Download Endoplasmic Reticulum-Localized Amyloid β

Copyright
Traffic 2004; 5: 89–101
Blackwell Munksgaard
#
Blackwell Munksgaard 2004
doi: 10.1046/j.1600-0854.2003.00159.x
Endoplasmic Reticulum-Localized Amyloid b-Peptide is
Degraded in the Cytosol by Two Distinct Degradation
Pathways
Anton Schmitz1,*, Andrea Schneider1, Markus P.
Kummer1,2 and Volker Herzog1
1
Institut für Zellbiologie, Rheinische Friedrich-WilhelmsUniversität, Ulrich-Haberland-Str. 61a, 53121 Bonn,
Germany, 2 Present address: UCSD, Department of
Neurosciences, La Jolla, CA 92093–0691
*Corresponding author: Anton Schmitz, anton.schmitz@
uni-bonn.de
The paradigm of endoplasmic reticulum (ER)-associated
degradation (ERAD) holds that misfolded secretory and
membrane proteins are translocated back to the cytosol
and degraded by the proteasome in a coupled process.
Analyzing the degradation of ER-localized amyloid b-peptide
(Ab), we found a divergence from this general model.
Cell-free reconstitution of the export in biosynthetically
loaded ER-derived brain microsomes showed that the
export was mediated by the Sec61p complex and required
a cytosolic factor but was independent of ATP. In contrast
to the ERAD substrates known so far, the exported Ab
was degraded by both, a proteasome-dependent and a
proteasome-independent pathway. RNA interference experiments in Ab-transfected cells identified the protease of the
proteasome-independent pathway as insulin-degrading
enzyme (IDE). The IDE-mediated clearance mechanism for
ER-localized Ab represents an as yet unknown type of
ERAD which is not entirely dependent on the proteasome.
Key words: amyloid b-peptide, endoplasmic reticulum,
insulin-degrading enzyme, protein degradation, protein
translocation
Received 10 October 2003, revised and accepted for publication 15 November 2003
Misfolded secretory and membrane proteins are recognized
by quality control mechanisms in the endoplasmic reticulum
(ER). They are retained in the ER and finally removed by a
series of events named ER-associated degradation (ERAD).
According to the current model of ERAD, the misfolded
proteins are translocated from the ER back to the cytosol,
where they are degraded by the 26S proteasome [for recent
reviews, see (1–3)]. Under normal conditions the misfolded
proteins are not found in the cytosol, suggesting that their
export and their proteasomal degradation are coupled processes. Evidence supporting this view has been obtained for
several proteins. For example, a misfolded form of yeast
carboxypeptidase Y did not accumulate in the cytosol but
was retained in the ER when polyubiquitination, which serves
as the main signal for degradation by the 26S proteasome,
was inhibited (4,5). The membrane extraction of an artificial
degradation substrate (6) and of CD4 (7), as well as the export
of an unassembled immunoglobulin light chain (8), were
reduced when the catalytic activity of the proteasome was
inhibited. However, there is also evidence for a less tight
coupling of translocation and proteasomal activity. The MHC
class I heavy chain (9) and the cystic fibrosis transmembrane
conductance regulator (10) were found in the cytosol after
inhibition of proteasomal activity.
During the intoxication of their target cells, several bacterial
and plant toxins such as cholera toxin or ricin are transported
in a retrograde manner through the secretory pathway to the
ER, from where they translocate into the cytosol. Their
translocation appears to depend on the Sec61p complex
(11–13), which also mediates the translocation of misfolded
proteins (14–18). In contrast to ERAD substrates, however,
these toxins largely escape the proteasomal degradation
and act as functional enzymes in the cytosol.
One characteristic feature of Alzheimer’s disease (AD) is the
accumulation of the amyloid b-peptide (Ab) in extracellular
plaques. Ab is generated by proteolytic processing of the
amyloid precursor protein (APP) in the secretory and endocytic pathways but not completely released into the extracellular space. Consequently, Ab is found not only in the
extracellular space but also in intracellular compartments
[for review, see (19)]. Ab, in particular its 42-amino-acidslong form (Ab42), is also generated in the ER but only very
inefficiently transported further along the secretory pathway
(20–24). Nevertheless, only small amounts of Ab42 are
found in the ER, even upon over-expression of APP.
Therefore, we asked whether the accumulation of Ab42 in the
ER is counteracted by its removal through the ERAD machinery. We show that the export of Ab is distinct in several
aspects from that of other ERAD substrates and that the
exported Ab is degraded by proteasome-dependent and
proteasome-independent pathways. RNA interference experiments identified the protease of the latter pathway as insulindegrading enzyme (IDE).
Results
Ab 42 is exported from microsomes
The hypothesis that ER-localized Ab is degraded by the
proteasome implies that it is exported from the ER to the
89
Schmitz et al.
cytosol. We obtained first evidence for this hypothesis by
morphological analysis of CHO cells transfected with
ER-targeted Ab. In these cells Ab was found not only in the
ER but also in the cytosol, where it formed aggregates (25).
To study the export biochemically, a cell-free export system
was applied. In principle, ER-derived brain microsomes
were loaded with Ab42 by in vitro translation and the
release of the imported Ab42 was monitored. To allow
the import of Ab42 into the microsomes, the signal peptide
of APP was fused to the N-terminus of Ab42 (Figure 1A). To
verify the import, Ab42-loaded microsomes were re-isolated
by centrifugation and subjected to protease protection
analysis (Figure 1B). Trypsin treatment of the microsomes
resulted in the loss of the non-imported, signal peptide
containing precursor (sAb42). In contrast, Ab42 was protected from proteolysis in the absence of detergent (lane
2) but was degraded when detergent was added (lane 3),
demonstrating complete import of Ab42 into the microsomal lumen.
To examine the export of Ab42, the loaded microsomes
were re-isolated, washed with high-salt to remove proteins adsorbed to the outside and resuspended in export
buffer. After incubation at 37 °C the reaction was separated into pellet and supernatant. During the chase an
increasing amount of Ab42 became detectable in the
supernatant (Figure 2A, upper panel). This increase was
prevented by incubation on ice (data not shown). The total
amount of Ab42 present after 6 h chase accounted for
114% (12% SE) compared to the amount present at
0 h chase, indicating that the total amount of Ab42 did
not change during the course of the experiment. Kinetic
Figure 1: Import of Ab into microsomes. (A) For the
construction of sAb42, the signal peptide (broken line) of APP
was directly fused to the N-terminus of Ab42 (unbroken line). The
arrow indicates the predicted cleavage site of signal peptidase. (B)
sAb42 was translated in a reticulocyte lysate in the presence of
brain microsomes. After translation, the microsomes were
isolated by centrifugation and treated with trypsin in the
absence or presence of Triton X-100 (TX-100). The reaction
products were analyzed by SDS-PAGE and autoradiography.
