orbital shaker (175 r.p.m.) for 48 h at 30 mC. For
checking growth on other hydrocarbons (C –C ), the cultures
& "!
streaked on MMA plates were placed in a desiccator along
with a glass petriplate containing a few drops of the
hydrocarbon to saturate the desiccator with the vapours of the
hydrocarbons. Growth of the organisms on different intermediates of alkane metabolic pathways (n-propanol, 2propanol, tert-butanol, n-butanol, isoamyl alcohol, acetol,
propanaldehyde, butyraldehyde, butyric acid, formic acid,
propionic acid, pentanoic acid, hexanoic acid, capric acid and
caprylic acid) was checked by streaking the culture on MMA
plates containing 0n1 % (v\v for liquid, w\v for solid) of
different intermediates. Aldehydes were used at 0n05 % (v\v)
concentration. Visible growth was observed within 48–72 h
on all intermediates except 2-propanol and formic acid.
Growth studies were performed at 30 mC.
Membrane preparation. Late-exponential-phase cultures
were harvested by centrifugation at 13 000 g at 4 mC for 15 min
and washed twice with PBS (10 mM phosphate buffer,
150 mM NaCl, pH 7n4). Cells from 1 l medium (about 1 g wet
wt) were suspended in 1 ml 30 % sucrose in PBS. DNase
(25 µg ml−") and RNase (25 µg ml−") were added and mixed
with 2 g glass beads (0n25–0n5 mm) (ml cell suspension)−". A
cocktail of protease inhibitors was used throughout the
preparation. The suspension was homogenized for 10 min
(two 5 min cycles) at full speed in a Braun homogenizer cooled
with a flow of carbon dioxide. Glass beads were removed by
centrifugation at 1500 g for 10 min and the supernatant was
collected. Unbroken cells and cell debris were removed by
centrifugation at 10 000 g for 10 min and the resulting supernatant was centrifuged at 153 000 g for 2 h at 4 mC. The pellet
and supernatant were collected separately. The pellet obtained
from the first run was resuspended in PBS and incubated with
lysozyme (100 µg ml−") for 1 h at 37 mC. After incubation the
membrane fraction was purified by centrifuging twice at
153 000 g and the final pellet (particulate fraction) was
resuspended in 1 ml 25 % (w\v) sucrose in PBS. The suspension was stored at k20 mC until further use. The supernatant was once again centrifuged at 153 000 g for 2 h and the
supernatant (soluble fraction) was stored at k20 mC.
Purification of hydrocarbon-induced proteins and antibody
production. Electrophoresis was carried out according to the
protocol of Laemmli (1970) with minor modifications. The
specific bands were then cut out with a razor blade from the
gel and the protein was eluted and concentrated by electrophoresis using a sample concentrator (ISCO) in Tris (25 mM)\
glycine (190 mM) buffer (pH 8n3) containing 0n01 % SDS for
1 h at 450 mA. The eluted protein was checked for purity on
SDS-PAGE followed by silver staining. The presence of a
single band on SDS-PAGE was used as a criterion of purity.
Preparations showing single bands were stored at k20 mC.
Antibody against this protein was raised in rabbits. Purification of IgG was carried out according to Kasper &
Hartman (1987).
Construction of a genomic library in λgt11, amplification and
immunoscreening. Genomic DNA of Pseudomonas sp.
IMT40 was partially digested with EcoRI and 5–7 kb size
fragments were purified from agarose gel using a Geneclean
kit (Bio 101) according to the manufacturer’s instructions.
Purified DNA was ligated to λgt11 arms using the Packagene
system (Promega) as per the instructions of the supplier. The
phage titre was determined using Escherichia coli LE392 and
amplification of the library was carried out following standard
methods (Sambrook et al., 1989). Immunoscreening of the
library was done with the Protoblot immunoscreening system
(Promega) using E. coli Y1090. DNA from recombinant λ
clones was isolated according to Sambrook et al. (1989).
Recombinant λ clones were lysogenized in E. coli Y1089 and
individual colonies were checked for their growth at 32 and
42 mC. Colonies which could not grow at 42 mC were considered lysogen. Eighty micrograms of protein from each
lysogen lysate was run on SDS-PAGE according to the method
of Laemmli (1970). Protein bands were visualized by silver
staining (Merril et al., 1981). The resolved proteins were
transferred onto nitrocellulose membrane (Towbin et al.,
1979). The filters were immunodeveloped by using anti-rabbit
IgG peroxidase conjugate.
Dot-ELISA. Gaseous-alkane-utilizing bacteria Rhodococcus
sp. IMT35 and Pseudomonas sp. IMT40 were grown in
nutrient broth, glucose and propane. Other bacteria were
grown in nutrient broth, glucose and glucose in the presence of
propane in gas-tight flasks. Nitrocellulose membrane was
rinsed in distilled water followed by Tris-buffered saline
(TBS : Tris 50 mM, pH 7n4 ; NaCl 150 mM) and thoroughly
dried on Whatman filter paper (3 MM). Five microlitres of cell
suspension was applied in duplicate and air-dried. When
whole cells were applied, the dried membranes were placed in
an oven at 60 mC to stabilize binding and to inactivate bacterial
enzymes. Blank space on the membrane was blocked by
2482
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:57:24
Involvement of a novel gene in butane utilization
incubating the membrane in 3 % (w\v) casein in TBS overnight
at 4 mC. The membranes were then rinsed in TBS containing
0n05 % Tween 20 and transferred in diluted antibody solution
in TBS containing 1 % BSA. Diluted antibody was preadsorbed with E. coli lysate to remove non-specific IgG
molecules. Excess antibodies were washed off by rinsing in
TBS-Tween 20 and the membranes were incubated in alkalinephosphatase-conjugated anti-rabbit IgG (Promega). Colour
was developed using an immunoscreening kit (Promega)
according to the instructions of the manufacturer.
Rapid extraction of DNA from micro-organisms and general
techniques. For isolation of chromosomal DNA, different
organisms were grown on LB agar media. A loopful of cells
was resuspended in 50 µl TE containing 50 µg lysozyme µl−"
and lysed by adding 450 µl guanidinium isothiocyanate (5 M,
0n1 M EDTA). DNA was purified by chloroform\isoamyl
alcohol (24 : 1), precipitated by 2-propanol, washed in 70 %
alcohol and the dried pellet was dissolved in 100 µl water.
Ligation and restriction endonuclease digestions were done as
per the instructions of the supplier (Promega) of these
enzymes. DNA elution from agarose was done by using the
Geneclean kit from Bio 101 and the Qiaquick gel extraction kit
(Qiagen). General genetic and recombinant DNA techniques
were as described by Sambrook et al. (1989).
Dot blotting of DNA, hybridization and autoradiography.