90
analysis showed that the export of Ab42 was a fast process
occurring largely during the first 30 min (Figure 2B).
To demonstrate that the export did not result from rupture of the microsomal membranes, the release of the
ER-resident chaperone BiP was determined. BiP was not
released into the supernatant (Figure 2A, lower panel). In
contrast, more than 90% of BiP was released into the
supernatant when the microsomal membrane was disrupted by the addition of detergent (data not shown). The
band running below the BiP band is cytosolic Hsc70, which
is also recognized by the anti BiP-antiserum.
Budding of transport vesicles from the microsomes was
unlikely under the experimental conditions used here.
Nevertheless, the possibility that the Ab42 in the supernatant was contained within transport vesicles and not
translocated across the microsomal membrane was analyzed by protease protection analysis at the end of an
export reaction (Figure 2C). Whereas the non-exported
Ab42 still residing inside the microsomes was protected
from trypsin in the absence of detergent (lane 2), the Ab42
in the supernatant was readily degraded (lane 5). The
susceptibility to trypsin showed that the Ab42 present in
the supernatant was not contained in vesicles but
exported across the microsomal membrane and freely
accessible in the buffer.
The retention of BiP in the microsomes did not exclude the
possibility that Ab42 was released due to leakiness of the
microsomes for small molecules. Therefore, the permeability of the microsomes for substances which were
much smaller than Ab42 was determined. For this purpose,
Ab42-loaded microsomes were incubated with sulfo-NHSbiotin (molecular weight 443.4 Da) and the biotinylation of
the lumenal proteins BiP and Glucose-regulated protein 94
(Grp94) was determined by their retention on a streptavidin column followed by immunoblotting. The biotinylation
was performed in either the absence or the presence of
13 mM n-octylglucoside, which served as a positive control
mimicking leaky microsomes. Biotinylation of a membranefree extract of lumenal proteins was equally efficient in
the absence or presence of the detergent, indicating that
the biotinylation itself was not affected by the detergent
(Figure 3A). In contrast, in the Ab42-loaded microsomes
biotinylation of BiP and Grp94 was almost undetectable
in the absence of the detergent, but was readily observed
in its presence (Figure 3B; compare lane 3 with 4 and lane
5 with 6, respectively). Quantitative analysis showed that
1.1% (0.6% SE, n ¼ 3) of the total Grp94 was accessible
for the sulfo-NHS-biotin in the absence of detergent
as compared to 20.1% (9.0% SE) in the presence of
detergent. Complete biotinylation in the presence of
detergent was not achievable because this would have
required complete permeabilization of the microsomes
and would have resulted in the total loss of Grp94. The
finding that the low molecular weight sulfo-NHS-biotin did
not penetrate the microsomes as long as the membrane
Traffic 2004; 5: 89–101
Cytosolic Degradation of Ab42
Figure 2: Ab42 is exported from
microsomes. (A) After loading with
Ab42 by in vitro translation, the
microsomes were re-isolated, highsalt-washed, resuspended in export
buffer containing 5 mg/ml cytosol
and divided into aliquots. One
aliquot was directly separated into a
pellet and a supernatant fraction, the
other aliquots were first incubated
for the indicated time at 37 °C. The
reaction products were analyzed by
SDS-PAGE. Ab42 was visualized by
autoradiography. BiP was immunodetected using an anti BiP-antiserum
which cross-reacts with cytosolic
Hsc70. (B) Graphical representation
of 5 independent export reactions
performed as described above. The
error bars represent the standard
deviation. (C) To exclude the possible
localization of the exported Ab42 in
vesicles, a proteolysis protection
analysis was performed. At the end
of a 1-h export reaction performed as
in (A), the microsomal pellet
containing the non-exported Ab42 (p)
and the supernatant containing the
exported Ab42 (s) were treated with
trypsin in the absence or presence of
Triton X-100 (TX-100).
was not permeabilized by the detergent showed that the
microsomes were sealed by an intact membrane, and
strongly argued against the possibility that the export of
Ab42 was a result of microsomal leakiness.
To analyze whether the export of Ab42 required ATP, export
reactions were performed in the presence of an ATP
depleting or regenerating system, respectively. Unexpectedly, the export of Ab42 was independent of ATP (Figure
4A). Ab42 is a relatively small molecule of 4.5 kDa, which
may fit into the presumed translocation channel without
the need of ATP-dependent unfolding. Therefore, we
Traffic 2004; 5: 89–101
reasoned that elongation of the peptide might render its
export ATP dependent. To test this assumption, the export
of Ab42 which had been N-terminally elongated by 42
(42Ab42) or 81(81Ab42) amino acids was analyzed (Figure
4B). Increasing the length of the peptides resulted in an
increasing ATP dependence of their export (Figure 4C).
This correlation suggested that it was indeed the small
size of Ab42 which allowed its ATP-independent export.
As the export of ERAD substrates appears to be mediated
by the Sec61p complex, its involvement in the export of
Ab42 was investigated. This channel also mediates the
91
Schmitz et al.
demonstrated that the export of Ab42 was mediated by the
Sec61p complex.
As known so far, the export of ERAD substrates depends
on cytosolic proteins. To test whether cytosolic proteins
were also required for the export of Ab42 high-salt-washed,
Ab42-loaded microsomes were incubated in the presence
of 5 mg/ml brain cytosol which had been inactivated by
heating (95 °C, 10 min). Heat inactivation of the cytosol
almost completely inhibited the export (Figure 6A). The
stimulatory effect of the untreated, active cytosol was
concentration dependent (Figure 6B).