Approximately 2 µg DNA from various organisms was applied
onto Zeta probe nylon membranes using the Bio-Dot microfiltration apparatus (Bio-Rad) according to the manufacturer’s
instructions. Hybridization was done using different concentrations of formamide (depending on desired stringency) at
45 mC according to the instructions of the manufacturer of the
nylon membranes. After hybridization, the membranes were
rinsed briefly in 2i SSC and washed in the following solutions
successively : 2i SSCj0n1 % SDS, 0n5i SSCj0n1 % SDS and
0n1i SSCj0n1 % SDS. The membranes were dried and placed
in plastic bags and exposed to X-ray film at k70 mC.
Nucleic acid labelling and purification. DNA fragments were
labelled using [$#P]dCTP or [$#P]dGTP by a nick translation
kit (Promega) according to the manufacturer’s instructions.
The labelled DNA fragments were purified using Sephadex
G50 column chromatography (Sambrook et al., 1989).
Construction and screening of a genomic library of Pseudomonas sp. IMT37. Genomic DNA from Pseudomonas sp.
IMT37 was isolated essentially as described by Sambrook et
al. (1989). DNA was partially digested with HindIII and
ligated to the cosmid vector pHC79, also cut with HindIII and
dephosphorylated. The ligated mixture was electroporated
into E. coli MC1061.
Hybridization and screening of the genomic library. The
library was screened using the 4n9 kb fragment as a probe. The
4n9 kb fragment was obtained from a genomic library of
Pseudomonas sp. IMT40 constructed in λgt11. The immunoscreening was done with an antibody raised against a 58 kDa
polypeptide which is induced by propane or butane. This
DNA fragment showed high specificity of hybridization with
DNAs of propane- or butane-utilizing bacteria, including
Pseudomonas sp. IMT37, but not with non-utilizers (see
Results for details). A clone, designated pRT3, with the
smallest insert (6 kb) carrying the region corresponding to the
encoding region of 4n9 kb was digested with KpnI and the two
HindIII–KpnI fragments of 2n3 and 3n7 kb thus obtained were
subcloned into pUC19, which was also cut with KpnI and
HindIII. These subclones were designated pRT3A and pRT3B.
The subclone pRT3A carried the coding region for the 58 kDa
protein, whereas pRT3B carried the upstream region of the
ORF (Fig. 1).
Subcloning and sequencing of pRT3A and pRT3B. Overlapping subclones of pRT3A were generated in pUC19 and
these were sequenced using the universal reverse and forward
primers for the pUC series of plasmids. A 300 bp region of
pRT3B which was upstream to the ORF in pRT3A was also
subcloned in pUC19 and sequenced using the same primers.
Both the strands were sequenced. A portion of the insert was
also sent to Medigene (Germany) for confirmation of the
sequences obtained in the laboratory. The sequence has been
submitted to GenBank under accession number L81125. A
homology search was carried out for the sequence using 
at the EMBL database, Heidelberg, Germany, and  at
GenBank, NCBI, NLM, Bethesda, USA.
S1 nuclease mapping and primer extension assays. Total
RNA was isolated by the Qiagen RNaeasy midi kit from
Pseudomonas sp. IMT37 grown in the presence of butane as
the sole source of carbon and energy. S1 nuclease mapping was
carried out as described in Sambrook et al. (1989). RNA
(30 µg) was hybridized with the labelled probe and treated
with S1 nuclease at 45 mC for 2 h. For the preparation of the
probe, a plasmid, pGEMPstRT3, was constructed by cloning
a " 1n4 kb PstI fragment of pRT3 in the PstI site of pGEM5Z
(Fig. 1). The construct pGEMPstRT3 was digested with EcoRI
and the 5h ends of digested DNA were labelled with [γ-$#P]ATP
using T4 polynucleotide kinase after dephosphorylating the
ends with calf intestinal alkaline phosphatase. The endlabelled DNA was then digested with ScaI and separated in a
1 % (w\v) agarose gel. A 532 bp labelled EcoRI–ScaI fragment
(Fig. 1) was cut out from gel and the DNA was eluted by a
Qiaquick gel extraction kit (Qiagen).
The primer extension assay was carried out as described in
Sambrook et al. (1989). Primer was prepared by digesting endlabelled EcoRI-digested pGEMPstRT3 (as described above)
with ApaI and a 195 nt EcoRI–ApaI fragment (Fig. 1) was
eluted from the gel with a Qiaquick gel extraction kit. Primer
was hybridized to 30 µg IMT37 RNA for 16 h at 30 mC after
initial denaturation at 85 mC for 10 min in hybridization buffer
(40 mM PIPES buffer, pH 6n4 ; 1 mM EDTA ; 0n4 M NaCl ;
80 %, v\v, formamide). Reverse transcription was done at
42 mC for 1 h, the reaction was stopped by adding 1 µl 0n5 M
EDTA and the remaining RNA was removed by DNase free
RNaseA treatment followed by phenol\chloroform extraction. The primer extension products were precipitated with
absolute ethanol at k70 mC and washed with 70 % (v\v) cold
ethanol. DNA was resuspended in 8 µl TE buffer.
The extended product in the primer extension assay and the S1
nuclease protected region were analysed on a 6 % polyacrylamide sequencing gel containing 8 M urea after heating
the reaction mix at 90 mC for 5 min. Samples were loaded
adjacent to a DNA sequence ladder generated by using a
standard primer with the single-stranded M13 bacteriophage
DNA (Sequenase kit version 2.0 ; Amersham).
Insertional inactivation of the ORF. The longest ORF of
1512 bp in pRT3A was cut at a BstEII site located at 536 bp
downstream of the start codon (ATG). This was blunt-ended
and ligated to the kanamycin (‘ kan ’) cassette (Pharmacia)
which was also blunt-ended at the EcoRI ends. The plasmid
carrying the kanamycin-disrupted ORF was designated
pRT3AK (Fig. 1). This construct was used to transform
Pseudomonas sp. IMT37.
Electrotransformation of Pseudomonas. Bacteria were grown
at 37 mC until mid-exponential phase (OD 0n3) with shaking,
'!!
2483
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:57:24
R. S. P A D D A a n d O T H E R S
.................................................................................................................................................................................................................................................................................................................
Fig. 1. Overall cloning strategy. A 4n9 kb EcoRI DNA fragment identified by immunoscreening using an anti-58 kDa
antibody was cloned in pUC18 and the product is pTC4. The 58 kDa ORF is present in its 2n0 kb EcoRI–HindIII fragment
and is shown as a shaded horizontal bar. A KpnI–HindIII subclone (pRT3A) of pRT3 includes the above 2n0 kb EcoRI–HindIII
fragment encoding the 58 kDa polypeptide plus 240 bases upstream of the EcoRI site. The direction of transcription is
shown by an inverted arrow ( ) in the 2n3 kb insert of pRT3A. The ORF in pRT3A was disrupted by inserting a blunt-ended
kanamycin cassette at the BstEII site. This disrupted construct (pRT3AK) was used for insertional inactivation studies. A
1n4 kb PstI fragment of pRT3, which contains the 5h end and upstream region of the ORF, was cloned in pGEM5Z. A 195 nt
ApaI–EcoRI and a 532 nt ScaI–EcoRI fragment from this construct (pGemPstRT3) was used in primer extension and S1
nuclease analysis, respectively. The 4n9 kb EcoRI fragment or a part of it, the 2n0 kb EcoRI–HindIII fragment, was used in
probing experiments. The sizes shown in the line drawings are of the inserts only.
washed once in transformation buffer (300 mM sucrose ;
7 mM sodium phosphate, pH 7n4 ; 1 mM MgCl ) and re# −" (Wirth
suspended in the same buffer to yield 10* c.f.u. ml
et al., 1989). Aliquots of 200 µl were made and stored at
k70 mC. For electroporation, an aliquot of competent cells
was thawed on ice and 100–200 ng DNA was mixed with the
cells. Electroporation was done in a 0n4 cm cuvette (Bio-Rad)
with the Gene Pulser (Bio-Rad) setting at 2n5 kV, 25 µF
and 800 Ω. After pulsing, 800 µl LB was added to the cuvette
and cells were transferred to 2 ml vials. These were incubated
at 37 mC for 2 h and 100 µl of the culture was spread on
appropriate plates.
stainless steel column containing PorapakQ. The column was
run isothermally at 180 mC with nitrogen (30 ml min−") as
the carrier gas. The amount of epoxide was quantified
from the peak area measured using a reporting integrator
(Chromatopac C-R6A ; Shimadzu) that was calibrated with
standard solutions. Rates were expressed in nmol epoxybutane formed (g cells)−" h−".
Monooxygenase assay (Murrell & Ashraf, 1990). Cells were
grown in MM-glucose (0n2 %, w\v) for 6 h. After harvesting
the cells, fresh mineral medium was added and cells were
exposed to a butane\air (6 : 4) mixture for 10–12 h. Cells were
harvested again, washed once in 20 mM Tris, pH 6n8, and
resuspended in the same buffer to give a suspension of
50 mg ml−". The assay was performed in 2 ml gas chromatography vials. The assay mixture contained 50 µl cell suspension and 200 µl Tris buffer, pH 6n8 (20 mM). After
equilibration for 1 h at 30 mC in a water bath, 1 ml air was
drawn out and replaced with 1 ml butene (substrate) using an
airtight Hamilton syringe. The vials were incubated at 37 mC
for 2 h. After 2 h, 10 µl samples were removed and injected in
a gas chromatograph (GC-14B ; Shimadzu) fitted with a
Twenty-three colonies were isolated in pure form after
repeated cycles of enrichment using LPG as carbon
source. Three of them were selected for detailed studies.
IMT35 was a Gram-positive coccus ; IMT37 and IMT40
were Gram-negative rods. IMT40 and IMT35 could
utilize both propane and butane for growth and IMT37
could grow on butane but not on propane. On the basis
of morphological and biochemical characteristics, they
were identified as Rhodococcus sp. IMT35 and Pseudomonas sp. IMT37 and IMT40.
RESULTS AND DISCUSSION
Isolation of gaseous-alkane-utilizing bacteria
Both Rhodococcus sp. IMT35 and Pseudomonas sp.
IMT40 could grow well on propane, butane, pentane
2484
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:57:24
Involvement of a novel gene in butane utilization
and hexane but not on methane or ethane. They could
utilize a wide variety of carbon sources tested (e.g.
glucose, glycerol, lactate, citrate, pyruvate) and most of
the intermediates (propanol, butanol, propionic acid,
acetic acid, acetol) of the proposed propane and butane
metabolic pathways (Woods & Murrell, 1989 ; Van
Ginkel et al., 1987).
(a)
1
2
3
4
Identification and purification of a specific
polypeptide induced by propane or butane and
specificity of the antibody
Membrane fractions of glucose-, propane (or butane)and nutrient-broth-grown Pseudomonas sp. IMT40 and
Rhodococcus sp. IMT35 were analysed by SDS-PAGE.
One unique polypeptide band of 58 kDa was apparent
in propane (or butane)-grown cells, but not in glucoseor nutrient-broth-grown cells. Since the 58 kDa band
was more prominent in Rhodococcus sp. IMT35, it was
purified by electroelution. Antibody was raised against
this polypeptide. Immunoblots of membrane preparations of both IMT35 and IMT40 were probed with
anti-58 kDa antibody. Positive immunoreactions were
obtained with the corresponding band in each only
when the cells were grown on butane (Fig. 2a). Antigenically similar protein was also induced when propane
was used as a growth substrate since a similar immunopositive reaction was obtained with membrane
preparations of such cells (data not shown). The
antibody showed no detectable reaction with membrane
fractions prepared from glucose- or nutrient-brothgrown cultures (Fig. 2a). An immunoblot experiment
could not detect this polypeptide in membrane
preparations of cells grown on propanol or butanol, the
first intermediate of the proposed propane (Woods &
Murrell, 1989) and butane (Van Ginkel et al., 1987)
pathway, respectively (data not shown). Pseudomonas
sp. IMT37 did not appear to have an antigenically
similar protein since no positive reaction could be
detected against this antibody (data not shown).
Hamamura et al. (1999) reported induction of a protein
of similar molecular mass in butane-grown cells of ‘ P.
butanovora ’ and Mycobacterium vaccae. Based on a
["%C]acetylene inhibition study of butane degradation by
these two bacteria, the authors suggested that this could
be a component of BMO. The protein reported by them
and the protein we describe here show similarities in
induction and molecular mass. We have reason to
believe that the 58 kDa protein we purified is also a
component of BMO as described later in the paper.
The anti-58 kDa antibody was used in a dot-ELISA
format against whole cells of seven micro-organisms
(Table 1, marked with an asterisk) grown on propane or
butane, glucose and in nutrient broth. Alkane-grown
cells of IMT35 and IMT40 could be easily detected,
while the same organisms grown on other substrates
(glucose or nutrient broth) did not react with this
antibody. Other organisms which could not utilize
propane or butane failed to show any positive reactions.
In order to test the sensitivity of this method, 5 µl each
(in duplicate) of 10)–10$ propane-grown cells ml−" was
(b)
1
2
3
4
kDa
— 205
—116
—94
—66
—45
— 29
.................................................................................................................................................
Fig. 2. (a) Western immunoblot showing the specificity of the
anti-58 kDa antibody. Lanes : 1, purified 58 kDa protein ; 2, 3
and 4, membrane fractions of Rhodococcus sp. IMT35 grown in
nutrient broth, on butane and on glucose, respectively. (b)
Immunoblot showing the presence of a fusion protein in crude
protein extracts of recombinant lysogens. Lanes : 1, purified
58 kDa protein ; 2, λgt11 ; 3, λTC1 ; 4, λTC4.
spotted onto a membrane filter and was processed as
above. It was observed that about 5i10$ cells per spot
(i.e. 10' cells ml−") were required for detection by this
method (data not shown). The technique of dot-ELISA
gives relatively rapid results, is easy to perform and
many samples can be checked on a membrane filter.