Figure 3: Ab42-loaded microsomes are sealed by a tight
membrane. (A) Membrane-free lumenal ER-proteins were
incubated with sulfo-NHS-biotin in the absence or presence of
n-octylglucoside (OG). Biotinylated proteins were detected by
streptavidin-peroxidase. (B) Ab42-loaded microsomes were
incubated with sulfo-NHS-biotin in the absence or presence of
n-octylglucoside (OG). The microsomes were lysed and BiP (lanes
1–4) and Grp94 (lanes 5–8) were identified by immunoblotting
either directly in the lysate (total; lanes 1, 2, 7, 8) or after the
biotinylated proteins had been separated on a streptavidin column
(biotinylated, lanes 3–6). The eluate from the column was
normalized to the total amount of BiP or Grp94, respectively,
present in the lysate.
import of proteins into the ER. Therefore, the export of
proteins can be inhibited by blocking the channel with
ribosome nascent chain complexes (RNCs), which are
short polypeptides still bound to the ribosome (13). For
this purpose, the Sec61p complexes of Ab42-loaded microsomes were saturated with RNCs formed of a 75-aminoacids-long fragment of cholera toxin subunit A (CTAD137;
Figure 5A). As the signal peptide-containing CTAD137 is
stably inserted into the Sec61p channel, it should inhibit
the export of Ab42 if the export is mediated by the Sec61p
complex. As a control, a 75-amino-acids-long fragment
of dihydrofolate reductase (DHFRD112) was used.
DHFRD112 which lacks a signal peptide for import into
the ER does not stably interact with the channel and thus
should be ineffective. Export reactions performed in the
presence of the RNCs showed that this was indeed the
case (Figure 5B). The export of Ab42 was blocked by
CTAD137 (upper panel), but proceeded undisturbed in the
presence of DHFRD112 (lower panel). The ongoing recruitment of CTAD137 during the first 30 min of the export
reaction is explained by the fact that the microsomes had
to be preincubated with the RNCs on ice, which is less
efficient than binding at 37 °C. Preincubation at 37 °C was
not possible because then Ab42 would have been exported
before the blocking of the Sec61p complex was effective.
The selective inhibition by signal peptide-containing RNCs
92
The finding of about 40% of total Ab42 in the cytosol
showed that the export of Ab42 and its degradation were
not as tightly coupled as reported for other ERAD substrates. In some cases, the tight coupling of export and
degradation is thought to result from the proteasome
being involved not only in the actual degradation but also
in the retro-translocation itself. Therefore, the export of
Ab42 was performed in the absence of proteasomes. For
this purpose, the cytosol was depleted of proteasomes by
ultracentrifugation (Figure 6C). However, the export of
Ab42 was not affected by the depletion (Figure 6D), indicating that it did not require the proteasome.
Exported Ab 42 is degraded by the proteasome and
insulin-degrading enzyme
To analyze whether Ab42 was, after its export, degraded
by the proteasome, HeLa cells were transfected with
ER-targeted Ab42 and chased in the presence or absence
of the proteasome inhibitor MG-132 (Figure 7). Indeed, the
degradation of Ab42 was attenuated by the proteasome
inhibitor. However, the inhibition was not complete and
about 70% of Ab42 were still degraded in the presence of
MG-132, suggesting that an alternative pathway might
contribute to the degradation of ER-localized Ab42.
Reports exist on the IDE-mediated degradation of Ab in
cell culture (26–28) and in a mouse model (29), and the
degradation of Ab was reconstituted with purified IDE
(26,30). These studies concentrated on extracellular Ab
and Ab found in the secretory and endocytic pathways.
But as IDE is predominantly localized in the cytosol (31),
the degradation of cytosolic Ab42 could also be mediated
by IDE. Therefore, RNA interference was used to investigate the involvement of IDE in the degradation of
ER-localized Ab42. To deplete cells of IDE, HeLa cells were
transfected with IDE-specific small interfering doublestranded RNA (siRNA). Immunoblot analysis verified that
transfection with siRNA, but not with single-stranded
sense RNA used as a control, induced the depletion of
the majority of IDE (Figure 8A). In cell culture Ab42 is
found in a soluble and an insoluble form (32). To analyze
both fractions, the RIPA-soluble Ab42 was immunoprecipitated, whereas the RIPA-insoluble material was extracted
by sonification in 2 concentrated sample buffer containing
Traffic 2004; 5: 89–101
Cytosolic Degradation of Ab42
Figure 4: Export of Ab42 is independent of ATP. (A) Ab42-loaded
microsomes were used for an export
reaction as described in Figure 2(A) in
the presence of an ATP-depleting (–
ATP) or ATP-regenerating (þ ATP)
system, respectively. (B) Ab42 was
extended at its N-terminus by either
42 amino acids (42Ab42; upper panel)
or 81 amino acids (81Ab42; lower
panel). Microsomes were loaded by
in vitro translation of the respective
construct and used for an export
reaction as in (A). (C) Graphical
representation of export reactions
performed as in (A) and (B). The
columns show the export after 1 h
incubation. For the calculation of the
export rate, the material present in the
supernatant at 0 min chase was
subtracted. The error bars give the
standard error (n ¼ 3).
5% SDS and directly loaded on the gel (see Materials and
Methods). By this procedure, Ab42 is the only peptide
found in the RIPA-insoluble fraction of sAb42-transfected
Traffic 2004; 5: 89–101
HeLa cells without any background of other peptides of
the same molecular weight (Figure 8B). The result was
verified by formic acid extraction. Immunoprecipitation
93
Schmitz et al.
Figure 5: Export of Ab42 is mediated
by the Sec61p complex. (A)
Microsomes were incubated with
CTAD137 isolated from the indicated
volumes of a translation reaction. After
washing with high-salt buffer the
microsomes were isolated, and the
CTAD137 bound in a salt-resistant
manner was visualized. Saturation of
binding was achieved with a 40-ml
translation reaction. (B) Ab42-loaded
microsomes were reisolated, resuspended in export buffer containing
5 mg/ml cytosol and split into two
aliquots. One aliquot was incubated for
10 min on ice with saturating amounts
(corresponding to a 40-ml translation
reaction) of the signal peptidecontaining CTA1D137 (upper panel), the
other with DHFRD112 which did not
contain a signal peptide and was used as
a control (lower panel). After binding of
the RNCs, the microsomes were used
for an export reaction as described in
Figure 2(A). Ab42 , CTAD137 and
DHFRD112 were detected by autoradiography.
was omitted because immunoprecipitation of RIPA-insoluble
Ab42 is not quantitative [own observation and (32)]. To
determine the degradation rate of Ab42, HeLa cells were
cotransfected with sAb42 and either IDE-specific siRNA or
sense RNA as a control. The cells were labeled for 15 min
with [35S]-methionine and chased for up to 2 h. Where
indicated, 20 mM MG-132 was present during the entire
pulse and chase periods to inhibit the proteasome (Figure
8C). When used alone, either inhibitor, MG-132 (lanes 1–3)
or the siRNA treatment (lanes 10–12), inhibited the degradation of Ab42 only weakly. Efficient inhibition required the
presence of both inhibitors (lanes 7–9). The inhibition by
either inhibitor alone was not statistically significant (Figure
8D). However, when both proteases, IDE and the proteasome, were inhibited the degradation of soluble and total
Ab42 was statistically significantly reduced, indicating that
both proteases contributed to its degradation. If the two
proteases operated sequentially in a common proteolytic
pathway, each inhibitor should have led to the same
degree of inhibition as their combined use. However, the
inhibitory effects were additive, indicating that the proteasome and IDE were part of two independent parallel
pathways.
94
For the experiments described above, sAb42 was
expressed from the strong CMV promoter. Therefore,
the inhibitory effect of MG-132 on the degradation of
soluble Ab42, although not found for total Ab42, could
have indicated that at lower expression levels Ab would
be degraded, like other ERAD substrates, only by the
proteasome-dependent pathway, and that it became a
substrate for the normally unused IDE-dependent pathway
only because the proteasome-dependent pathway was
saturated. To exclude this possibility a minimal HSV thymidine kinase promoter, a promoter much weaker than the
CMV promoter, was used to express sAb42. The expression level of sAb42 under control of this promoter was
reduced to 15% (5% SE) as compared to the expression
level under control of the CMV promoter. Under this condition, insoluble Ab42 was not detectable (not shown). The
soluble Ab42 was almost completely degraded in the first
hour of the chase as long as one protease, the proteasome
or IDE, was active (Figure 9A). Neither MG-132 (lanes 1–3,
upper panel) nor the siRNA treatment (lanes 4–6, lower
panel) resulted in significant inhibition. Only the simultaneous inhibition of both proteases reduced the degradation
of Ab42 (lanes 1–3, lower panel). When both proteases
Traffic 2004; 5: 89–101
Cytosolic Degradation of Ab42
Figure 6: Export of Ab42 requires
cytosol but is independent of the
proteasome. (A) After loading with
Ab42, the microsomes were washed
with 0.5 M potassium acetate to
remove adsorbed cytosolic proteins.
The microsomes were resuspended in
export buffer containing 5 mg/ml
untreated or heat-inactivated brain
cytosol, respectively. The export
reaction was performed as described
in Figure 2(A). p, pellet; s, supernatant.
(B) Graphical representation of 3
independent export reactions
performed as in (A) in the presence of
the indicated concentrations of
untreated cytosol. The error bars
represent the standard error. (C) For
the depletion of proteasomes the
cytosol was centrifuged at 500 000 g
for 1 h. The supernatant was recovered
and the absence of proteasomes
verified by immunodetection using an
antibody against subunit a7 of the 20S
core of the proteasome. (D) An export
reaction was performed as in (A), the
only difference being that the cytosol
was depleted of proteasomes by
ultracentrifugation.
Traffic 2004; 5: 89–101
95
Schmitz et al.
were active, the amount of Ab42 detectable directly after
the pulse (lane 4, upper panel) was less than in the presence of inhibitors because a major fraction was degraded
already during the pulse. This rapid degradation rate
implies fast export of Ab42 from the ER, which is in full
agreement with the export kinetics determined in the cellfree assay (see Figure 2B). The degradation of Ab42 was
statistically significantly reduced only when both proteases, the proteasome and IDE, had been inhibited (Figure 9B). This finding indicated that each of the two
pathways was functional independently of the other and
could compensate the inhibition of the other. The redundancy of these two pathways explains why inhibition of
the proteasome did not alter the turnover of Ab42 in an
APP-transfected neuronal cell line (33), a model in which
low levels of Ab were generated. In summary, our results
show that ER-localized Ab42 is degraded by two distinct
cytosolic degradation pathways, one being dependent on
the proteasome and the other on IDE.
Therefore, one possible explanation for the inefficient
degradation is that the exported Ab42 is not ubiquitinated.
To our knowledge, with the exception of pro-a factor (35),
all ERAD substrates known so far are polyubiquitinated
during their export, and the polyubiquitination is required
for their efficient degradation. The AAA-ATPase p97/
Cdc48 which binds to mono- and polyubiquitinated proteins when associated with Ufd1/Npl4 (36) has been
shown to be required for the export and degradation of
several ERAD substrates (37–41). Thus this factor might
possibly provide the link between export and efficient
targeting to the proteasome. The function of p97 is, however, ATP dependent (42), arguing against its involvement
in the export of Ab42. Indeed, recent experiments showed
that the export of Ab42 was independent of p97 (data not
shown). It should be mentioned that the proteasome is
able to degrade at least some proteins without their prior
ubiquitination, e.g. ornithine decarboxylase (43) or pro-a
factor (35). Thus, the lack of ubiquitination may only partially explain why the proteasome degrades the exported
Ab42 less efficiently than other ERAD substrates.
Discussion
An unexpected feature of the export of Ab42 is its independence of ATP. Although it is generally accepted that protein
export from the ER to the cytosol is an ATP-dependent
process, it should be noted that the experimental data
on the membrane translocation itself are rather limited. To
our knowledge, unglycosylated pro-a factor (44) and MHC
class I heavy chain (14,45) are the only ERAD substrates
for which the ATP dependence of the actual export has
been shown. Our results show that increasing the length
of the Ab42 peptide resulted in a corresponding increase in
the ATP dependence of the export. They are therefore in
line with the assumption that it is the small size of Ab42
which allows its ATP-independent export. It is assumed
that ATP is required for the unfolding of the export substrate to fit into the translocation channel formed by the
Sec61p complex. Alternatively, an ATP-dependent conformational rearrangement of the translocation channel may
permit the transit of a folded protein, as has been suggested for MHC class I heavy chain (46). As N-glycans are
rather bulky and rigid structures extending from the protein
backbone, such a conformational rearrangement may also
explain why the export of glycopeptides from the ER is
ATP dependent (47,48). However, all these constraints
may not pertain to the small and unglycosylated Ab42
peptide, resulting in an ATP-independent export process.
The ATP independence of the basic export mechanism
does not, however, exclude the existence in vivo of superimposed ATP-dependent regulatory mechanisms which
may have not been active in the export assay.
In this study, we have identified the export of Ab42 to the
cytosol followed by its IDE-mediated degradation as an as
yet unknown type of ERAD. The independence of proteasomes distinguishes this pathway from the general paradigm of ERAD, which is characterized by the tight coupling
of export and proteasomal degradation. The uncoupling of
export from proteasomal degradation has recently been
described for ricin (11) and cholera toxin (13,34). Ab42 is,
however, the first endogenous protein for which this
uncoupling has been demonstrated.