Thus detection of propane- and butane-utilizing bacteria
with the polyclonal antibody raised against the 58 kDa
2485
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:57:24
R. S. P A D D A a n d O T H E R S
protein may open up an interesting possibility for its use
in microbiological prospecting for oil and natural gas.
Analysis of a genomic library of Pseudomonas sp.
IMT40 constructed in λgt11
Since specific antibody was available, attempts were
made to find the gene which encodes this butane (or
propane)-induced 58 kDa polypeptide. Immunoblot
experiments showed that a similar protein was present
in both Rhodococcus sp. and Pseudomonas sp. IMT40.
It was therefore decided to clone the gene from the latter
organism because, being a Gram-negative organism, it
should be more amenable to genetic manipulation
procedures. A genomic library of Pseudomonas sp.
IMT40 was constructed in λgt11 as described in
Methods. A total of nearly 10& plaques of an amplified
genomic library were screened using anti-58 kDa antibody. Out of four putative clones, a 4n9 kb insert could
be found only in two, and they were designated λTC1
and λTC4. When nick-translated 4n9 kb DNA fragments
of λTC1 and λTC4 were used for hybridization under
stringent conditions (50 % formamide at 42 mC) with
total DNA of these four clones, λTC1 and λTC4 showed
a strong positive signal but no detectable reaction was
obtained with λTC2 and λTC3.
These two recombinant clones containing the 4n9 kb
insert were lysogenized in E. coli Y1089 and then crude
lysates were analysed by dot-ELISA. Each of them
showed the presence of a protein reacting strongly with
anti-58 kDa antibody. When the lysates were run on an
SDS-PAGE gel and the immunoblot was probed with
anti-58 kDa antibody, both λTC1 and λTC4 lysates
showed the presence of a fusion protein of about
170 kDa (Fig. 2b). Control λgt11 lysogen showed no
reaction with the antibody.
The 4n9 kb inserts from λTC1 and λTC4 were re-cloned
in the EcoRI site of pUC18 and were designated pTC1
and pTC4, respectively. Digestion of these two clones
with 13 restriction endonucleases generated identical restriction patterns. Restriction endonuclease digestion
of this 4n9 kb DNA fragment of Pseudomonas sp. IMT40
with HindIII produced a 2n9 kb and a 2n0 kb fragment
(Fig. 1). These two fragments with appropriate manipulations were ligated to λgt11, packaged into lambda and
then transfection was carried out. The resulting plaques
were screened with anti-58 kDa antibody. DNA isolated
from plaques showing positive reactions was found to
contain either 2n0 kb or full 4n9 kb inserts. Plaques which
showed no reaction had the 2n9 kb fragment. This
implied that the 2n0 kb sub-fragment was responsible for
encoding the polypeptide and the polypeptide was being
expressed as a fusion protein from the 2n0 kb EcoRI–
HindIII end.
Specificity of the 4n9 kb fragment in detection of
propane/butane-utilizing bacteria
In order to check whether other bacteria had DNA
sequences similar to the 4n9 kb fragment of Pseudomonas sp. IMT40, DNA hybridization studies were
A
B
C
D
1
2
3
4
5
6
7
8
.................................................................................................................................................
Fig. 3. Detection of propane- and butane-utilizing bacteria by a
4n9 kb DNA probe. Hybridization was carried out at 45 mC with
45 % (v/v) formamide using a 4n9 kb cloned DNA fragment.
Spots in the blots are genomic DNA from : A1, Pseudomonas sp.
IMT40 ; A2, Rhodococcus sp. IMT35 ; A3, IMT24 ; A4, IMT23 ; A5,
IMT37 ; A6, IMT33 ; A7, IMT32a ; A8, IMT32b ; B1, IMT39 ; B2,
IMT41 ; B3, IMT14 ; B4, IMT34 ; B5, Serratia marcescens; B6,
Pseudomonas sp. MTCC 129 ; B7, Rhodococcus sp. MTCC 289 ;
B8, Vibrio sp. ; C1, Lactobacillus fermentum; C2, Gluconobacter
oxydans ; C3, E. coli ; C4, IMT21 ; C5, Pseudomonas cepacia ;
C6, Micrococcus sp. ; C7, Flavobacterium antarcticus ; C8,
Corynebacterium sp. ; D1, Arthrobacter sp. ; D2, blank ; D3,
Nocardia petroleophila ; D4, Mycobacterium sp.
performed with DNAs of many propane\butaneutilizing as well as non-utilizing bacteria (Table 1).
Genomic DNA from each bacterium was applied onto
nylon membrane and probed with a $#P-labelled 4n9 kb
fragment at 45 mC using different concentrations (40, 45
and 50 %) of formamide. It was observed that at a 40 %
formamide concentration, the probe yielded detectable
signal with DNAs of propane- and butane-utilizing
bacteria tested including the strain obtained from the
NCIB, UK (Pseudomonas sp. MTCC 129). The other
strain, Rhodococcus sp. MTCC 289 (a kind gift from
J. J. Perry, North Carolina State University, USA), resulted in a weak but detectable signal. However, at this
concentration of formamide only Micrococcus sp. and
Vibrio sp., which could not utilize propane\butane,
showed weak and non-specific hybridization. Such a
non-specific signal was drastically reduced when the
concentration of formamide was raised to 45 % (Fig. 3).
Among the 15 hydrocarbon-utilizing bacteria, eight
2486
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:57:24
Involvement of a novel gene in butane utilization
showed a strong reaction and seven showed a weak
but detectable reaction. A non-specific reaction was
obtained with only one organism (Micrococcus sp.). At
a 50 % formamide concentration, the probe showed
strong hybridization only with four isolates : Pseudomonas sp. IMT37, Rhodococcus sp. IMT35, IMT41 and
Pseudomonas sp. IMT40 (from where the DNA fragment was cloned). Thus the DNA hybridization results
establish that the entire 4n9 kb region is unique to
bacteria which could utilize these two alkanes for
growth. The DNA probe could not only detect our
propane\butane-utilizing bacterial isolates, it reacted
positively with two reported hydrocarbon-utilizing
strains, Pseudomonas sp. NCIB 11309 ( l MTCC 129)
and Rhodococcus sp. MTCC 289, obtained from
different geographical regions under optimized
hybridization conditions (45 % formamide at 45 mC).
Hybridization was also carried out with the smaller
2n0 kb EcoRI–HindIII region of the cloned 4n9 kb fragment as a probe and genomic DNAs of the test
organisms. Reactions were performed at 45 mC in the
presence of 40 % formamide. The probe showed specific
signals with all propane\butane-utilizing bacteria
tested. Weak and non-specific hybridization was
obtained with only Micrococcus sp. and Corynebacterium liquefaciens (data not shown).