The reason why Ab42 is not as efficiently degraded by the
proteasome as other ERAD substrates is as yet unknown.
In the export experiments the molecular weight of the
exported Ab42 was unchanged, and Ab42 could not be
precipitated with anti-ubiquitin antibody (data not shown).
Figure 7: The degradation of ER-localized Ab42 is only
partially sensitive to inhibition of the proteasome. HeLa
cells were transfected with ER-targeted Ab42 and chased in the
presence or absence of the proteasome inhibitor MG-132. Ab42
was immunoprecipitated and visualized by autoradiography. The
numbers give the relative amount of Ab42 (0 h: 100%).
96
The cytosolic degradation of ER-localized Ab42 may be
relevant for the pathogenesis of AD. On one hand, it constitutes a clearance mechanism for ER-localized Ab42,
which explains why Ab is found in the ER only upon overexpression of APP. Thus it may prevent Ab-induced disturbance of ER function and represents a potentially
Traffic 2004; 5: 89–101
Cytosolic Degradation of Ab42
Figure 8: ER-localized Ab42 is degraded by both the proteasome and IDE. (A) HeLa cells were cotransfected with pCIsAb42 and
single-stranded sense RNA or IDE-specific siRNA, respectively. Two days after transfection, IDE was detected by immunoblotting. HeLa,
untransfected HeLa cells. (B) The RIPA-insoluble fractions of untransfected (HeLa) or sAb42-transfected (Ab) HeLa cells were extracted
with either 5% SDS as described in Materials and Methods or with formic acid and separated by gel electrophoresis. (C) HeLa cells were
transfected as in (A). Two days after transfection, the cells were labeled for 15 min with [35S]-methionine and chased for the indicated
time in the presence or absence of 20 mM MG-132 (MG). Ab42 in the RIPA-soluble (sol) and insoluble (insol) cell fractions was detected as
described in Materials and Methods. 75% of the soluble fraction and 25% of the insoluble fraction were loaded on the gel. (D) Statistical
evaluation of 4 independent experiments performed as in (C). For each fraction the amount of Ab42 remaining after 1 h chase is shown
(100%: Ab42 present in the respective fraction at 0 h chase). Total Ab42 corresponds to the sum of soluble and insoluble Ab42 corrected for
the different amounts loaded onto the gel. The bars represent the standard error. The asterisks indicate a level of significance of p < 0.05.
neuroprotective mechanism. On the other hand, the
export of Ab42 may under certain conditions result in its
accumulation in the cytosol. Indeed, Ab has been found in
the cytosol upon overexpression of ER-targeted Ab42 (25)
or APP (49). Cytosolic Ab is able to induce apoptosis even
in the absence of visible aggregates, as was demonstrated
by the cytosolic expression of Ab in transgenic mice (50)
and cell culture (51) model systems, as well as by microinjection of Ab42 into the cytosol of cultured neurons (52).
Traffic 2004; 5: 89–101
However, the relevance of these reports for the pathogenesis of AD was uncertain because Ab is not generated in
the cytosol. Our results provide the missing link between
the generation of Ab in the secretory pathway and its
possible pro-apoptotic effect in the cytosol. They allow
for the hypothesis that insufficient degradation of Ab42
exported from the ER to the cytosol could result in a
cytosolic pool of Ab42 triggering apoptosis. Indirect support
for this hypothesis comes from reports demonstrating that
97
Schmitz et al.
amino acid 42 of Ab. Using the Dovetail PCR cloning
kit (MBI Fermentas, Vilnius, Lithuania) the amplified sequences were ligated in such a way that no additional amino
acids were introduced into the protein (see Figure 1A) and
cloned into the vector pCI-neo (Promega, Madison, WI, USA)
(pCIsAb42). For 42Ab42 and 81Ab42, the 42 or 81 amino
acids directly N-terminal to the Ab region were included.
For the construction of pTKsAb42, the sequence of the
GeneSwitch protein of pSwitch (Invitrogen, Groningen,
the Netherlands) was replaced by the sequence coding
for sAb42. The sequences of all constructs were verified
by DNA sequencing (GATC Biotech, Konstanz, Germany).
For in vitro transcription, the linearized construct was
transcribed with the AmpliScribe T7 Kit (Epicentre
Technologies, Madison, WI, USA). The siRNA sequence
(AAGUCUCCUGAAGACAAGCGA) targeting IDE corresponds
to nucleotides 223–243 of human IDE (EMBL/GenBank Acc.
No. M21188). Sense and antisense RNAs (Dharmacon
Research, Lafayette, CO, USA) were deprotected and
annealed as described (57).
Figure 9: IDE-mediated degradation occurs at low-level
expression of Ab42. (A) For low-level expression of Ab42, HeLa
cells were cotransfected with pTKsAb42 and single-stranded
sense RNA or IDE-specific siRNA, respectively. The degradation
of the soluble Ab42 was analyzed as described in Figure 8(C).
Insoluble Ab42 was not detectable. (B) Statistical evaluation of 3
independent experiments performed as in (A). The amount of
Ab42 remaining after 1 h chase is shown (0 h: 100%). The bars
represent the standard error and the asterisks a level of
significance of p <0.05.
the activities of the proteasome (53) and of IDE (54) are
reduced in the brains from AD patients. In addition, possible genetic linkage of IDE with late-onset AD has been
reported (55,56).
Materials and Methods
Molecular biology methods
For the construction of sAb42, the sequences coding
exactly for the signal peptide or the Ab42 region of APP,
respectively, were amplified by PCR using the cDNA of
human APP695 as a template. The 30 -primer for the amplification of the Ab42 region introduced a stop codon after
98
Export assay
Microsomes were prepared from the gray matter of porcine brain or from pancreas obtained from the local slaughter house (58). Both types of microsomes gave identical
results in the export assay. The export assay was performed as described (13) with minor modifications. All
microsomes used for an experiment were loaded in a
single in vitro translation reaction containing 50% reticulocyte lysate (Promega), 0.3 mCi/ml [35S]-methionine, 20 ng/ml
mRNA, 0.4 U/ml RNase inhibitor (MBI Fermentas) and
0.1 eq/ml microsomes [for definition of eq, see (58)]. After
10 min at 30 °C, the translation was stopped with puromycin (2 mM final concentration). The microsomes were isolated by centrifugation (9000 g, 10 min, 4 °C) and washed
in 0.5 M potassium acetate, pH 7.4 for 20 min on ice. After
centrifugation the microsomes were resuspended in cold
PBS containing the indicated concentration of cytosol
and 10 mM EDTA, divided into aliquots (corresponding to
a 10-ml translation reaction) and chased at 37 °C. After the
chase the microsomes were re-isolated by centrifugation.
The proteins in the pellet and the supernatant were separated on a 10% NuPAGE/MES gel system (Invitrogen),
blotted onto nitrocellulose membrane, exposed on a Cyclone
Storage Phosphor System (Packard, Meriden, CT, USA)
and quantified using the OptiQuant 3.0 software (Packard).
The ATP-regenerating system contained 2 mM MgCl2,
1 mM ATP, 10 mM creatine phosphate, 200 mg/ml creatine
kinase, the ATP-depleting system 2 mM MgCl2, 5 mM glucose, 60 U/ml hexokinase. In these experiments EDTA
was omitted.
The blocking of the Sec61p complex was performed as
described (13), the only modifications being that RNCs
isolated from a 40-ml translation reaction were sufficient
to saturate the brain microsomes, and that the binding of
the RNCs was performed on ice.
Traffic 2004; 5: 89–101
Cytosolic Degradation of Ab42
Biotinylation of microsomes
Ab42-loaded microsomes were incubated for 30 min at
room temperature in 1 mM puromycin, 500 mM KCl,
50 mM Hepes-KOH, pH 7.5. The re-isolated microsomes
were incubated for 30 min at 37 °C in PBS containing
5 mM sulfo-NHS-biotin and, where indicated, 13 mM n-octylglucoside. After quenching the unreacted sulfo-NHS-biotin
with 50 mM Tris-Cl, pH 8.0 and washing in TBS, the microsomes were lysed in 50 mM Tris-Cl, pH 8.0, 300 mM NaCl,
0.5% NP-40. The biotinylated proteins were captured
using streptavidin mMACS paramagnetic beads (Miltenyi
Biotech, Bergisch Gladbach, Germany). BiP and Grp94
were visualized in the eluate from the beads and in the
total lysate, using anti-BiP antiserum (SantaCruz Biotechnology, Santa Cruz, CA, USA) or anti-Grp94 monoclonal
antibody (StressGen, Canada).
Protease protection analysis
Ab42-loaded microsomes were resuspended in PBS containing 200 mg/ml trypsin and, where indicated, 1% Triton
X-100. After incubation for 30 min on ice, the products
were analyzed as above. To test whether the exported
Ab42 was contained in vesicles, a 45-min export reaction
was separated into the microsomal pellet and the supernatant. Both fractions were treated with trypsin or trypsin
and detergent as above.
Preparation of cytosol
The gray matter of porcine brain cortices was homogenized using a Potter-Elvehjem homogenizer in 4 vol. (v/w)
homogenization buffer (20 mM Tris-Cl, pH 7.4, 250 mM
sucrose, 25 mM KCl, 5 mM MgCl2). The homogenate was
centrifuged successively at 10 000 g for 20 min and at
100 000 g for 2 h. The supernatant was precipitated with
ammonium sulfate (90% saturation). The resulting pellet
was solubilized in homogenization buffer, followed by
chromatography on a desalting column equilibrated in
homogenization buffer.
To remove proteasomes, brain cytosol was centrifuged at
500 000 g for 1 h and the supernatant was used for further
experiments. Proteasomes were immunodetected using
an antibody against the a7 subunit (Affiniti Research Products, Mamhead, UK).
Degradation of Ab 42
For high-level expression, HeLa cells in 6-well plates were
transfected with 1 mg pCIsAb42 and 60 pmol siRNA or
single-stranded sense RNA, respectively, using 5.5 ml
Metafectene (Biontex Laboratories, München, Germany).
For low-level expression, pCIsAb42 was substituted by 1 mg
pTKsAb42 and 1 mg pSwitch coding for the GeneSwitch
protein. Expression of the GeneSwitch protein which
enhances the transcription from pTKsAb42 was induced
with 10 nM mifepristone (Invitrogen) for 1 day.
Traffic 2004; 5: 89–101
Two days after transfection, the cells were labeled for
15 min with 200 mCi/ml [35S]-methionine. After the chase
in medium containing unlabeled methionine, the cells
were lysed in RIPA buffer (25 mM Tris-Cl, pH 8.0, 125 mM
NaCl, 0.5% sodium deoxycholate, 0.1% SDS, 1% NP-40,
20 mM EDTA) with protease inhibitors (10 mM E-64, 1 mM
pepstatin A, 2 mM PMSF). The lysate was separated by
centrifugation (18 000 g, 15 min) into a RIPA-soluble and a
RIPA-insoluble fraction. Ab42 was precipitated from the soluble fraction with antibody 6E10. To detect Ab in the RIPAinsoluble fraction, the pellet was resuspended in 2 sample
buffer containing 5% SDS, sonicated with a Branson Sonifier
B-12 (Branson, Danbury, CT, USA) for 5 s at position 2 and
boiled for 5 min. An amount normalized to the soluble fraction
was directly loaded on the gel. Formic acid extraction was
performed as described (32). Statistical significance was
determined by the One-way ANOVA Bonferroni test using the
software Origin 7.0 (OriginLab Corporation, Northampton,
MA, USA).
Acknowledgments
The authors wish to thank Dr E.H. Koo, University of California, San Diego,
for the APP-cDNA, K. Bois and C. Mirschkorsch for technical assistance,
Dr A. Winkeler for help with the low-level expression of Ab, and Dr J. Höhfeld
and Dr A. Haas for valuable discussions. This work was supported by the
Deutsche Forschungsgemeinschaft, Priority Programme ‘Cellular Mechanisms of Alzheimer’s Disease’, and the Bonner Forum Biomedizin.
References
1. Tsai B, Ye Y, Rapoport TA. Retro-translocation of proteins from the
endoplasmic reticulum into the cytosol. Nat Rev Mol Cell Biol
2002;3:246–255.
2. Kostova Z, Wolf DH. For whom the bell tolls: protein quality control of
the endoplasmic reticulum and the ubiquitin-proteasome connection.
EMBO J 2003;22:2309–2317.
3. McCracken AA, Brodsky JL. Evolving questions and paradigm shifts
in endoplasmic-reticulum-associated degradation (ERAD). Bioessays
2003;25:868–877.