The 2n0 kb EcoRI–HindIII fragment and 0n6 kb DNA
upstream of EcoRI have been sequenced and analysed
from Pseudomonas sp. IMT37 (see below). The sequence (GenBank accession no. L81125) appeared to be
novel since no significant similarity was observed with
available sequences in databases. The sequence of the
full ORF in Pseudomonas sp. IMT40 DNA was also
determined and was found to be identical to that of
Pseudomonas sp. IMT37. The specificity of the DNA
probes could therefore be explained on the basis of the
determined base sequence, which was found to be
unique to bacteria with propane\butane utilization
capabilities.
Cloning and sequencing of a hydrocarbon-specific
gene(s)
The conserved nature of the 4n9 kb EcoRI fragment
among gaseous alkane utilizers suggested its importance
in the pathway, but its exact role was not clear. In order
to investigate the nature of the protein encoded by this
fragment, we decided to compare its sequence with
other known sequences. It was of interest to see if
the sequence encodes a protein involved in butane
utilization or is involved non-specifically in the
utilization of other alkanes as well.
A genomic library of Pseudomonas sp. IMT37 was
constructed in the HindIII site of cosmid vector pHC79
for cloning and characterizing the genes involved in the
butane utilization pathway. This library was screened
using the 4n9 kb fragment (described above) as a probe.
The restriction map of the corresponding region in
Pseudomonas sp. IMT37 was identical to that of IMT40.
Four different types of clones having insert sizes from 6
to 26 kb were obtained. These clones covered a region of
nearly 40 kb around the 4n9 kb fragment. Since it was
known (described above) that a 2n0 kb EcoRI–HindIII
region of the 4n9 kb fragment encodes the 58 kDa
protein, the corresponding region from one of the clones,
designated pRT3 (Fig. 1), was subcloned in pUC19 and
designated pRT3A. The total insert (HindIII–KpnI
fragment) of 2n3 kb in pRT3A was sequenced. A 0n3 kb
(KpnI–PstI) fragment upstream of pRT3A was also
subcloned (pRT3B.1) and the sequence determined.
Sequence analysis
A search of the databases revealed no significant
similarity with any known sequences, thus implying that
this is a novel sequence. The entire 2606 bp sequence
(GenBank accession no. L81125) was analysed using
Sequaid II and MicroGenie software. The sequence was
translated in all six possible frames. One ORF with two
possible initiation sites (ATG) could be recognized.
Irrespective of initiation at position 502 or at base 544,
the termination codon (TGA) was at position 2014,
thereby producing a polypeptide of 504 or 490 amino
acids, respectively. Since the largest reading frame could
encode a polypeptide of 54 kDa, this ORF was designated orf54. The molecular mass of the polypeptide in
either case (54 or 52n3 kDa) is slightly less than the one
(58 kDa) determined by SDS-PAGE, a phenomenon
which is often reported for membrane proteins (Buchel
et al., 1980 ; Youvan et al., 1984). Analysis of the
hydropathy plot of the translated product did not reveal
features indicating its possible transmembrane location
except a small stretch of about 20 amino acids at the Nterminus. However, the C-terminal region was found to
be rich in cysteine residues, which implies that the
protein possibly has many disulfide linkages or some
metal binding sites. Upstream of both the possible
initiation codons, putative RBS sequences are present at
bases 14 and 16 upstream of the first ATG and bases 4
and base 8 upstream of the second ATG. At present,
there remains some uncertainty regarding the translational start of the protein. Six inverted repeats having
free energy ranging between k12n8 and 23n0 kcal
(k53n76 and 96n6 kJ) could be detected within the ORF.
One of these inverted repeats (1978–2019) is present at
the very end of the ORF. However, the significance of
these repeats is not yet understood.
Analysis of the promoter region and the phenotypes of
gene disruption mutants (see below) indicate that the
gene might encode a component of multicomponent
BMO. Therefore, special attention was given to compare
the sequence with the known sequences of pMMO
(Semrau et al., 1995), sMMO (Stainthorpe et al., 1990)
and alkane monooxygenase (Kok et al., 1989a). No
significant similarity was observed. This was not
surprising because even the monooxygenases associated
with hydrocarbon metabolism reported so far show very
little sequence homology among themselves. The
pMMO components, however, show homology with
2487
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:57:24
R. S. P A D D A a n d O T H E R S
1
2
G A T C
F
B
H
H
H
E
.................................................................................................................................................
.................................................................................................................................................
Fig. 4. Identification of the transcription start site of the gene
encoding the 58 kDa protein by primer extension and S1
nuclease mapping. Arrows show the primer and the extended
product in primer extension (lane 1). Lane 2 shows the
protected region from the 532 nt EcoRI–ScaI fragment in S1
nuclease mapping. The sequence ladder used to determine the
size was generated from single-stranded M13 bacteriophage.
ammonia monooxygenase (Semrau et al., 1995 ; Holmes
et al., 1995).
Primer extension and S1 nuclease mapping
In order to determine the transcription start site and to
identify a promoter region upstream, primer extension
and S1 nuclease mapping were carried out. The size of
the primer extension product was determined by comparison with the sequence ladder of pGEMPstRT3
obtained with primer ATTCCATTCTGCTGCTGCCC (PE3 ; bases 550–531) (data not shown) and an
unrelated but known sequence ladder of M13 bacteriophage DNA. Primer extension using a 195 nt
labelled EcoRI–ApaI fragment (Fig. 1) as the primer
yielded a product of 267 nt and, therefore, there was an
extension of 72 nt to this primer (Fig. 4). The results
suggest that transcription of this ORF starts at a ‘ T ’
261 nt upstream (5h) of the start codon ATG, located at
544.
S1 nuclease mapping, done with a 532 nt labelled
(EcoRI–ScaI) fragment (Fig. 1), also showed a protected
region which moves in the sequencing gel at a position
which was identical to that of the primer extension
Fig. 5. Alignment of orf54 promoter sequences with ntr-like
promoters (Dixon, 1986 ; Johnson et al., 1986 ; Deretic et al.,
1987). The k24 and k12 sequences are in bold and underlined
and the more conserved dinucleotide sequences in these
conserved sequences are shown in a shaded box.
product and is therefore 267 nt long (Fig. 4). Thus,
similar results obtained from both the primer extension
assay as well as S1 nuclease mapping show convincingly
that transcription starts at base 283. Pseudomonas is
known to possess E. coli k35 and k10 consensus
sequence as well as its unique promoter sequence
(TGGC at the k24 and TGCT at the k12 position ;
Deretic et al., 1987). In this ORF, the promoter sequence
is similar to Pseudomonas and has an identical TGGC at
the k24 position and GGCT at k11. The conclusion
that transcription starts at base 283 is also reinforced by
the presence of a promoter at an ideal distance upstream.