4. Biederer T, Volkwein C, Sommer T. Role of Cue1p in ubiquitination and
degradation at the ER surface. Science 1997;278:1806–1809.
5. Bordallo J, Plemper RK, Finger A, Wolf DH. Der3p/Hrd1p is required for
endoplasmic reticulum-associated degradation of misfolded lumenal
and integral membrane proteins. Mol Biol Cell 1998;9:209–222.
6. Mayer TU, Braun T, Jentsch S. Role of the proteasome in membrane
extraction of a short-lived ER-transmembrane protein. EMBO J
1998;17:3251–3257.
7. Schubert U, Anton LC, Bacik I, Cox JH, Bour S, Bennink JR, Orlowski M,
Strebel K, Yewdell JW. CD4 glycoprotein degradation induced by
human immunodeficiency virus type 1 Vpu protein requires the function of proteasomes and the ubiquitin-conjugating pathway. J Virol
1998;72:2280–2288.
8. Chillaron J, Haas IG. Dissociation from BiP and retrotranslocation of
unassembled immunoglobulin light chains are tightly coupled to proteasome activity. Mol Biol Cell 2000;11:217–226.
9. Wiertz EJ, Jones TR, Sun L, Bogyo M, Geuze HJ, Ploegh HL. The
human cytomegalovirus US11 gene product dislocates MHC class I
heavy chains from the endoplasmic reticulum to the cytosol. Cell
1996;84:769–779.
99
Schmitz et al.
10. Johnston JA, Ward CL, Kopito RR. Aggresomes: a cellular response to
misfolded proteins. J Cell Biol 1998;143:1883–1898.
11. Simpson JC, Roberts LM, Romisch K, Davey J, Wolf DH, Lord JM.
Ricin A chain utilises the endoplasmic reticulum-associated protein
degradation pathway to enter the cytosol of yeast. FEBS Lett
1999;459:80–84.
12. Wesche J, Rapak A, Olsnes S. Dependence of ricin toxicity on translocation of the toxin A-chain from the endoplasmic reticulum to the
cytosol. J Biol Chem 1999;274:34443–34449.
13. Schmitz A, Herrgen H, Winkeler A, Herzog V. Cholera toxin is exported
from microsomes by the Sec61p complex. J Cell Biol 2000;148:
1203–1212.
14. Wiertz EJ, Tortorella D, Bogyo MYuJ, Mothes W, Jones TR, Rapoport TA,
Ploegh HL. Sec61-mediated transfer of a membrane protein from
the endoplasmic reticulum to the proteasome for destruction. Nature
1996;384:432–438.
15. Pilon M, Schekman R, Romisch K. Sec61p mediates export of a misfolded secretory protein from the endoplasmic reticulum to the cytosol
for degradation. EMBO J 1997;16:4540–4548.
16. Plemper RK, Bohmler S, Bordallo J, Sommer T, Wolf DH. Mutant
analysis links the translocon and BiP to retrograde protein transport
for ER degradation. Nature 1997;388:891–895.
17. Zhou M, Schekman R. The engagement of Sec61p in the ER dislocation process. Mol Cell 1999;4:925–934.
18. Wilkinson BM, Tyson JR, Reid PJ, Stirling CJ. Distinct domains within
yeast Sec61p involved in post-translational translocation and protein
dislocation. J Biol Chem 2000;275:521–529.
19. Selkoe DJ. Alzheimer’s disease: genes, proteins and therapy. Physiol
Rev 2001;81:741–766.
20. Cook DG, Forman MS, Sung JC, Leight S, Kolson DL, Iwatsubo T,
Lee VM, Doms RW. Alzheimer’s A beta (1–42) is generated in the
endoplasmic reticulum/intermediate compartment of NT2N cells. Nat
Med 1997;3:1021–1023.
21. Hartmann T, Bieger SC, Bruhl B, Tienari PJ, Ida N, Allsop D, Roberts GW,
Masters CL, Dotti CG, Unsicker K, Beyreuther K. Distinct sites of
intracellular production for Alzheimer’s disease A beta40/42 amyloid
peptides. Nat Med 1997;3:1016–1020.
22. Wild-Bode C, Yamazaki T, Capell A, Leimer U, Steiner H, Ihara Y, Haass C.
Intracellular generation and accumulation of amyloid beta-peptide
terminating at amino acid 42. J Biol Chem 1997;272:16085–16088.
23. Greenfield JP, Tsai J, Gouras GK, Hai B, Thinakaran G, Checler F,
Sisodia SS, Greengard P, Xu H. Endoplasmic reticulum and transGolgi network generate distinct populations of Alzheimer beta-amyloid
peptides. Proc Natl Acad Sci USA 1999;96:742–747.
24. Wilson CA, Doms RW, Zheng H, Lee VM. Presenilins are not required
for A beta 42 production in the early secretory pathway. Nat Neurosci
2002;5:849–855.
25. Bückig A, Tikkanen R, Herzog V, Schmitz A. Cytosolic and nuclear
aggregation of the amyloid beta-peptide following its expression in
the endoplasmic reticulum. Histochem Cell Biol 2002;118:353–360.
26. Chesneau V, Vekrellis K, Rosner MR, Selkoe DJ. Purified recombinant
insulin-degrading enzyme degrades amyloid beta-protein but does not
promote its oligomerization. Biochem J 2000;351:509–516.
27. Vekrellis KYeZ, Qiu WQ, Walsh D, Hartley D, Chesneau V, Rosner MR,
Selkoe DJ. Neurons regulate extracellular levels of amyloid betaprotein via proteolysis by insulin-degrading enzyme. J Neurosci
2000;20:1657–1665.
28. Sudoh S, Frosch MP, Wolf BA. Differential effects of proteases
involved in intracellular degradation of amyloid beta-protein between
detergent-soluble and -insoluble pools in CHO-695 cells. Biochemistry
2002;41:1091–1099.
29. Farris W, Mansourian S, Chang Y, Lindsley L, Eckman EA, Frosch MP,
Eckman CB, Tanzi RE, Selkoe DJ, Guenette S. Insulin-degrading
enzyme regulates the levels of insulin, amyloid beta-protein, and the
100
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
beta-amyloid precursor protein intracellular domain in vivo. Proc Natl
Acad Sci USA 2003;100:4162–4167.
Kurochkin IV, Goto S. Alzheimer’s beta-amyloid peptide specifically
interacts with and is degraded by insulin degrading enzyme. FEBS
Lett 1994;345:33–37.
Duckworth WC, Bennett RG, Hamel FG. Insulin degradation. progress
and potential. Endocr Rev 1998;19:608–624.
Skovronsky DM, Doms RW, Lee VM. Detection of a novel intraneuronal pool of insoluble amyloid beta protein that accumulates with time
in culture. J Cell Biol 1998;141:1031–1039.
Skovronsky DM, Pijak DS, Doms RW, Lee VM. A distinct ER/IC
gamma-secretase competes with the proteasome for cleavage of
APP. Biochemistry 2000;39:810–817.
Rodighiero C, Tsai B, Rapoport TA, Lencer WI. Role of ubiquitination in
retro-translocation of cholera toxin and escape of cytosolic degradation.
EMBO Rep 2002;21:21.
Werner ED, Brodsky JL, McCracken AA. Proteasome-dependent
endoplasmic reticulum-associated protein degradation: an unconventional route to a familiar fate. Proc Natl Acad Sci USA 1996;93:
13797–13801.
Meyer HH, Wang Y, Warren G. Direct binding of ubiquitin conjugates
by the mammalian p97 adaptor complexes, p47 and Ufd1-Npl4. EMBO
J 2002;21:5645–5652.
Bays NW, Wilhovsky SK, Goradia A, Hodgkiss-Harlow K, Hampton RY.
HRD4/NPL4 is required for the proteasomal processing of ubiquitinated
ER proteins. Mol Biol Cell 2001;12:4114–4128.
Ye Y, Meyer HH, Rapoport TA. The AAA ATPase Cdc48/p97 and its
partners transport proteins from the ER into the cytosol. Nature
2001;414:652–656.
Braun S, Matuschewski K, Rape M, Thoms S, Jentsch S. Role of the
ubiquitin-selective CDC48 (UFD1/NPL4) chaperone (segregase) in
ERAD of OLE1 and other substrates. EMBO J 2002;21:615–621.
Jarosch E, Taxis C, Volkwein C, Bordallo J, Finley D, Wolf DH, Sommer T.
Protein dislocation from the ER requires polyubiquitination and the
AAA-ATPase Cdc48. Nat Cell Biol 2002;28:28.
Rabinovich E, Kerem A, Frohlich KU, Diamant N, Bar-Nun S. AAA-ATPase
p97/Cdc48p, a cytosolic chaperone required for endoplasmic reticulumassociated protein degradation. Mol Cell Biol 2002;22:626–634.
Ye Y, Meyer HH, Rapoport TA. Function of the p97-Ufd1-Npl4 complex
in retrotranslocation from the ER to the cytosol: dual recognition of
nonubiquitinated polypeptide segments and polyubiquitin chains. J Cell
Biol 2003;162:71–84.
Rosenberg-Hasson Y, Bercovich Z, Ciechanover A, Kahana C. Degradation of ornithine decarboxylase in mammalian cells is ATP dependent
but ubiquitin independent. Eur J Biochem 1989;185:469–474.
McCracken AA, Brodsky JL. Assembly of ER-associated protein degradation in vitro: dependence on cytosol, calnexin, and ATP. J Cell Biol
1996;132:291–298.
Shamu CE, Story CM, Rapoport TA, Ploegh HL. The pathway of US11dependent degradation of MHC class I heavy chains involves a ubiquitinconjugated intermediate. J Cell Biol 1999;147:45–58.
Tirosh B, Furman MH, Tortorella D, Ploegh HL. Protein unfolding is not
a prerequisite for endoplasmic reticulum-to-cytosol dislocation. J Biol
Chem 2003;278:6664–6672.
Romisch K, Schekman R. Distinct processes mediate glycoprotein and
glycopeptide export from the endoplasmic reticulum in Saccharomyces
cerevisiae. Proc Natl Acad Sci USA 1992;89:7227–7231.
Gillece P, Pilon M, Romisch K. The protein translocation channel mediates glycopeptide export across the endoplasmic reticulum membrane.
Proc Natl Acad Sci USA 2000;97:4609–4614.
Grant SM, Ducatenzeiler A, Szyf M, Cuello AC. Abeta immunoreactive
material is present in several intracellular compartments in transfected,
neuronally differentiated, P19 cells expressing the human amyloid
beta-protein precursor. J Alzheimer Dis 2000;2:207–222.
Traffic 2004; 5: 89–101
Cytosolic Degradation of Ab42
50. LaFerla FM, Tinkle BT, Bieberich CJ, Haudenschild CC, Jay G. The
Alzheimer’s A beta peptide induces neurodegeneration and apoptotic
cell death in transgenic mice. Nat Genet 1995;9:21–30.
51. Yan SD, Fu J, Soto C, Chen X, Zhu H, Al-Mohanna F, Collison K, Zhu A,
Stern E, Saido T, Tohyama M, Ogawa S, Roher A, Stern D. An intracellular protein that binds amyloid-beta peptide and mediates neurotoxicity in Alzheimer’s disease. Nature 1997;389:689–695.
52. Zhang Y, McLaughlin R, Goodyer C, LeBlanc A. Selective cytotoxicity of
intracellular amyloid beta peptide1-42 through p53 and Bax in cultured
primary human neurons. J Cell Biol 2002;156:519–529.
53. Keller JN, Hanni KB, Markesbery WR. Impaired proteasome function in
Alzheimer’s disease. J Neurochem 2000;75:436–439.
54. Perez A, Morelli L, Cresto JC, Castano EM. Degradation of soluble
amyloid beta-peptides 1–40, 1–42. and the Dutch variant 1–40Q by
Traffic 2004; 5: 89–101
55.
56.
57.
58.
insulin degrading enzyme from Alzheimer disease and control brains.
Neurochem Res 2000;25:247–255.
Bertram L, Blacker D, Mullin K, Keeney D, Jones J, Basu S, Yhu S,
McInnis MG, Go RC, Vekrellis K, Selkoe DJ, Saunders AJ, Tanzi RE.
Evidence for genetic linkage of Alzheimer’s disease to chromosome
10q. Science 2000;290:2302–2303.
Prince JA, Feuk L, Gu HF, Johansson B, Gatz M, Blennow K, Brookes AJ.
Genetic variation in a haplotype block spanning IDE influences
Alzheimer disease. Hum Mutat 2003;22:363–371.
Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T.
Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured
mammalian cells. Nature 2001;411:494–498.
Walter P, Blobel G. Preparation of microsomal membranes for cotranslational protein translocation. Meth Enzymol 1983;96:84–93.
101