The position and the sequence of the promoter bear
close resemblance to promoters in other systems such as
xylA in Pseudomonas putida, several nif genes in
Klebsiella pneumoniae, Azotobacter chroococcum and
Azotobacter vinelandii (Dixon, 1986) and also the pilin
gene in Pseudomonas aeruginosa (Johnson et al., 1986).
Common features of these genes are : (a) their transcription is ntrA-dependent (Dixon, 1986), (b) involvement of an activator protein (Kustu et al., 1989) and (c)
a characteristic conserved GC doublet at around
k12 bp and a conserved GG doublet at around k24 bp
upstream of the transcription start site. An alignment of
the orf54 promoter sequence with a few other ntrAdependent genes is shown (Fig. 5). It is very likely,
therefore, that this gene encodes an enzymic rather than
2488
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:57:24
Involvement of a novel gene in butane utilization
a regulatory protein and may also need the ntrA product
for its transcription.
of an incorrect reading frame at the point of single
crossover. Similar observations were also reported by
Martin & Murrell (1995).
Insertional inactivation of the ORF
Growth of all these transformants was also checked on
other hydrocarbons and on different intermediates of
their metabolic pathways as sole carbon sources. Five
transformants (37.1K–37.5K) did not grow on any of the
hydrocarbons tested viz. butane, pentane, hexane, heptane, octane, nonane and decane, but on the other hand
they were able to grow on n-butanol, 1-propanol,
hexanoic acid and caprylic acid. Three transformants,
37.6K, 37.7K and 37.8K, and the wild-type Pseudomonas
sp. IMT37 were able to grow on all these carbon
sources. The inability of these transformants to grow on
butane was also confirmed using liquid minimal medium
(MM), with butane as the sole carbon source. This
inability of mutants to utilize butane might be due to the
loss of monooxygenase activity that converts hydrocarbons to their respective alcohols. In order to check
that the disruption of the ORF in pRT3A results in the
loss of monooxygenase activity, a whole cell enzyme
assay was performed. Monooxygenase activity in one of
the mutants, 37.1K (unable to grow on hydrocarbons),
was not detectable. In another transformant, 37.7K
(kanamycin-resistant but able to grow on hydrocarbons), the monooxygenase activity [131n8 nmol h−"
(g cell wet wt)−"] was comparable to the wild-type
activity [134 nmol h−" (g cells)−"]. This observation
suggests that in these five mutants (37.1AK–37.5AK) the
defect is in the first step of the metabolic pathway and
not in any subsequent step because they can utilize
intermediates such as alcohols and acids. This implies
that alcohol dehydrogenase, aldehyde dehydrogenase
and other enzymes involved in the pathway are not
affected. The phenotype of the mutants and analysis of
the sequence indicate that the ORF encodes an essential
component of BMO and not a regulatory protein.
Further experimentation will be necessary to confirm
this hypothesis. As is evident from the growth studies,
inactivation of the gene results in the loss of the ability
to utilize a series of hydrocarbons from C to C . The
%
"!of the
result therefore shows that functional integrity
gene is essential for utilization of alkanes as carbon and
energy source. It may not be possible, at present, to
conclude that this organism uses the same genetic and
metabolic route for utilization of the alkanes tested but
the results definitely support the view that the product of
this ORF is involved in catalysing the conversion of at
least seven alkanes (C –C ) to the respective alcohols.
% the
"! gene therefore appears to
The protein encoded by
show broad specificity in its action towards alkanes
from C to C .
%
"!
Although there exists some physiological evidence to
substantiate the pathway proposed for butane metabolism in bacteria (van Ginkel et al., 1987 ; Arp, 1999), no
information is available about the nature of the proteins
involved and the genetic machinery they employ. We
were able to isolate for the first time a polypeptide
specifically induced by butane and clone and sequence
the DNA fragment encoding this protein. The specificity
In order to ascertain the function of the 1512 bp ORF
from pRT3A in hydrocarbon utilization, it was disrupted at 536 bp downstream of the ATG start codon
in the ORF using a kanamycin cassette. The ORF
in pRT3A was digested with BstEII and blunt-ended.
A kanamycin cassette (1n3 kb), having EcoRI ends
(Pharmacia), was also blunt-ended with Klenow and
ligated to pRT3A. The recombinant plasmid, designated
pRT3AK, was electroporated into Pseudomonas sp.
IMT37. A total of 43 kanamycin-resistant transformants
were selected for preliminary characterization. These
transformants were initially checked for their ability to
grow on butane, pentane and hexane. Five out of 43
transformants were unable to utilize any one of these
alkanes and have a possible disruption in the target gene.
These were designated 37.1K, 37.2K, 37.3K, 37.4K and
37.5K. Three kanamycin-resistant transformants which
could grow on these hydrocarbons were also selected for
analysis. These were designated 37.6K, 37.7K and 37.8K.
Since pUC19-based plasmids could not survive in
Pseudomonas and since the spontaneous frequency of
kanamycin resistance was below a detectable level, the
only way these transformants could become kanamycin
resistant was by integration of the plasmid (pRT3AK)
into the chromosome by homologous recombination.
Homologous recombination may result from single or
double crossover events. Southern hybridization of
chromosomal DNA isolated from the six selected
kanamycin-resistant mutants confirmed the presence of
the kanamycin cassette (data not shown). When genomic
DNA was digested with EcoRI and probed with the
labelled 4n9 kb fragment, wild-type Pseudomonas sp.
IMT37 revealed, as expected, only one band of 4n9 kb
whereas the mutant 37.3K showed a band of 6n2 kb (data
not shown). The increased size of this fragment was due
to a double crossover event between the insert (having
the ORF disrupted by a kanamycin cassette) and the
chromosomal DNA. Four other mutants (37.1K, 37.4K,
37.7K and 37.8K) showed two bands of 4n9 kb and 6n2 kb
on hybridization with the 4n9 kb fragment. This observation is in agreement with integration of the plasmid
pRT3AK by a single homologous crossover event. Single
crossover would result in integration of the whole
plasmid and this event would still retain an undisrupted
copy of the gene while the other one will be disrupted.
Such kanamycin-resistant transformants, therefore,
should not lose the ability to grow on propane and
butane. The majority of the transformants, exemplified
by 37.6K, 37.7K and 37.8K, belong to this group as
expected. In spite of originating from single crossover
events, as revealed by Southern analysis, four (37.1K,
37.2K, 37.4K and 37.5K) out of 43 transformants could
not utilize any of the alkanes tested. Their phenotype
appears to be similar to the transformant 37.3K, which
represents a double crossover phenomenon. This unexpected behaviour could be attributed to the formation
2489
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:57:24
R. S. P A D D A a n d O T H E R S
of the anti-58 kDa antibody for the detection of
bacteria which were actively utilizing a gaseous
alkane(s) could be explained on the basis of the
polypeptide being induced specifically by such a substrate(s). Since the DNA sequence encoding this polypeptide was found to be novel, we could show that the
DNA fragment could be used as a probe for detection of
such microbes. By a marker exchange mutagenesis
approach, it was possible to identify and characterize
for the first time a unique gene induced by butane. The
organism could grow on other higher linear alkanes ;
however, following the disruption of this gene its ability
to utilize other hydrocarbons of length C –C is
% "!may
abolished. It seems, therefore, that the same gene
also be induced by other alkanes (C –C ) and the gene
& of
"! these hydroproduct is essential for metabolism
carbons. This implies a broad specificity of the system.
On the other hand, the organism can not utilize alkanes
shorter than butane. Therefore, a mechanism probably
exists to measure the chain length of hydrocarbons that
the organism encounters. This possibility needs to be
confirmed by further work.
ACKNOWLEDGEMENTS
The authors thank the kind help of Dr A. Agnihotri, Mr S. S.
Virmani and Dr R. Talwar of ONGC, Dr Pramod Sharma and
Dr D. S. Arora for their help and active involvement in
collection of soil sample from oilfields. We thank Dr P.
Chakraborty and Dr A. Mondal for critical reading of the
manuscript, and Dr Shekhar Mande for useful discussion.
Thanks are also due to Mr Sushil Kumar and Ms Mamta Saini
for their skilful typing. Financial assistance from CSIR, DBT
and ONGC is duly acknowledged. R. S. P., K. K. P., V. D. N.
and S. K. were recipients of a CSIR fellowship. This is
IMTECH communication no. 044\99.
REFERENCES
Arp, D. J. (1999). Butane metabolism by butane grown ‘ Pseudo-
monas butanovora ’. Microbiology 145, 1173–1180.
Buchel, D. E., Gronenborn, B. & Mu$ ller-Hill, B. (1980). Sequence of
the lactose permease gene. Nature 283, 541–545.
Colby, J., Stirling, D. I. & Dalton, H. (1977). The soluble methane
monooxygenase of Methylococcus capsulatus (Bath). Its ability
to oxygenate n-alkanes, n-alkenes, ethers and alicyclic, aromatic
and heterocyclic compounds. Biochem J 165, 395–402.
Colby, J., Dalton, H. & Whittenbury, R. (1979). Biological and
biochemical aspects of microbial growth on C1 compounds.
Annu Rev Microbiol 33, 481–517.
Coleman, J. P. & Perry, J. J. (1985). Purification and characterization of the secondary alcohol dehydrogenase from propane
utilizing Mycobacterium vaccae JOB 5. J Gen Microbiol 131,
2901–2907.
Dalton, H. (1980). Oxidation of hydrocarbons by methane
monooxygenase from a variety of microbes. Adv Appl Microbiol
131, 2901–2907.
Dalton, H. S., Prior, D., Leak, D. J. & Stanley, S. H. (1984).
Regulation and control of methane monooxygenase. In Microbial
Growth on C1 Compounds, pp. 75–82. Proceedings of the 4th
International Symposium. Edited by R. L. Crawford & R. S.
Hanson. Washington, DC : American Society for Microbiology.
Deretic, V., Gill, J. F. & Chakrabarty, A. M. (1987). Alginate
biosynthesis : a model system for gene regulation and function in
Pseudomonas. Biotechnology 5, 469–477.
Dixon, R. (1986). The xylABC promoter from the Pseudomonas
putida TOL plasmid is activated by nitrogen regulatory genes in
Escherichia coli. Mol Gen Genet 203, 129–136.
Eggink, G., Lageveen, R. C., Attenburg, B. & Witholt, B. (1987a).
Controlled and functional expression of the Pseudomonas
oleovorans alkane utilizing system in Pseudomonas putida and
Escherichia coli. J Biol Chem 262, 17712–17718.
Eggink, G., van Lelyveld, P. H., Arnberg, A., Arfman, N.,
Witteveenv, C. & Witholt, B. (1987b). Structure of the Pseudo-
monas putida alkBAC operon. J Biol Chem 262, 6400–6406.
Eggink, G., Engel, H., Meijer, W. G., Otten, J., Kingma, J. &
Witholt, B. (1988). Alkane utilization in Pseudomonas oleovorans :
structure and function of the regulatory locus alkR. J Biol Chem
263, 13400–13405.
Eggink, G., Engel, H., Vriend, G., Terpstra, P. & Witholt, B. (1990).
Rubredoxin reductase of Pseudomonas oleovorans : structural
relationship to other flavoprotein oxidoreductases based on one
NAD and two FAD finger prints. J Mol Biol 212, 135–142.
Fox, B. G. & Lipscomb, J. D. (1988). Purification of a high specific
activity methane monooxygenase hydroxylase component from a
type II methanotroph. Biochem Biophys Res Commun 154,
165–170.
Fox, B. G., Surerus, K. K., Munck, E. & Lipscomb, J. D. (1988).
Evidence for a µ-oxo-bridged binuclear iron-cluster in the
hydroxylase component of methane monooxygenase, Mossbauer
and EPR studies. J Biol Chem 263, 10553–10556.
Fox, B. G., Froland, W. A., Degde, J. E. & Lipscomb, J. D. (1989).
Methane mono-oxygenase from Methylosinus trichosporium
OB3b. J Biol Chem 264, 10023–10033.
Green, J. & Dalton, H. (1989). A stopped flow kinetic study of
soluble methane monooxygenase from Methylococcus capsulatus
(Bath). Eur J Biochem 153, 137–144.
Grunstein, M. & Hogness, D. S. (1975). Colony hybridization, a
method for the isolation of cloned DNAs that contain a specific
gene. Proc Natl Acad Sci U S A 72, 3961–3965.
Hamamura, N., Storfa, R. T., Semprini, L. & Arp, D. J. (1999).
Diversity in butane monooxygenases among butane-grown bacteria. Appl Environ Microbiol 65, 4586–4593.
Hanson, R. S. (1980). Ecology and diversity of methylotrophic
organisms. Adv Appl Microbiol 26, 3–39.
Higgins, I. J. (1980). Respiration in methylotrophic bacteria. In
Diversity of Bacterial Respiratory Systems, pp. 187–221. Edited
by C. J. Knowles. Boca Raton, FL : CRC Press.
Hohn, B. & Collins, J. (1980). A small cosmid for efficient cloning
of large DNA fragments. Gene 11, 291–298.
Holben, W. E., Jansson, J. E., Chelm, B. K. & Tiedje, J. M. (1988).
DNA probe method for the detection of the soil bacterial
community. Appl Environ Microbiol 54, 703–711.
Holmes, A. J., Costello, A., Lidstrom, M. E. & Murrell, J. C. (1995).
Evidence that particulate methane monooxygenase and ammonia
monooxygenase may be evolutionarily related. FEMS Microbiol
Lett 132, 203–208.
Johnson, K., Parker, M. L. & Lory, S. (1986). Nucleotide sequence
and transcriptional initiation site of two Pseudomonas aeruginosa
pilin genes. J Biol Chem 261, 15703–15708.
Kasper, C. W. & Hartman, P. A. (1987). Production and specificity
of monoclonal antibodies and polyclonal antibodies to
Escherichia coli. J Appl Bacteriol 63, 335–341.
2490
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:57:24
Involvement of a novel gene in butane utilization
Kok, M., Oldenhuis, R., Van der Linden, M. P. G., Raatjes, P.,
Kingna, J., Van Lelyveld, P. H. & Witholt, B. (1989a). The
Sayler, G. S., Shieldo, M. S., Tedford, E., Breen, A., Hooper, S.,
Sirotkin, K. & Davis, J. (1985). Application of DNA-DNA colony
Pseudomonas oleovorans alkane hydroxylase gene : sequence and
expression. J Biol Chem 264, 5435–5441.
hybridization for the detection of catabolic genotypes in environmental samples. Appl Environ Microbiol 49, 1295–1303.
Sealy, J. Q. (1974). A geomicrobiological method of prospecting
for petroleum. Oil Gas J 72, 98.
Kok, M., Oldenhuis, R., Van der Linden, M. P. G., Meulenberg,
C. H. C., Kingna, J. & Witholt, B. (1989b). The Pseudomonas
oleovorans alkBAC operon encodes two structurally related
rubredoxins and an aldehyde dehydrogenase. J Biol Chem 264,
5442–5451.
Kustu, S., Santero, E., Keener, J., Popham, D. & Weiss, D. (1989).
Expression of sigma 54 (ntrA)-dependent genes is probably united
by a common mechanism. Microbiol Rev 53, 367–376.
Laemmli, U. K. (1970). Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227, 680–685.
Lidstrom, M. E. & Sterling, D. T. (1990). Methylotrophs : genetics
and commercial applications. Annu Rev Microbiol 44, 27–58.
Lonsane, B. K., Singh, H. D. & Baruah, J. N. (1977). Geomicrobiological methods for prospecting of petroleum oil gases –
a neglected aspect of petroleum prospecting. J Sci Ind Res 36,
534–541.
Lukins, H. B. & Foster, J. W. (1963). Methylketone metabolism by
hydrocarbon utilizing Mycobacteria. J Bacteriol 85, 1074–1087.
Martin, H. & Murrell, J. C. (1995). Methane monooxygenase
mutants of Methylosinus trichosporium constructed by marker
exchange mutagenesis. FEMS Microbiol Lett 127, 243–248.
Merril, C. R., Goldman, D., Sedman, S. A. & Ebert, M. H. (1981).
Ultrasensitive stain for proteins in polyacrylamide gels shows
regional variation in cerebrospinal fluid proteins. Science 211,
1437–1438.
Miyoshi, M. (1895). Die Durchbohrung von Membranen durch
Pilzfaden. J Wiss Biot 28, 269–289. [Cited in Petroleum Microbiology. Edited by R. M. Atlas. New York : Macmillan.]
Murrell, J. C. & Ashraf, W. (1990). Cell free assay methods for
enzymes of propane utilization. Methods Enzymol 188, 26–32.
Ogram, A. V., Sayler, G. S. & Barkay, T. (1987). The extraction and
purification of microbial DNA from sediments. J Microbiol
Methods 7, 57–66.
Quayle, J. R. (1980). Aspects of the regulation of methylotrophic
metabolism. FEBS Lett 117, K16–K27.
Quayle, J. R. & Ferenci, T. (1978). Evolutionary aspects of
autotrophy. Microbiol Rev 42, 251–273.
Rosenzweig, A. C., Frederick, C. A., Lippard, S. J. & Nordlund, P.
(1993). Crystal structure of a bacterial non-haem iron hydroxylase
that catalyses the biological oxidation of methane. Nature 366,
537–543.
Saeki, H. & Furahashi, K. (1994). Cloning and characterization of
a Nocardia corallina B-276 gene cluster encoding alkene monooxygenase. J Ferment Bioeng 78, 399–404.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular
Cloning : a Laboratory Manual, 2nd edn. Cold Spring Harbor,
NY : Cold Spring Harbor Laboratory.
Semrau, J. D., Chistoserdov, A., Lebron, J. & 7 other authors
(1995). Particulate methane monooxygenase genes in methano-
trophs. J Bacteriol 177, 3071–3079.
So$ hngen, N. L. (1906). U= her Bakterien, Welche Methan als
Kohlenstoffnahrung Energiquelle Gebrauchen. Zentbl Bakteriol
Parasitenkd Abt II 15, 513–517. [Cited in Petroleum Microbiology. Edited by R. M. Atlas. New York : Macmillan.]
Stainthorpe, A. C., Lees, V., Salmond, G. P. C., Dalton, H. &
Murrell, J. C. (1990). The methane monooxygenase gene cluster of
Methylococcus capsulatus (Bath). Gene 91, 27–34.
Taggart, M. S. (1967). Petroleum prospecting. In Petroleum
Microbiology, pp. 195–245. Edited by J. B. Davis. Amsterdam :
Elsevier.
Torsvik, V. L. (1980). Isolation of bacterial DNA from soil. Soil
Biol Biochem 12, 15–21.
Towbin, H., Staehelin, T. & Gordon, J. (1979). Electrophoretic
transfer of proteins from polyacrylamide gels to nitrocellulose
sheets : procedure and some applications. Proc Natl Acad Sci
U S A 76, 4350–4354.
Van Ginkel, C. G., Welten, H. G. J., Hartmans, S. & de Bont,
J. A. M. (1987). Metabolism of trans-2-butene and butane in
Nocardia TB1. J Gen Microbiol 133, 1713–1720.
Whittenbury, R., Phillips, K. C. & Wilkinson, J. F. (1970). En-
richment, isolation and some properties of methane utilizing
bacteria. J Gen Microbiol 61, 205–218.
Wirth, R., Friesenegger, A. & Fiedler, S. (1989). Transformation of
various species of gram negative bacteria belonging to 11 different
genera by electroporation. Mol Gen Genet 216, 175–177.
Woodland, M. P. & Dalton, H. (1984). Purification and characterization of component A of the methane monooxygenase from
Methylococcus capsulatus (Bath). J Biol Chem 259, 53–59.
Woods, N. R. & Murrell, J. C. (1989). The metabolism of propane
in Rhodococcus rhodochrous PNKb1. J Gen Microbiol 135,
2335–2344.
Yanisch-Perron, C., Vieira, J. & Messing, J. (1985). Improved M13
phage cloning vectors and host strains : nucleotide sequences of
the M13mp18 and pUC19 vectors. Gene 33, 103–119.
Youvan, D. C., Bylina, E. J., Alberti, M., Begusch, H. & Hearst,
J. E. (1984). Nucleotide and deduced polypeptide sequences of the
photosynthetic reaction center, B870 antenna and flanking
polypeptides from R. capsulata. Cell 37, 949–957.
.................................................................................................................................................
Received 3 January 2001 ; revised 3 April 2001 ; accepted 6 April 2001.
2491
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:57:24